Restriction Map of BRN1/YBL097W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BRN1/YBL097W on chromosome II from coordinates 40831 to 43095.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.27888

DdeI SetI TspDTI TspDTI \ \ \ \ ATGACTACACAACTAAGGTATGAAAATAACGATGACGATGAAAGAGTAGAATATAATCTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGATGTGTTGATTCCATACTTTTATTGCTACTGCTACTTTCTCATCTTATATTAGAG // / / |DdeI TspDTI TspDTI SetI M T T Q L R Y E N N D D D E R V E Y N L * L H N * G M K I T M T M K E * N I I S D Y T T K V * K * R * R * K S R I * S L ----:----|----:----|----:----|----:----|----:----|----:----| X V V C S L Y S F L S S S S L T S Y L R X S * V V L T H F Y R H R H F L L I Y D H S C L * P I F I V I V I F S Y F I I E BinI* | MboI | XhoII | | DpnI | | |BstKTI | | || BccI TsoI | | || | FatI |MboI | | || | |CviAII || DpnI | | || | ||MslI || |BstKTI | | || | ||| BstXI || || MboII | | || | ||| NlaIII || || | BinI* | | || | ||| | ApoI || || | | CviJI | | || | ||| | TspEI || || | | |SfeI* \ \ \\ \ \\\ \ \ \\ \\ \ \ \\ TTTACCAATAGATCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGGTTATCTAGGTGGTACTACCGTTTAAAACTTCTTACCTAGTTTTACCGATGTCTA / // / // /// / / // / / / / | || | || ||FatI TspEI | || | | | SfeI* | || | || |CviAII ApoI | || | | CviJI | || | || MslI | || | BinI* | || | |NlaIII | || MboII | || | |BstXI | || MboI | || | BccI | |DpnI | || XhoII | BstKTI | || MboI TsoI | |DpnI | BstKTI BinI* F T N R S T M M A N F E E W I K M A T D L P I D P P * W Q I L K N G S K W L Q I Y Q * I H H D G K F * R M D Q N G Y R * ----:----|----:----|----:----|----:----|----:----|----:----| K V L L D V M I A F K S S H I L I A V S R * W Y I W W S P L N Q L I S * F P * L K G I S G G H H C I K F F P D F H S C I MboI | DpnI TspEI ApoI | |TaqI MmeI | Hpy178III* TspEI | |BstKTI \ \ \ \ \ \\ AATAAAATCAATTCCCGAAATAGTTGGAATTTCGCATTGATCGACTATTTTTATGACTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTTAGTTAAGGGCTTTATCAACCTTAAAGCGTAACTAGCTGATAAAAATACTGAAC / / / / // // MmeI | Hpy178III* TspEI || |TaqI TspEI ApoI || MboI |DpnI BstKTI N K I N S R N S W N F A L I D Y F Y D L I K S I P E I V G I S H * S T I F M T W * N Q F P K * L E F R I D R L F L * L G ----:----|----:----|----:----|----:----|----:----|----:----| L L I L E R F L Q F K A N I S * K * S K Y Y F * N G F Y N S N R M S R S N K H S I F D I G S I T P I E C Q D V I K I V Q CviRI* |TaqII || BccI || SfaNI MaeII || |StyI | SetI || |SecI* | TaiI || || SetI | | BccI TspEI Hpy188I || || | BsiYI* \ \ \ \ \ \\ \\ \ \ GACGTTTTGAAAGATGGCGAGAATAACATCAATTTTCAGAAAGCATCTGCAACCTTGGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCAAAACTTTCTACCGCTCTTATTGTAGTTAAAAGTCTTTCGTAGACGTTGGAACCTA / / / / / // / / // | | BccI | Hpy188I || | | |SecI* | MaeII TspEI || | | |StyI TaiI || | | BsiYI* SetI || | | SfaNI || | BccI || SetI |CviRI* TaqII D V L K D G E N N I N F Q K A S A T L D T F * K M A R I T S I F R K H L Q P W M R F E R W R E * H Q F S E S I C N L G W ----:----|----:----|----:----|----:----|----:----|----:----| S T K F S P S F L M L K * F A D A V K S P R K S L H R S Y C * N E S L M Q L R P V N Q F I A L I V D I K L F C R C G Q I TaqI |Hpy178III* ||Ksp632I* ||| TfiI BseGI ||| HinfI | MseI ||| | MaeIII SetI | | FokI ||| | Tsp45I | FauI | | |MboII ||| | | TspRI | TspGWI \ \ \\ \\\ \ \ \ \ \ GGGTGTATTAAGATTTACTCTTCGAGAGTTGATTCAGTGACAACGGAAACAGGTAAGTTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCCACATAATTCTAAATGAGAAGCTCTCAACTAAGTCACTGTTGCCTTTGTCCATTCAAT / / / // / / / / / / / BseGI | FokI || | | HinfI Tsp45I SetI | FauI MboII || | | TfiI MaeIII TspGWI MseI || | TspRI || Ksp632I* |Hpy178III* TaqI G C I K I Y S S R V D S V T T E T G K L G V L R F T L R E L I Q * Q R K Q V S Y V Y * D L L F E S * F S D N G N R * V I ----:----|----:----|----:----|----:----|----:----|----:----| P H I L I * E E L T S E T V V S V P L N H T Y * S K S K S L Q N L S L P F L Y T P T N L N V R R S N I * H C R F C T L * MaeIII AciI Tsp4CI* BsrBI SfaNI | TspGWI \ \ \ \ TTGAGCGGGTTGGCACAAAGAAAGACGAATGGGGCATCTAACGGAGATGACAGTAACGGG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCGCCCAACCGTGTTTCTTTCTGCTTACCCCGTAGATTGCCTCTACTGTCATTGCCC / / / / / / | AciI | | | MaeIII BsrBI | | TspGWI | Tsp4CI* SfaNI L S G L A Q R K T N G A S N G D D S N G * A G W H K E R R M G H L T E M T V T G E R V G T K K D E W G I * R R * Q * R G ----:----|----:----|----:----|----:----|----:----|----:----| N L P N A C L F V F P A D L P S S L L P I S R T P V F F S S H P M * R L H C Y R Q A P Q C L S L R I P C R V S I V T V P MnlI | CviJI | | HphI | | | MaeIII | | | Tsp45I | | | | SetI | | | | | MaeIII BinI* | | | | | Tsp45I | MboI | | | | | Tsp4CI* | | DpnI | | | | | | TspRI | | |BstKTI Hin4II* | | | | | | |HphI | | || MseI \ \ \ \ \ \ \ \\ \ \ \\ \ GGAAATGGTGAAGGGCTTGGAGGTGACAGTGACGAAGCAAATATAGAGATTGATCCCTTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTACCACTTCCCGAACCTCCACTGTCACTGCTTCGTTTATATCTCTAACTAGGGAAT / / / / / / / / / // / / / Hin4II* | | | | | | Tsp45I | || | | MseI | | | | | | MaeIII | || | BsiYI* | | | | | | HphI | || MboI | | | | | Tsp4CI* | |DpnI | | | | | Tsp45I | BstKTI | | | | | MaeIII BinI* | | | | TspRI | | | SetI | | HphI | CviJI MnlI G N G E G L G G D S D E A N I E I D P L E M V K G L E V T V T K Q I * R L I P * K W * R A W R * Q * R S K Y R D * S L N ----:----|----:----|----:----|----:----|----:----|----:----| P F P S P S P P S L S S A F I S I S G K P F H H L A Q L H C H R L L Y L S Q D R S I T F P K S T V T V F C I Y L N I G * BinI* TatI | MboI Bsp1407I | | DpnI |Csp6I BsiYI* | | |BstKTI MaeI |Hpy166II | BsrI | | ||Hpy178III* | AciI ||RsaI EciI \ \ \ \ \\\ \ \ \\\ \ ACTGGTATGCCTATATCTAATGATCCTGATGTGAATAACACTAGGCGGAGAGTGTACAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCATACGGATATAGATTACTAGGACTACACTTATTGTGATCCGCCTCTCACATGTTG / / // / / / / ///// / BsrI | || | Hpy178III* | AciI ||||| CspCI | || MboI MaeI ||||EciI | |DpnI |||Bsp1407I | BstKTI |||TatI BinI* ||Csp6I |RsaI Hpy166II T G M P I S N D P D V N N T R R R V Y N L V C L Y L M I L M * I T L G G E C T T W Y A Y I * * S * C E * H * A E S V Q Q ----:----|----:----|----:----|----:----|----:----|----:----| V P I G I D L S G S T F L V L R L T Y L L Q Y A * I * H D Q H S Y C * A S L T C S T H R Y R I I R I H I V S P P S H V V AluI CviJI |MaeI ||SetI MboI ||| BssKI | DpnI ||| EcoRII | CspCI ||| | ScrFI TaqI | |BstKTI ||| | BseBI CspCI AsuII | ||Hpy178III* ||| | TspDTI \ \ \ \\\ \\\ \ \ AGAGTTTTAGAAACAACATTGGTGGAGTTCGAAACGATCAAGATGAAAGAGCTAGACCAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCAAAATCTTTGTTGTAACCACCTCAAGCTTTGCTAGTTCTACTTTCTCGATCTGGTC / /// / / / / / / / | ||| | | | | | | BseBI | ||| | | | | | | ScrFI | ||| | | | | | TspDTI | ||| | | | | MaeI | ||| | | | CviJI | ||| | | | AluI | ||| | | SetI | ||| | Hpy178III* | ||| MboI | ||DpnI | |BstKTI | CspCI AsuII TaqI R V L E T T L V E F E T I K M K E L D Q E F * K Q H W W S S K R S R * K S * T R S F R N N I G G V R N D Q D E R A R P G ----:----|----:----|----:----|----:----|----:----|----:----| L T K S V V N T S N S V I L I F S S S W C L K L F L M P P T R F S * S S L A L G S N * F C C Q H L E F R D L H F L * V L SetI |KasI |HgiCI* TspEI ||AcyI | MseI ||NarI | VspI ||Hin6I | | BinI* StuI |||GlaI | | |TspEI CviJI |||DinI | | || MboI HaeIII |||NlaIV | | || | DpnI |StyI Hin4II* ||||HhaI | | || | |BstKTI |SecI* |TaqI |||||HaeII \ \ \\ \ \\ \\ \\ \\\\\\ GAATTAATAATTGATCCATTATTCAAAAAGGCCTTGGTTGATTTCGATGAAGGTGGCGCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAATTATTAACTAGGTAATAAGTTTTTCCGGAACCAACTAAAGCTACTTCCACCGCGG / // / /// / / / / / / ////// | || | ||| MboI | SecI* | | SetI |||||TspDTI | || | ||DpnI | StyI | TaqI ||||HgiCI* | || | |BstKTI HaeIII Hin4II* ||||KasI | || | TspEI CviJI |||Hin6I | || BinI* StuI |||NarI | |VspI |||AcyI | |MseI ||NlaIV | TspEI ||DinI EcoRII ||GlaI BssKI |HhaI HaeII E L I I D P L F K K A L V D F D E G G A N * * L I H Y S K R P W L I S M K V A P I N N * S I I Q K G L G * F R * R W R Q ----:----|----:----|----:----|----:----|----:----|----:----| S N I I S G N N L F A K T S K S S P P A P I L L Q D M I * F P R P Q N R H L H R F * Y N I W * E F L G Q N I E I F T A G CviRI* | TspRI PleI | | HinfI |TaqI CviRI* TspDTI MseI BtsI | | |SfaNI |MlyI | EcoT22I \ \ \ \ \ \\ \\ \ \ AAGAGTTTATTGTTGAACACATTAAACATAGACAACACTGCAAGAGTCATTTTCGATGCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCAAATAACAACTTGTGTAATTTGTATCTGTTGTGACGTTCTCAGTAAAAGCTACGT / / / / / / // / MseI TspRI CviRI* | | | || CviRI* BtsI | | | |EcoT22I | | | TaqI | | PleI | | MlyI | SfaNI HinfI K S L L L N T L N I D N T A R V I F D A R V Y C * T H * T * T T L Q E S F S M H E F I V E H I K H R Q H C K S H F R C I ----:----|----:----|----:----|----:----|----:----|----:----| L L K N N F V N F M S L V A L T M K S A W S N I T S C M L C L C C Q L L * K R H L T * Q Q V C * V Y V V S C S D N E I C FalI FalI FalI TspEI FalI | TspEI |BciVI MaeII | | MseI || MseI | SetI SetI | | VspI || | SfaNI | TaiI |Hpy166II | | |TspEI \\ \ \ \ \ \\ \ \ \\ TCAATTAAGGATACACAAAACGTAGGGCAAGGTAAACTTCAAAGGAAAGAAGAAGAATTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTAATTCCTATGTGTTTTGCATCCCGTTCCATTTGAAGTTTCCTTTCTTCTTCTTAAT / // / / / / / / / // | || | | | MaeII SetI Hpy166II FalI |MboII | || | | TaiI FalI |VspI | || | | SetI |MseI | || | FalI TspEI | || | FalI | || SfaNI | |MseI | TspEI BciVI S I K D T Q N V G Q G K L Q R K E E E L Q L R I H K T * G K V N F K G K K K N * N * G Y T K R R A R * T S K E R R R I N ----:----|----:----|----:----|----:----|----:----|----:----| D I L S V C F T P C P L S * L F S S S N M L * P Y V F R L A L Y V E F S L L L I * N L I C L V Y P L T F K L P F F F F * MaeI |SetI TatI || CviJI TsoI || |BsrI |Csp6I MboII || |Hin4I ||RsaI | MboII || || TspDTI ||ScaI \ \ \\ \\ \ \\\ ATTGAAAGAGATAGTTTAGTAGATGACGAAAATGAACCTAGCCAGTCATTGATAAGTACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTTCTCTATCAAATCATCTACTGCTTTTACTTGGATCGGTCAGTAACTATTCATGA / / / // / / /// MboII | | || TspDTI | ||TatI TspEI | | |CviJI | |Csp6I | | MaeI | ScaI | | BsrI | RsaI | Hin4I TsoI SetI I E R D S L V D D E N E P S Q S L I S T L K E I V * * M T K M N L A S H * * V L * K R * F S R * R K * T * P V I D K Y S ----:----|----:----|----:----|----:----|----:----|----:----| I S L S L K T S S S F S G L W D N I L V L Q F L Y N L L H R F H V * G T M S L Y N F S I T * Y I V F I F R A L * Q Y T S ApaLI | CviRI* | Hpy166II | | SduI | | BseSI | | HgiAI* | | | SetI | | | | FatI | | | | NcoI | | | | StyI | | | | SecI* | | | | DsaI* Hin4I | | | | |CviAII |TspGWI | | | | ||Hin4I |Tsp4CI* | | | | ||| Hin4I MlyI || TfiI | | | | ||| NlaIII PleI HinfI || HinfI | | | | ||| | Hin4II* \ \ \\ \ \ \ \ \ \\\ \ \ CGTAATGACTCAACCGTAAATGATTCCGTTATTAGTGCACCTTCCATGGAAGATGAGATT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTACTGAGTTGGCATTTACTAAGGCAATAATCACGTGGAAGGTACCTTCTACTCTAA // // // / / /// / // /// / |PleI || |Tsp4CI* HinfI | ||| | || ||Hin4II* MboII MlyI || TspGWI TfiI | ||| | || |DsaI* |HinfI | ||| | || |SecI* Hin4I | ||| | || |StyI | ||| | || |NcoI | ||| | || |FatI | ||| | || CviAII | ||| | |NlaIII | ||| | Hin4I | ||| Hin4I | ||ApaLI | |SetI | Hpy166II | CviRI* HgiAI* BseSI SduI R N D S T V N D S V I S A P S M E D E I V M T Q P * M I P L L V H L P W K M R F * * L N R K * F R Y * C T F H G R * D F ----:----|----:----|----:----|----:----|----:----|----:----| R L S E V T F S E T I L A G E M S S S I E Y H S L R L H N R * * H V K W P L H S T I V * G Y I I G N N T C R G H F I L N Hin4I | Hin4I | | PsiI | | | ApoI | | | TspEI | | | | MboI | | | | BclI | | | | | DpnI | | | | | |BstKTI Hpy178III* | | | | | || TspEI ApoI | MboI MboII | | | | | || | AciI TspEI | | DpnI \ \ \ \ \ \ \\ \ \ \ \ \ \ TTATCTCTTGGTATGGATTTTATAAAATTTGATCAAATTGCGGTGTGTGAAATTTCAGGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGAGAACCATACCTAAAATATTTTAAACTAGTTTAACGCCACACACTTTAAAGTCCT / / / / // / / / / /// | Hin4I PsiI | || BclI | AciI | ||DpnI Hin4I | || MboI TspEI | |BstKTI | |DpnI | Hpy178III* | BstKTI TspEI TspEI ApoI ApoI L S L G M D F I K F D Q I A V C E I S G Y L L V W I L * N L I K L R C V K F Q D I S W Y G F Y K I * S N C G V * N F R I ----:----|----:----|----:----|----:----|----:----|----:----| K D R P I S K I F N S * I A T H S I E P K I E Q Y P N * L I Q D F Q P T H F K L * R K T H I K Y F K I L N R H T F N * S AclI TaqI MaeII MseI ClaI | SetI VspI BstKTI | TaiI BsaBI | BinI* DdeI | | TaqI | MboII TaqI \ \ \ \ \ \ \ \ \ TCGATTGAGCAACTAAGGAACGTTGTCGAAGATATTAATCAAGCGAAAGACTTTATCGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTAACTCGTTGATTCCTTGCAACAGCTTCTATAATTAGTTCGCTTTCTGAAATAGCTT // / / / / / / / / / || BinI* | | MaeII TaqI | | MboII TaqI |ClaI | | AclI | VspI |TaqI | TaiI | MseI MboI | SetI BsaBI DdeI S I E Q L R N V V E D I N Q A K D F I E R L S N * G T L S K I L I K R K T L S K D * A T K E R C R R Y * S S E R L Y R K ----:----|----:----|----:----|----:----|----:----|----:----| D I S C S L F T T S S I L * A F S K I S I S Q A V L S R Q R L Y * D L S L S * R R N L L * P V N D F I N I L R F V K D F BslFI TspEI | CviRI* | |MboII | ||Cac8I | ||| TseI | ||| MboII | ||| |BisI | ||| ||BlsI | ||| |||AluI | ||| |||CviJI | ||| |||PvuII MseI | ||| |||NspBII* |HpaI | ||| ||||Eco57I |HindII | ||| ||||Eco57MI |Hpy166II MseI | ||| |||||SetI \\ \ \ \\\ \\\\\\ AATGTTAACAACAGATTTGATAACTTCTTAACTGAAGAAGAATTGCAAGCAGCTGTCCCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAATTGTTGTCTAAACTATTGAAGAATTGACTTCTTCTTAACGTTCGTCGACAGGGT // / // // /// |MseI MseI || || ||NspBII* Hpy166II || || ||PvuII HindII || || ||CviJI HpaI || || ||TseI || || ||AluI || || |Eco57MI || || |Eco57I || || |BisI || || BlsI || || SetI || |MboII || Cac8I |CviRI* |MboII TspEI BslFI N V N N R F D N F L T E E E L Q A A V P M L T T D L I T S * L K K N C K Q L S Q C * Q Q I * * L L N * R R I A S S C P R ----:----|----:----|----:----|----:----|----:----|----:----| F T L L L N S L K K V S S S N C A A T G F H * C C I Q Y S R L Q L L I A L L Q G I N V V S K I V E * S F F F Q L C S D W BtgZI | FatI | |CviAII | ||Cac8I | ||| SphI | ||| NspI | ||| CviRI* | ||| NlaIII | ||| | MwoI | ||| | | AluI | ||| | | CviJI MboII | ||| | | AlwNI BbvI CviRI* BccI | CviJI | ||| | | | SetI \ \ \ \ \ \ \\\ \ \ \ \ GATAATGCAGAAGATGATAGCGATGGCTTTGATATGGGCATGCAACAGGAGCTGTGCTAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTACGTCTTCTACTATCGCTACCGAAACTATACCCGTACGTTGTCCTCGACACGATA / / / / / ///// / // / | CviRI* | | CviJI ||||| | || CviJI BbvI | MboII ||||| | || AluI BccI ||||| | |SetI ||||| | AlwNI ||||| MwoI ||||CviRI* ||||FatI |||CviAII ||Cac8I |BtgZI NlaIII NspI SphI D N A E D D S D G F D M G M Q Q E L C Y I M Q K M I A M A L I W A C N R S C A I * C R R * * R W L * Y G H A T G A V L S ----:----|----:----|----:----|----:----|----:----|----:----| S L A S S S L S P K S I P M C C S S H * L Y H L L H Y R H S Q Y P C A V P A T S I I C F I I A I A K I H A H L L L Q A I Hpy178III* | Hin4I | Hin4I | |BsaBI | || FatI | || BspHI HindII | || |CviAII Hpy166II | || |Hpy178III* FatI | Tsp4CI* | || || NlaIII |CviAII Hin4I | |Csp6I | || || | TspDTI || NlaIII Hin4I TspDTI | ||RsaI \ \\ \\ \ \ \\ \ \ \ \ \\\ CCAGATGAAAATCATGACAATACATCACATGATGAACAAGATGATGATAATGTCAACAGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTACTTTTAGTACTGTTATGTAGTGTACTACTTGTTCTACTACTATTACAGTTGTCA // / / // / / // / / / / / || | | || TspDTI | || Hin4I TspDTI | | RsaI || | | |BspHI | || Hin4I | Tsp4CI* || | | |FatI | |FatI Hpy166II || | | Hpy178III* | CviAII HindII || | | CviAII NlaIII || | NlaIII || BsaBI |Hpy178III* Hin4I Hin4I P D E N H D N T S H D E Q D D D N V N S Q M K I M T I H H M M N K M M I M S T V R * K S * Q Y I T * * T R * * * C Q Q Y ----:----|----:----|----:----|----:----|----:----|----:----| G S S F * S L V D C S S C S S S L T L L D L H F D H C Y M V H H V L H H Y H * C W I F I M V I C * M I F L I I I I D V T TaqI AsuII BccI \ \ ACCACAGGAAGTATATTCGAAAAAGATTTGATGGCATACTTTGACGAAAATCTAAATAGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGTCCTTCATATAAGCTTTTTCTAAACTACCGTATGAAACTGCTTTTAGATTTATCT / / / / Csp6I AsuII BccI MnlI TaqI T T G S I F E K D L M A Y F D E N L N R P Q E V Y S K K I * W H T L T K I * I E H R K Y I R K R F D G I L * R K S K * K ----:----|----:----|----:----|----:----|----:----|----:----| V V P L I N S F S K I A Y K S S F R F L Y W L F Y I R F L N S P M S Q R F D L Y G C S T Y E F F I Q H C V K V F I * I S GsuI Eco57MI | Csp6I | |RsaI | || ApoI | || TspEI MnlI BsrI | || | MseI DdeI MmeI \ \ \ \\ \ \ \ \ AACTGGAGAGGGAGAGAACATTGGAAAGTACGAAATTTTAAGAAAGCAAACTTAGTGAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGACCTCTCCCTCTCTTGTAACCTTTCATGCTTTAAAATTCTTTCGTTTGAATCACTTA / / // / / / BsrI | |Csp6I | MseI DdeI | RsaI TspEI MmeI Eco57MI ApoI GsuI N W R G R E H W K V R N F K K A N L V N T G E G E N I G K Y E I L R K Q T * * I L E R E R T L E S T K F * E S K L S E * ----:----|----:----|----:----|----:----|----:----|----:----| F Q L P L S C Q F T R F K L F A F K T F F S S L S L V N S L V F N * S L L S L S V P S P S F M P F Y S I K L F C V * H I TfiI FnuDII* HinfI | MboII | Hpy188I | |MmeI Hin4I | | SetI | || SfeI* Hin4I \ \ \ \ \\ \ \ AAAGAATCCGACCTGTTGGAAGAAACGCGAACTACTATAGGAGATACTACTGACAAAAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTAGGCTGGACAACCTTCTTTGCGCTTGATGATATCCTCTATGATGACTGTTTTTG // / / / / / || SetI | MboII SfeI* Hin4I |Hpy188I | MmeI Hin4I HinfI FnuDII* TfiI K E S D L L E E T R T T I G D T T D K N K N P T C W K K R E L L * E I L L T K T R I R P V G R N A N Y Y R R Y Y * Q K H ----:----|----:----|----:----|----:----|----:----|----:----| L S D S R N S S V R V V I P S V V S L F Y L I R G T P L F A F * * L L Y * Q C F F F G V Q Q F F R S S S Y S I S S V F V BccI | BciVI SetI | |TaqI | Hpy178III* | |ClaI Hin4I MboII | | TspEI | || TspGWI Hin4I | MboII | | |MboII \ \\ \ \ \ \ \ \ \\ ACAACGGACGACAAATCGATGGATACGAAGAAGAAGCATAAACAAAAAAAGGTTCTGGAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGCCTGCTGTTTAGCTACCTATGCTTCTTCTTCGTATTTGTTTTTTTCCAAGACCTT // // / / / / / / || |ClaI Hin4I | MboII SetI | MboII || |TaqI Hin4I MboII Hpy178III* || TspGWI |BciVI BccI T T D D K S M D T K K K H K Q K K V L E Q R T T N R W I R R R S I N K K R F W K N G R Q I D G Y E E E A * T K K G S G N ----:----|----:----|----:----|----:----|----:----|----:----| V V S S L D I S V F F F C L C F F T R S C L P R C I S P Y S S S A Y V F F P E P C R V V F R H I R L L L M F L F L N Q F FokI TspGWI | Tth111I | |BbvII* Hin4II* BseGI | || MboII | MnlI \ \ \\ \ \ \ ATTGATTTCTTCAAAACGGATGATAGTTTTGAAGACAAAGTCTTTGCCTCAAAAGGAAGG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTAAAGAAGTTTTGCCTACTATCAAAACTTCTGTTTCAGAAACGGAGTTTTCCTTCC / / / / / / / / TspEI BseGI | | | BbvII* | MnlI | | | MboII Hin4II* | | Tth111I | FokI TspGWI I D F F K T D D S F E D K V F A S K G R L I S S K R M I V L K T K S L P Q K E G * F L Q N G * * F * R Q S L C L K R K D ----:----|----:----|----:----|----:----|----:----|----:----| I S K K L V S S L K S S L T K A E F P L F Q N R * F P H Y N Q L C L R Q R L L F N I E E F R I I T K F V F D K G * F S P FatI |CviAII || NspI || NlaIII || | MseI HpaII \\ \ \ \ ACAAAGATTGACATGCCGATTAAGAACAGAAAGAACGACACACATTATTTACTGCCGGAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTCTAACTGTACGGCTAATTCTTGTCTTTCTTGCTGTGTGTAATAAATGACGGCCTA / // / / | |FatI MseI HpaII | CviAII NlaIII NspI T K I D M P I K N R K N D T H Y L L P D Q R L T C R L R T E R T T H I I Y C R M K D * H A D * E Q K E R H T L F T A G * ----:----|----:----|----:----|----:----|----:----|----:----| V F I S M G I L F L F F S V C * K S G S S L S Q C A S * S C F S R C V N N V A P C L N V H R N L V S L V V C M I * Q R I MseI | BssKI | |SecI* | |HpaII | ||ScrFI | ||CauII* | |||BdaI BseGI FokI TspRI TspDTI | |||BdaI HinfI \ \ \ \ \ \\\\ \ GACTTCCATTTTTCCACTGATAGAATAACAAGATTGTTCATTAAACCGGGGCAGAAAATG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAGGTAAAAAGGTGACTATCTTATTGTTCTAACAAGTAATTTGGCCCCGTCTTTTAC / / / / / / / / BseGI | FokI TspDTI | | | BssKI TspRI | | | SecI* | | CauII* | | HpaII | | ScrFI | BdaI | BdaI MseI D F H F S T D R I T R L F I K P G Q K M T S I F P L I E * Q D C S L N R G R K * L P F F H * * N N K I V H * T G A E N E ----:----|----:----|----:----|----:----|----:----|----:----| S K W K E V S L I V L N N M L G P C F I H S G N K W Q Y F L L I T * * V P A S F V E M K G S I S Y C S Q E N F R P L F H MaeII MnlI | Hpy99I PleI BdaI | |SetI |MlyI BdaI | |TaiI CviJI \\ \ \ \\ \ AGTCTGTTCAGTCATAGGAAGCATACCAGAGGCGACGTTAGTTCGGGGCTTTTTGAAAAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGACAAGTCAGTATCCTTCGTATGGTCTCCGCTGCAATCAAGCCCCGAAAAACTTTTT / / // / / / / HinfI PleI |MnlI | | MaeII CviJI MlyI BdaI | TaiI BdaI | SetI Hpy99I S L F S H R K H T R G D V S S G L F E K V C S V I G S I P E A T L V R G F L K K S V Q S * E A Y Q R R R * F G A F * K K ----:----|----:----|----:----|----:----|----:----|----:----| L R N L * L F C V L P S T L E P S K S F S D T * D Y S A Y W L R R * N P A K Q F T Q E T M P L M G S A V N T R P K K F F Tsp4CI* SduI | AlwNI CviRI* HgiAI* \ \ \ \ AGCACAGTTTCTGCCAACCATTCAAATAACGACATTCCTACTATTGCAGATGAGCACTTT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTGTCAAAGACGGTTGGTAAGTTTATTGCTGTAAGGATGATAACGTCTACTCGTGAAA / / / / | AlwNI | HgiAI* Tsp4CI* | SduI CviRI* S T V S A N H S N N D I P T I A D E H F A Q F L P T I Q I T T F L L L Q M S T F H S F C Q P F K * R H S Y Y C R * A L L ----:----|----:----|----:----|----:----|----:----|----:----| L V T E A L W E F L S M G V I A S S C K F C L K Q W G N L Y R C E * * Q L H A S A C N R G V M * I V V N R S N C I L V K AciI TspEI EciI MnlI MnlI \ \ \ \ \ TGGGCGGATAATTACGAAAGGAAAGAACAAGAGGAAAAAGAAAAGGAGCAGTCTAAAGAG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCGCCTATTAATGCTTTCCTTTCTTGTTCTCCTTTTTCTTTTCCTCGTCAGATTTCTC / / / / / / AciI | EciI MnlI MnlI SetI TspEI W A D N Y E R K E Q E E K E K E Q S K E G R I I T K G K N K R K K K R S S L K R G G * L R K E R T R G K R K G A V * R G ----:----|----:----|----:----|----:----|----:----|----:----| Q A S L * S L F S C S S F S F S C D L S K P P Y N R F S L V L P F L F P A T * L P R I I V F P F F L L F F F L L L R F L Hin6I FatI |GlaI |CviAII |TspGWI || NlaIII |Eco47III || |MboII ||HhaI || || Tsp4CI* SetI |||HaeII || || | HindII | TaqII HphI ||||TaqI || || | Hpy166II \ \ \ \\\\\ \\ \\ \ \ GTTGGTGATGTGGTGGGTGGAGCGCTCGATAATCCGTTTGAAGATGACATGGACGGTGTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCACTACACCACCCACCTCGCGAGCTATTAGGCAAACTTCTACTGTACCTGCCACAA / / //// / / // / / TaqII HphI |||| TaqI | || | Hpy166II |||Hin6I | || | HindII ||Eco47III | || Tsp4CI* ||GlaI | |MboII |HhaI | |FatI TspGWI | CviAII HaeII NlaIII V G D V V G G A L D N P F E D D M D G V L V M W W V E R S I I R L K M T W T V L W * C G G W S A R * S V * R * H G R C * ----:----|----:----|----:----|----:----|----:----|----:----| T P S T T P P A S S L G N S S S M S P T P Q H H P P H L A R Y D T Q L H C P R H N T I H H T S R E I I R K F I V H V T N HindIII | AluI | CviJI | Hin4II* | | SetI CviJI | | | TaqI MnlI HaeIII TspRI BdaI | | | AsuII | MnlI |BsrI |BseRI BdaI \ \ \ \ \ \ \\ \\ \ GACTTCAACCAAGCTTTCGAAGGAACAGATGATAACGAGGAGGCCAGTGTGAAACTTGAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAGTTGGTTCGAAAGCTTCCTTGTCTACTATTGCTCCTCCGGTCACACTTTGAACTA /// / / / / // / / ||| | AsuII | MnlI |HaeIII BseRI BdaI ||| | TaqI MnlI |CviJI BdaI ||| HindIII TspRI ||CviJI BsrI ||AluI |Hin4II* SetI D F N Q A F E G T D D N E E A S V K L D T S T K L S K E Q M I T R R P V * N L I L Q P S F R R N R * * R G G Q C E T * F ----:----|----:----|----:----|----:----|----:----|----:----| S K L W A K S P V S S L S S A L T F S S Q S * G L K R L F L H Y R P P W H S V Q V E V L S E F S C I I V L L G T H F K I BseGI | MboI BdaI | | DpnI BdaI | | |BstKTI |TaqI | | ||FokI MboII ||Hpy178III* MaeIII Hpy178III* \ \ \\\ \ \\\ \ \ TTACAGGATGACGAAGATCATAAGTTCCCCATTCGAGAAAATAAAGTTACTTATTCAAGA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTCCTACTGCTTCTAGTATTCAAGGGGTAAGCTCTTTTATTTCAATGAATAAGTTCT / // / // / // / / BseGI || | |MboII BdaI |Hpy178III* MaeIII Hpy178III* || | FokI BdaI TaqI || MboI |DpnI BstKTI L Q D D E D H K F P I R E N K V T Y S R Y R M T K I I S S P F E K I K L L I Q E T G * R R S * V P H S R K * S Y L F K S ----:----|----:----|----:----|----:----|----:----|----:----| K C S S S S * L N G M R S F L T V * E L N V P H R L D Y T G W E L F Y L * K N L * L I V F I M L E G N S F I F N S I * S MboI | DpnI | |TaqI | |ClaI HindII | |BstKTI Hpy166II MboII | ||MboI | MaeII | MaeII | ||| DpnI TaqI | | SetI | | SetI | ||| |BstKTI AsuII | | TaiI MseI | | TaiI | ||| || TspEI \ \ \ \ \ \ \ \ \ \\\ \\ \ GTTTCGAAAAAAGTTGACGTAAGAAGATTAAAGAAAAACGTATGGAGATCGATCAACAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGCTTTTTTCAACTGCATTCTTCTAATTTCTTTTTGCATACCTCTAGCTAGTTGTTA / // / / / / / // /// / AsuII || MaeII | | | MaeII || ||| MboI TaqI |TaiI | | TaiI || ||DpnI |SetI | | SetI || |BstKTI Hpy166II | MboII || |ClaI HindII MseI || |TaqI || MboI |DpnI BstKTI V S K K V D V R R L K K N V W R S I N N F R K K L T * E D * R K T Y G D R S T I F E K S * R K K I K E K R M E I D Q Q F ----:----|----:----|----:----|----:----|----:----|----:----| T E F F T S T L L N F F F T H L D I L L L K S F L Q R L F I L S F R I S I S * C N R F F N V Y S S * L F V Y P S R D V I FatI |CviAII AluI || NlaIII CviJI Tsp4CI* || | Tsp4CI* | SetI | TspRI \\ \ \ \ \ \ \ TTGATACAAGAACATGACAGTAGGAAAAATAGAGAACAAAGCTCTAATGACAGTGAAACC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AACTATGTTCTTGTACTGTCATCCTTTTTATCTCTTGTTTCGAGATTACTGTCACTTTGG / / // / / / / / TspEI | || Tsp4CI* | CviJI | Tsp4CI* | |FatI | AluI TspRI | CviAII SetI NlaIII L I Q E H D S R K N R E Q S S N D S E T * Y K N M T V G K I E N K A L M T V K P D T R T * Q * E K * R T K L * * Q * N P ----:----|----:----|----:----|----:----|----:----|----:----| K I C S C S L L F F L S C L E L S L S V N S V L V H C Y S F Y L V F S * H C H F Q Y L F M V T P F I S F L A R I V T F G TspDTI |AluI |CviJI |Ecl136II ||BdaI ||BdaI ||SmlI TfiI |||SetI HinfI |||SduI Bce83I* |||SacI Hpy188I | BsaXI |||HgiAI* | EcoRV | | MboII |||HgiJII* | | BsaXI \ \ \ \\\\ \ \ \ CACACAGAAGATGAATCAACAAAGGAGCTCAAGTTTTCTGATATCATTCAGGGTATAAGT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTGTCTTCTACTTAGTTGTTTCCTCGAGTTCAAAAGACTATAGTAAGTCCCATATTCA / / / / //// / / // / | | | MboII |||| SmlI | |BsaXI BdaI | | HinfI |||Ecl136II | EcoRV BdaI | | TfiI |||CviJI Hpy188I | BsaXI |||AluI Bce83I* ||BdaI ||BdaI |HgiJII* |HgiAI* |SacI |SduI |SetI TspDTI H T E D E S T K E L K F S D I I Q G I S T Q K M N Q Q R S S S F L I S F R V * V H R R * I N K G A Q V F * Y H S G Y K * ----:----|----:----|----:----|----:----|----:----|----:----| W V S S S D V F S S L N E S I M * P I L G C L L H I L L P A * T K Q Y * E P Y L V C F I F * C L L E L K R I D N L T Y T HindIII | AluI BdaI Hpy188I | CviJI BdaI | BseGI FokI | | SetI \ \ \ \ \ \ \ AAAATGTATTCGGATGATACACTAAAGGACATTTCAACAAGCTTTTGTTTTATATGCCTT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTACATAAGCCTACTATGTGATTTCCTGTAAAGTTGTTCGAAAACAAAATATACGGAA / / / / / / | BseGI FokI | | HindIII Hpy188I | CviJI | AluI SetI K M Y S D D T L K D I S T S F C F I C L K C I R M I H * R T F Q Q A F V L Y A F N V F G * Y T K G H F N K L L F Y M P S ----:----|----:----|----:----|----:----|----:----|----:----| L I Y E S S V S F S M E V L K Q K I H R Y F T N P H Y V L P C K L L S K N * I G F H I R I I C * L V N * C A K T K Y A K FatI |CviAII || NlaIII || | MwoI DdeI || | TsoI |Hin4II* || | BstAPI || CviJI || | | CviRI* \\ \ \\ \ \ \ CTACACTTAGCCAATGAGCATGGGTTGCAGATAACTCATACCGAAAACTATAATGACTTG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTGAATCGGTTACTCGTACCCAACGTCTATTGAGTATGGCTTTTGATATTACTGAAC / // / // / | |CviJI | |TsoI CviRI* | DdeI | |FatI Hin4II* | BstAPI | CviAII | MwoI NlaIII L H L A N E H G L Q I T H T E N Y N D L Y T * P M S M G C R * L I P K T I M T * T L S Q * A W V A D N S Y R K L * * L D ----:----|----:----|----:----|----:----|----:----|----:----| R C K A L S C P N C I V * V S F * L S K E V S L W H A H T A S L E Y R F S Y H S * V * G I L M P Q L Y S M G F V I I V Q MboI XhoII | DpnI | |BstKTI | ||MaeI TseI MnlI | ||| BinI* |BisI TspEI | ||| | HgaI ||BlsI \ \ \\\ \ \ \\\ ATAGTGAATTATGAGGATCTAGCGACAACACAGGCAGCGTCATAG 2230 2240 2250 2260 ----:----|----:----|----:----|----:----|----: TATCACTTAATACTCCTAGATCGCTGTTGTGTCCGTCGCAGTATC / / // / / / / /// MnlI TspEI || | | BinI* | ||TseI || | MaeI | |BisI || XhoII | BlsI || MboI HgaI |DpnI BstKTI I V N Y E D L A T T Q A A S * * * I M R I * R Q H R Q R H X S E L * G S S D N T G S V I X ----:----|----:----|----:----|----:----|----: I T F * S S R A V V C A A D Y S L S N H P D L S L V P L T M Y H I I L I * R C C L C R * L # Enzymes that cut Frequency Isoschizomers AciI 4 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 7 AluBI AlwNI 2 CaiI ApaLI 1 Alw44I,VneI ApoI 5 AcsI,XapI AsuII 4 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 1 BpuEI BciVI 2 BfuI BclI 1 FbaI,Ksp22I BdaI 6 BinI* 7 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI Bsp1407I 1 BsrGI,BstAUI BspHI 1 CciI,PagI,RcaI BsrBI 1 AccBSI,MbiI BsrI 4 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 13 BstXI 1 BtgZI 1 BtsI 1 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I ClaI 3 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 9 CviJI 15 CviKI-1 CviRI* 9 HpyCH4V DdeI 4 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 13 MalI DsaI* 1 BtgI,BstDSI EciI 2 Ecl136II 1 EcoICRI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 9 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 2 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 6 HpyAV Hin6I 2 HinP1I,HspAI HindII 4 HincII HindIII 2 HinfI 7 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 4 Hpy99I 1 KasI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 5 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 18 MlyI 3 SchI MmeI 3 MnlI 9 MseI 13 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NarI 1 Mly113I NcoI 1 Bsp19I NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PleI 3 PpsI PsiI 1 AanI PvuII 1 RsaI 4 AfaI SacI 1 Psp124BI,SstI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 24 SfaNI 4 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SphI 1 PaeI,BbuI StuI 1 Eco147I,PceI,SseBI,AatI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 15 TaqII 2 TatI 2 TfiI 4 PfeI TseI 2 ApeKI TsoI 3 Tsp45I 3 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 18 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 6 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 3 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BceAI BcgI BetI* BfiI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BseMII BsePI BseYI BsgI BsiI* BsmAI BsmI Bsp120I BspCNI BspLU11I* BspMI BspMII* BspOI BsrDI BssNAI Bst1107I BstEII BstZ17I BtrI Cfr10I Cfr9I CfrI DraII DraIII DrdI Eam1105I Eco31I EcoNI EcoP15I EcoRI Esp3I EspI* FseI FspAI GsaI KpnI MauBI McrI* MfeI MluI MroNI MstI* NaeI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacII SalI SanDI SapI SauI* SexAI SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI SwaI TauI TspMI TstI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769