Chromosome II History Help



 

This page lists all sequence and annotation changes that have been made to the Chromosome II systematic reference sequence since its intial release on 1996-07-31.


SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of Change Old SequenceNew Sequence
2011-02-03YBL077W, YBL078C8074780747DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs ATG8/YBL078C and YBL077W.
New    80708   TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTT-ATTATGATTTTCTCAAC  80766
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    80705   TTCAGACTTAAATGTAGACTTCATGTCTCTAGTAATTATTTTTATTATGATTTTCTCAAC  80764

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03ARS225, YBR275C757291757291DeletionA
 A single nucleotide deletion was made in the intergenic region between ORF RIF1/YBR275C and ARS225.
New    757242  ATCTTCTTGCTAACGATGAGTCGCCAATAAATAAAAAATCGACG-CGTCGGTCAATTATA  757310
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    757237  ATCTTCTTGCTAACGATGAGTCGCCAATAAATAAAAAATCGACGACGTCGGTCAATTATA  757306

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2003-01-03YBR098W, YBR100W442868442868DeletionC
 Due to a change to the systematic sequence of chromosome II (C deletion at 442868), YBR098W and YBR100W have been merged to one single ORF of 691 aa. MMS4 is the standard name for the new, elongated ORF after merging; YBR100W and SLX2 are its aliases. The new coordinates of MMS4/YBR098W are 441473-443548, for a coding sequence of 2076 nt.
We thank Jim Brown (james.brown@stanford.edu), and Kirk Ehmsen (ktehmsen@ucdavis.edu) for reporting this sequence error on Chr II, which was verified in the FY1679 (S288c derivative) strain background by SGD.
Old: 442861 AGAAAACCGTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442920
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 442861 AGAAAAC-GTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442919

Xiao W, et al. (1998) Mms4, a putative transcriptional (co)activator, protects Saccharomyces cerevisiae cells from endogenous and environmental DNA damage. Mol Gen Genet 257(6):614-23
SGD Papers Entry  Pubmed Entry  DOI full text  
Kaliraman V, et al. (2001) Functional overlap between Sgs1-Top3 and the Mms4-Mus81 endonuclease. Genes Dev 15(20):2730-40
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-01-28YBL006C, YBL006W-A216785216785DeletionG
 Kellis et al. 2003 predicted and confirmed the deletion of a single nucleotide at 216785. As a consequence of this sequence change, YBL006C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 145 to 180 amino acids. In addition, YBL006W-A was extended at the 3' end, altering the C-terminus and increasing size of the predicted protein from 39 to 49 amino acids.
New 301 TCAAGTGTCGA-CTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA  359
        ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old     TCAAGTGTCGACCTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03
YBR038W, YBR039W
315071315071DeletionG
315270315271SubstitutionCGGC
 A single nucleotide deletion and a dinucleotide substitution were made in the intergenic region between ORFs CHS2/YBR038W and ATP3/YBR039W.
New    315050  TGTATGAGCTGGGCATCAAGAG-CTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA  315108
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    315049  TGTATGAGCTGGGCATCAAGAGGCTTTTGAGATTTTCCAAGTAGTAACTCATCTTTCTGA  315108
New    315229  TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGAGCTGTCGCTAGAACTAGTA  315288
               |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Old    315229  TCGATAAAACAAAAAAAAAGTAAGAAGATATATGAATAGGACGTGTCGCTAGAACTAGTA  315288

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL086C, YBL087C6105661056DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs RPL23A/YBL087C and YBL086C.
New    61019   AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTT-CAAAGCAGTTGGGGGTGT  61077
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    61015   AAAAACTTGGTCTGTTGAAAATAATAACTGCATGGGTTTTTTCAAAGCAGTTGGGGGTGT  61074

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-01-21YBR041W320081320082DeletionCC
 Kellis et al. 2003 and Brachat et al. 2003 independently predicted and confirmed the deletion of two C nucleotides from YBR041W. As a consequence of this change, YBR041W was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 623 to 669 amino acids.
     New:        TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAA--TC
                 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||
Previous: 320025 TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAACCTC 320084

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

1999-04-26
YBR266C, YBR267W
739866739866DeletionG
739912739912DeletionA
 Two changes were made to the systematic sequence of Chromosome II within the ORF REI1/YBR267W. The G at chromosomal coordinate 739866 was deleted, and the A at 739912 was deleted; as a result, the start of YBR267W was moved 294 nt upstream.
Note that the deletion at 739912 also affects the overlapping ORF SLM6/YBR266C; as a result, the stop of YBR266C was moved 111 nt upstream:
Old: 739860 GAGCAGGCGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGAACGTGTTG 739919
            |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||
New: 739860 GAGCAG-CGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGA-CGTGTTG 739917
2004-01-29YBL097W4090040901DeletionGA
 Kellis et al. 2003 predicted and confirmed the deletion of two nucleotides (GA) at chromosomal coordinates 40900-40901. As a consequence of this deletion, YBL097W was extended at the 5' end, altering the N-terminus and increasing the predicted protein from 728 to 754 amino acids.
New  61     TTTACCAATAGA--TCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG  118
            ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||
Old  40888  TTTACCAATAGAGATCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG  40947

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

1999-04-26YBR201W623651623651DeletionA
 A change was made to the systematic sequence of Chromosome II in the region upstream of the ORF DER1/YBR201W. The A at chromosomal coordinate 623651 was deleted. As a result, the start of YBR201W was moved upstream 210 nucleotides, increasing the size of the predicted protein from 141 to 211 amino acids.
Old: 623640 GATCCAGGGAAAGGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623699
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New: 623640 GATCCAGGGAA-GGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623698
2011-02-03YBR200W-A, YBR201W623444623444DeletionC
 A single nucleotide deletion was made in the intergenic region between ORFs YBR200W-A and DER1/YBR201W.
New    623434  GAAGGTATAACAAAA-CAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC  623492
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    623429  GAAGGTATAACAAAACCAGATAGACACCTAATAAAGAACAAAATATTCCTATAGTTTTGC  623488

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1998-09-13
YBL101C
2539425394DeletionT
2540825408InsertionC
2827228272InsertionG
2829628296InsertionC
2830228302InsertionGG
2830628306SubstitutionAG
 Six changes were made to the systematic sequence of Chromosome II within the ORF ECM21/YBL101C and in the adjacent intergenic region. Within the ORF, the T at chromosomal coordinate 25394 was deleted, and a single C was inserted after the C at 25408:
Old: 25381 CGGCATCATCGCTTGTATCCGGATGGCC-ACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439
           ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
New: 25381 CGGCATCATCGCT-GTATCCGGATGGCCCACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439
Upstream of the ORF, a single G was inserted after the G at 28272, a single C was inserted after the C at 28296, two nucleotides (nt) GG were inserted after the G at 28302, and the A at 28306 was changed to a G:
Old: 28260 TTTTTCGCCACCG-TCTTGATGTTATAAACGGCATGCC-AATAGG--TAGAGAAAAATCT 28315
           ||||||||||||| |||||||||||||||||||||||| ||||||  ||| |||||||||
New: 28260 TTTTTCGCCACCGGTCTTGATGTTATAAACGGCATGCCCAATAGGGGTAGGGAAAAATCT 28319
The start site of YBL101C was then moved upstream, extending the size of the coding region from 3234 nt to 3354 nt, and the size of the predicted protein from 728 amino acids (aa) to 754 aa.
2011-02-03
YBL102W, YBL103C
2385523856DeletionCC
2394723947Insertion A
2891328913SubstitutionCA
 Several sequence changes were made in the intergenic region between ORFs RTG3/YBL103C and SFT2/YBL102W.
New    23821   GAAGGCTTTTCTAATCACCATGGCTTTATTATTTC--AAAAGTAACTTGCGAAGAGTCAC  23878
               |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||
Old    23820   GAAGGCTTTTCTAATCACCATGGCTTTATTATTTCCCAAAAGTAACTTGCGAAGAGTCAC  23879
New    23879   ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCAAAAGGCGATTGTAATGAAGAGGGAGT  23938
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    23880   ATCCCGCGGAACGGCCCGCAATCGTGACCCGGCCAAAGGCGATTGTAATGAAGAGGGAGT  23939
New    23939   ATTGGTCAAGACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA  23998
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old    23940   ATTGGTCA-GACTTGTACTATACTGAAATAGGAAGAAGATTGAATAAATTTGCATTCTAA  23998

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR207W
635890635890DeletionA
635882635882Insertion T
635822635822SubstitutionCG
636342636342SubstitutionGA
635192635192SubstitutionAG
635247635247SubstitutionAG
636141636141SubstitutionAG
636306636309SubstitutionAATATATG
636319636322SubstitutionGCTTACTG
636336636336SubstitutionGA
 Nucleotide changes within the coding region of FTH1/YBR207W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 18 is now Glu rather than Lys, residue 36 is now Gly rather than Asp, residue 228 is now Glu rather than Gln, residues 249-250 are now VF rather than YS, residue 334 is now Gly rather than Glu, residues 389-390 are now IC rather than KY, and residues 399-401 are now EKY rather than GKC.
New    635196  GGAATCCTTAGAAATTGTTGTCATTGTTTCTATCCTGTTGACGATCGTCAAACAAGGTCT  635255
               | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Old    635191  GAAATCCTTAGAAATTGTTGTCATTGTTTCTATCCTGTTGACGATCGTCAAACAAGATCT  635250

New    635803  ACCCAAAAAGGTGTGAAATTCAGTGAAAAGTACTCCTTCTTCATATTACCATTTATAACG  635862
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    635798  ACCCAAAAAGGTGTGAAATTCAGTCAAAAGTACTCCTTCTTCATATTACCATTTATAACG  635857

New    635863  ACTTTGAGAGAAGGGTTAGAAGCTGTTGTATTC-ATTGGAGGTATCGGTATTGACCAACC  635921
               ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||
Old    635858  ACTTTGAGAGAAGGGTTAGAAGCTG-TGTATTCAATTGGAGGTATCGGTATTGACCAACC  635916

New    636102  AGACTACGTCAACAAATGTAACGGTCAAGACATGAGTGAAGTAGGAAATGGACCCGGTTC  636161
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    636097  AGACTACGTCAACAAATGTAACGGTCAAGACATGAGTGAAGTAGAAAATGGACCCGGTTC  636156

New    636292  GCCTACTGGTTGGTATTAATATGCGCTTTGAAACTGCTAATGATAGAAGAAAAATACGGA  636351
               ||||||||||||||||||| || ||||||||| || ||||||||||||| ||||| ||||
Old    636287  GCCTACTGGTTGGTATTAAAATACGCTTTGAAGCTTCTAATGATAGAAGGAAAATGCGGA  636346

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-07-12YBR062C366383366383DeletionT
 The work of Cliften et al. 2003 predicted that there is a sequencing error in YBR062C: an single nucleotide should be deleted 100 nt upstream of the currently annotated start site. Assuming this sequence change, Cliften et al. further propose a new intron and 5' exon, and a framechange for this ORF. When spliced, this ORF would now encode a predicted protein of 180 amino acids. This sequence error was confirmed in S288C by SGD and the coordinates have been changed accordingly (start was moved upstream 195 nt and an intron was added at relative coordinates 17-98).
     New: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCT-GACCTGTCTTCTCTGCTCCTCCTGTG
          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
     Old: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCTTGACCTGTCTTCTCTGCTCCTCCTGTG 

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

1999-04-26
YBR069C, YBR070C
378815378815DeletionC
378824378824InsertionC
378810378810InsertionT
 Three changes were made to the systematic sequence of Chromosome II in the intergenic region between the ORFs TAT1/YBR069C and ALG14/YBR070C. A single T was inserted after the T at chromosomal coordinate 378810, the C at 378815 was deleted, and a C was inserted after the G at 378824:
Old: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTT-GGCCCGTCCCGGCG-GGCGAAGAGTGAGAC 378839
            |||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||
New: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTTTGGCC-GTCCCGGCGCGGCGAAGAGTGAGAC 378840
2003-09-29
YBR074W, YBR075W
387625387625DeletionG
387430387430DeletionC
 Due to deletion of a C after the C at position 387430 and a deletion of G after the G at position 387625, YBR074W and YBR075W were merged. After merging YBR074W (386243 - 387484 (1-1242)) and YBR075W (387793 - 389175 (1-1383)), the coordinates of the merged ORF, YBR074W, are 386243 - 389173 (1 - 2931). YBR075W is now an alias of YBR074W. These sequence changes were verified in S288c strain by SGD.
Query:   1141 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGAC-ACGCTTTCCTCT 1199
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 387383 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGACCACGCTTTCCTCT 387442

Query:   1380 AAG-CCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 1438
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 387623 AAGGCCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 387682

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2011-02-03
YBR076W
390442390442DeletionG
391277391277Insertion A
 A single G nucleotide was deleted near the 3' end, and a single A nucleotide was inserted near the 5' end of ORF ECM8/YBR076W, altering its coding sequence. The ORF was extended 49 amino acids at the N-terminus and shortened 34 amino acids at the C-terminus, resulting in a protein that is 15 amino acids larger. Although this protein is altered at both ends, the central portion of the protein remains the same.
New    390408  AAACCATCAAGAACAAAATATTCCCACAAAGGAAAATATT-CAACGATAGCGAAAATTTT  390466
               |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    390402  AAACCATCAAGAACAAAATATTCCCACAAAGGAAAATATTGCAACGATAGCGAAAATTTT  390461

New    391247  CGAACGAAATGTTTATATGTCCAAGTTATAACAAAAAGCAATTGATTGTGTACGCAAGAT  391306
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    391242  CGAACGAAATGTTTATATGTCCAAGTTATAACAAAA-GCAATTGATTGTGTACGCAAGAT  391300

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR077C, YBR078W
392340392340DeletionTT
392822392822Insertion T
392557392558SubstitutionCGGC
392568392569SubstitutionCGGC
 Several nucleotide changes were made in the intergenic region between ORFs SLM4/YBR077C and ECM33/YBR078W.
New    392327  GATAACTGCCTTTTTTTTTT--CTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT  392384
               ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
Old    392321  GATAACTGCCTTTTTTTTTTTTCTTCTTATCTTCCCTTAATTAATTCATTAGAGTCTTTT  392380
New    392545  CACGACCCGGGTGGCTGCTGCGCCCTCGCGAAAAAGAAATGAAATGGAGTGCAAAAACGG  392604
               ||||||||||||||||  |||||||||  |||||||||||||||||||||||||||||||
Old    392541  CACGACCCGGGTGGCTCGTGCGCCCTCCGGAAAAAGAAATGAAATGGAGTGCAAAAACGG  392600
New    392805  AATGTCAAACACCTACGACTTTTCGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA  392864
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    392801  AATGTCAAACACCTACGACTTT-CGCAATCAACGGACCTCTCTTGCATTTTTGTATTTAA  392859

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL057C113437113437DeletionG
 One nucleotide was deleted within ORF PTH2/YBL057C, near its 5' end, altering its coding sequence. The stop and reading frame remain the same, but the start has been moved 18 nucleotides downstream and the annotated protein sequence is now six amino acids shorter.
New    113393  ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAG-ACGTTATCATGTTACTC  113451
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    113395  ATGGTGTAATTCGAAGAAACTGTCATCTTTTCCATTAAAAAGGACGTTATCATGTTACTC  113454

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR013C, YBRCdelta14
265902265902DeletionC
265922265922DeletionC
265905265905SubstitutionTG
 Several nucleotide changes were made within the intergenic region between ORF YBR013C and Ty1 LTR YBRCdelta14.
New    265852  GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAA-ACGCAAT  265910
               |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||
Old    265850  GATACATATCCTGAATAAGGGATATATCATTATGAGGTTAAGTGGCCTAAAACACTCAAT  265909
New    265911  TAATACGGATCC-TTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG  265969
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    265910  TAATACGGATCCCTTGTACTATTAAGTCTTTTCTATCTCTGAAAATTAACTTAAGAAGCG  265969

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR160W, YBR161W561435561435DeletionC
 A single nucleotide deletion was made in the intergenic region between ORFs CDC28/YBR160W and CSH1/YBR161W.
New    561405  GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCA-TTGTCACCGTTGAATAACCGAGA  561463
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    561399  GCAAATTCATTGCTCTTTGAATTTTGAAGAGTTTCACTTGTCACCGTTGAATAACCGAGA  561458

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL067C, YBL068W9362293622DeletionC
 A single nucleotide deletion was made in the intergenic region between ORFs PRS4/YBL068W and UBP13/YBL067C.
New    93594   AAAGGAGACGGTGAACCTTTACCTTCC-TTGATATGCAAATATTTTTCAGCTTTTCCTAA  93652
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    93595   AAAGGAGACGGTGAACCTTTACCTTCCCTTGATATGCAAATATTTTTCAGCTTTTCCTAA  93654

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBL068W
9291892920DeletionCCG
9267992679SubstitutionCA
9291692916SubstitutionGA
 Two nucleotide substitutions and one trinucleotide deletion were made within the ORF PRS4/YBL068W, altering its coding sequence. The start, stop, and reading frame remain the same, but the annotated protein is now one amino acid shorter.
New    92637   TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCAAAATTGCATCTGCAA  92696
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    92635   TTAATGATTTCTTGATGGAATTATTAATTTTAATTCATGCTTGCCAAATTGCATCTGCAA  92694

New    92877   ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAAC---GAAAACAGATTTCG  92933
               ||||||||||||||||||||||||||||||||||||||||| |   ||||||||||||||
Old    92875   ACAACCTATATGCAGAACCAAGTGTTTTAAATTATATTAGAGCCCGGAAAACAGATTTCG  92934

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2001-05-29YBL069W9171191711DeletionC
 A change was made to the systematic sequence of Chromosome II within the ORF AST1/YBL069W. The C at chromosomal coordinate 91711 was deleted, shifting the reading frame and moving the stop from 91722 to 92025:
Old: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACCCACTGTAGGTGATTACGTTGCCAATTATAA 91740
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACC-ACTGTAGGTGATTACGTTGCCAATTATAA 91739
2011-02-03YBL001C, YBL002W237021237021Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs HTB2/YBL002W and ECM15/YBL001C.
New    236992  AGGGTCTAGTCTATCAGCCTCCGAAGGGAGTTGTATAAATGTATATATATAACTTTATAA  237051
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    236995  AGGGTCTAGTCTATCAGCCTCCGAAGG-AGTTGTATAAATGTATATATATAACTTTATAA  237053

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03ARS213390033390033Insertion C
 A single nucleotide insertion was made within ARS213.
New    389998  ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGCCGAAAAATGTTTCGAAAAT  390057
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    389993  ACTGACACTAAAAAAAGGGTCGTACGTCTTACTGGCAGCGC-GAAAAATGTTTCGAAAAT  390051

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-07-09YBR108W457298457298InsertionG
 The work of Kellis et al. 2003 predicted the insertion of a single G after the G at chromosomal coordinate 457298. This sequence error was confirmed in strain S288C by SGD. As a consequence of this sequence change which caused a frameshift, YBR108W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 848 to 947 amino acids.
New: CGGTTCGAAAAAAGTGAAGGACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT
     ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old: CGGTTCGAAAAAAGTGAAG-ACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03YBR036C, YBR037C310457310457Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs CSG2/YBR036C and SCO1/YBR037C.
New    310430  TCCTTTAGAGTGAGAGAGCTTTTTTTTTTCTTGCGATACACCTTCGCCGGGTGATAGCCG  310489
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    310430  TCCTTTAGAGTGAGAGAGCTTTTTTTTT-CTTGCGATACACCTTCGCCGGGTGATAGCCG  310488

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL087C, YBL088C5940659406Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs TEL1/YBL088C and RPL23A/YBL087C.
New    59399   ATTTCCCTTTTTCTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59458
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    59396   ATTTCCCTTTT-CTTTGAAGGCTTTTTTTTCGAATTTCCTGCTTTTTTTGCGAGGCTTTG  59454

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR044C324366324366Insertion T
 One nucleotide was inserted within ORF TCM62/YBR044C, very near its 3' end, altering its coding sequence. The start, stop, and majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now one amino acid shorter.
New    324349  TGTGCCGTTCAGGCTTTTTGTATACACATGTGATAATTGTATTACAGCTTGTAAGTAATT  324408
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    324349  TGTGCCGTTCAGGCTTTT-GTATACACATGTGATAATTGTATTACAGCTTGTAAGTAATT  324407

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR045C328382328382Insertion T
 A single nucleotide was inserted within ORF GIP1/YBR045C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 66 amino acids longer.
New    328369  CTCAGTCTATAATTTTCTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA  328428
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    328368  CTCAGTCTATAATTT-CTGCTTCATTTCTCTGCCTTTTATACTCTGTATATTGAAAATAA  328426

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-01-29YBL013W203180203180InsertionC
 A single C nucleotide insertion was confirmed by sequencing genomic DNA from FY23 (S288C) and a D273-10B related strain; GenBank accession number for FY23 is AY490279. The stop codon of ORF YBL013W has been moved downstream, so that the ORF is now 1206 nucleotides long as opposed to the previously annotated 1182 nt.
New  1141    GGCCAGTTCATGGCGCGCCTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC  1200
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old  203163  GGCCAGTTCATGGCGCG-CTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC  203221
2004-01-09
YBR269C
742175742175InsertionG
742165742165InsertionG
 Kellis et al. 2003 predicted and confirmed the insertion of G after the G at chromosomal coordinate 742165, and the insertion of another G after the G at 742175. As a consequence of these sequence changes, YBR269C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 130 to 138 amino acids. This sequence change was incorporated at MIPS prior to SGD, and was verified in strain S288C.
     New:        ACGAATAATCGCCGTGTCTCAACGGGTCCTGCTTGGGACCCCCAACTTCACCAGTCTTGG
                 ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||
Previous: 742141 ACGAATAATCGCCGTGTCTCAACGG-TCCTGCTTGG-ACCCCCAACTTCACCAGTCTTGG

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03
YBR201C-A, YBR202W
625435625435Insertion T
625500625500SubstitutionTC
 A single nucleotide insertion and a single nucleotide substitution were made in the intergenic region between ORFs YBR201C-A and MCM7/YBR202W.
New    625423  ATTTTCTCAATAACAGGTCGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA  625482
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    625419  ATTTTCTCAATAACAGG-CGAGGCCCCTTCTACCCTTGAATGCTACTTATTACTCACTCA  625477
New    625483  TAATACATTGTATAAGCCTTCGCGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT  625542
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    625478  TAATACATTGTATAAGCCTTCGTGTTTTTCACGGCCTCGAAAAAATTTTTCTTAACTAAT  625537

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1997-07-27YBL103C2260322603InsertionG
 A single G was inserted after the G at chromosomal coordinate 22603 within the ORF RTG3/YBL103C, shifting the frame and extending the 3' end by 510 nucleotides:
New: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTGGCCGAGTTCTTTTATCT 22620
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTG-CCGAGTTCTTTTATCT 22619
2011-02-03YBL103C, YBL104C2137621376Insertion A
 A single nucleotide insertion was made in the intergenic region between ORFs YBL104C and RTG3/YBL103C.
New    21361   CTTATGCTATCTTGAAATATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21420
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    21361   CTTATGCTATCTTGAA-TATATCATCGCCGTAAAGTATGATGTGTAGCGCATTAGTCTTC  21419

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-01-26
YBL103C-A, YBL104C
2134721347InsertionA
2134521345InsertionA
2128821288InsertionC
2127921279InsertionT
1836418364InsertionG
 Brachat et al. 2003 and Kellis et al. 2003 predicted and confirmed DIFFERENT sequence changes for YBL104C. Brachat et al. demonstrated the insertion of a single G nt, which extended the 3' end by 141 nt and altered the C-terminus, resulting in overlapping ORF YBL103C-A becoming part of YBL104C (Cliften et al. also predicted this change).
     New:       CTTCTGTCTGCATTGGATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 
                ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Previous: 18350 CTTCTGTCTGCATTG-ATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 18408
Kellis et al. demonstrated the insertion of four separate nucleotides (a single T, a single C, and two separate As), which extended at the 5' end by 198 nt and altered the N-terminus. The inserted C (G on the opposite, coding strand) is the third nucleotide of the new ATG start codon.
     New:       ATTATCATATGACCAATGGGTCACTTTTTTGATGAGACCCATGTTTATTCTTCTATACGT 
                ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||
Previous: 21251 ATTATCATATGACCAATGGGTCACTTTTT-GATGAGACC-ATGTTTATTCTTCTATACGT 21308

     New:       TCGTGATACTGCACTTACGACTACCAGTAACATCAGAATAACCATAGAGC 
                ||||||||||||||||||||||||||||||||||||| || |||||||||
Previous: 21309 TCGTGATACTGCACTTACGACTACCAGTAACATCAGA-TA-CCATAGAGC 21356

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2011-02-03
YBR066C, YBR067C
371424371424Insertion A
370774370773SubstitutionCT
 A single nucleotide substitution and a single nucleotide insertion were made in the intergenic region between ORFs NRG2/YBR066C and TIP1/YBR067C.
New    370729  TTGTTCTTCGAACAGTAGCGAGTGCTCATATGACTTGGTGCCGGAAATTCATTTGAGCTG  370788
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    370727  TTGTTCTTCGAACAGTAGCGAGTGCTCATATGACTTGGTGCCGGAAACTCATTTGAGCTG  370786
New    371389  AAGGTTATAGTCTCCTTTTTTTCTTGGCTTCGGGAAAAATACGATTTGTTTGTTATTCTA  371448
               |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    371387  AAGGTTATAGTCTCCTTTTTTTCTTGGCTTCGGGAAAA-TACGATTTGTTTGTTATTCTA  371445

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR072C-A, YBR072W
382729382729Insertion G
382742382742Insertion G
 Two separate single nucleotide insertions were made in the intergenic region between ORFs HSP26/YBR072W and YBR072C-A.
New    382719  TTGCTTGCATATGGGCTTGAAACATATGGTCATCACATCTGAGCGATTTTACCTCTTAGA  382778
               |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||
Old    382716  TTGCTTGCATATGG-CTTGAAACATATG-TCATCACATCTGAGCGATTTTACCTCTTAGA  382773

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR078W394727394727Insertion C
 One nucleotide was inserted within ORF ECM33/YBR078W, very near its 3' end, altering its coding sequence. The start, stop, and vast majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now 39 amino acids shorter.
New    394715  TGCTGCTGTTGGCGTTGCCTTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA  394774
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    394710  TGCTGCTGTTGGCGTTGC-TTACTATAAGATTAAAGCAACAATTTGTGTTTCTATTATTA  394768

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR292C, YBR293W
786761786761Insertion A
786736786737SubstitutionCTTC
 Several nucleotide changes were made in the intergenic region between ORFs YBR292C and YBR293W.
New    786721  TTCCAAATCAGATTTTTTTTCGCAATGCTTAAATCTAGTAAACACAAAGTACTACCGAAA  786780
               |||||||||||||||||||  |||||||||||||||||||||||| ||||||||||||||
Old    786717  TTCCAAATCAGATTTTTTTCTGCAATGCTTAAATCTAGTAAACAC-AAGTACTACCGAAA  786776
New    786761  AACACAAAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA  786820
               ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    786757  AACAC-AAGTACTACCGAAAAGCAAGGATGGAAACTATGGCAGTATTGAAGAGACTGAAA  786815

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR006W, YBR007C248623248623Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs UGA2/YBR006W and DSF2/YBR007C.
New    248572  GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTTTGAAAGAAAA  248631
               |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old    248574  GCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATTTTT-GAAAGAAAA  248632

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-01-20YBR157C553996553996InsertionG
 Kellis et al. 2003 predicted and confirmed the insertion of a single G nt after the C at chromosomal coordinate 553996. As a consequence of this sequence change, YBR157C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 106 to 255 amino acids.
     New:        TATGGAGGAATTTCTCCTCGTTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT
                 ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Previous: 553978 TATGGAGGAATTTCTCCTC-TTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT 554036

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2004-07-13YBL067C9389993899InsertionA
 The work of Kellis et al. 2003 predicted the insertion of a single nucleotide; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, UBP13/YBL067C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 688 to 747 amino acids.
New: 93883 TCGCTTTATAAAACAAAACATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93942
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old: 93883 TCGCTTTATAAAACAAA-CATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93941 

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03
ARS230, YBL100W-C
2888728887Insertion AT
2890928909Insertion A
 A dinucleotide insertion and a mononucleotide insertion were made in the intergenic region between ORF YBL100W-C and ARS230.
New    28859   ATTACTGTTTCGGGAATATAACGTTTGATATCGCTAGCGCACCCAGATGAGAAATCCGCA  28918
               |||||||||||||||||||||||||||||  |||||||||||||||||||||| ||||||
Old    28859   ATTACTGTTTCGGGAATATAACGTTTGAT--CGCTAGCGCACCCAGATGAGAA-TCCGCA  28915

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
ARS209
254548254548Insertion A
254719254719Insertion T
254720254720Insertion T
254495254495SubstitutionGT
254532254532SubstitutionCA
254616254616SubstitutionTA
 Several nucleotide changes were made within ARS209.
New    254452  AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTTAAATCTTCATAATCTTC  254511
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    254453  AAATATCCTTTTTTTTTTCTTTGCATTTGTCTTCTTTCATTTGAAATCTTCATAATCTTC  254512
New    254512  CGGAAAAACTAGTGATGCGAAATATTGTAGAGAAAAAGCGCAGGGCATTCCTATACTTAG  254571
               ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||
Old    254513  CGGAAAAACTAGTGATGCGCAATATTGTAGAGAAAA-GCGCAGGGCATTCCTATACTTAG  254571
New    254572  TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCAAAGAATTTTCTATACA  254631
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    254572  TAATCACCATCATAACGTATTTTAAAATGAAGAAGCGAACCTCATAGAATTTTCTATACA  254631
New    254692  TATATTGCAGAAAATGTGCTAGTAATATTGTTCTCTCTGTTGTCAATGGGCTTACAATTG  254751
               |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Old    254692  TATATTGCAGAAAATGTGCTAGTAATAT-G-TCTCTCTGTTGTCAATGGGCTTACAATTG  254749

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03ARS228792273792273Insertion T
 A single nucleotide insertion was made within ARS228.
New    792231  TTTGTTATGAATCTGAAAAGAAAAATACTATTTTAGCAATACAATGAATTTTAAAAAGTT  792290
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    792226  TTTGTTATGAATCTGAAAAGAAAAATACTATTTTAGCAATACAATGAA-TTTAAAAAGTT  792284

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR089C-A426394426396SubstitutionCCGGCC
 Nucleotide substitutions within the coding region of NHP6B/YBR089C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 30 is now Glycine rather than Arginine.
New    426355  GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAAGCCCCTCTTAGGGGC  426414
               ||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||
Old    426349  GACAATGTCTCTGTTTTCATTAGCAAAGAACATATAAGCTGACAACCGCCTCTTAGGGGC  426408

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL072C8927789277SubstitutionGT
 A single nucleotide substitution was made within the 5' UTR intron of ORF RPS8A/YBL072C.
New    89267   GGCTTGATTTTTTGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89326
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    89265   GGCTTGATTTTTGGGGTACACAAAGGATTCAGTTTAGTGCACTGCTCCTGTCACAATTTA  89324

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL079W, YBL080C7520875208SubstitutionAG
 A single nucleotide substitution was made in the intergenic region between ORFs PET112/YBL080C and NUP170/YBL079W.
New    75178   GGAGAATTACTGGAACCTAGGATCTGACAAGCGGACAAAAAAGCAGAGTGCGTTTATTAC  75237
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    75175   GGAGAATTACTGGAACCTAGGATCTGACAAGCGAACAAAAAAGCAGAGTGCGTTTATTAC  75234

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR102C, YBR103W447535447536SubstitutionCGGC
 A dinucleotide substitution was made in the intergenic region between ORFs EXO84/YBR102C and SIF2/YBR103W.
New    447525  AAAGGTTATGAGATATGCAAGACCATTCGTTTTGATTTGCAATTAGTGAGAACAATTTAA  447584
               ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
Old    447519  AAAGGTTATGAGATATCGAAGACCATTCGTTTTGATTTGCAATTAGTGAGAACAATTTAA  447578

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR108W456359456359SubstitutionCT
 A single nucleotide substitution within the coding region of AIM3/YBR108W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 515 is now Valine rather than Alanine.
New    456345  AGGACATTATGATGTAGATGTCAACATCATGCCACCTCCAAAACCTTTCAGACATGGACT  456404
               |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    456339  AGGACATTATGATGTAGATGCCAACATCATGCCACCTCCAAAACCTTTCAGACATGGACT  456398

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2001-05-29YBL004W234918234918SubstitutionCA
 A change was made to the systematic sequence of Chromosome II within the ORF UTP20/YBL004W. The C at chromosomal coordinate 234918 was changed to an A:
Old: 234901 CAGACCGTATTAGAAAGCAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960
            ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New: 234901 CAGACCGTATTAGAAAGAAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960
2011-02-03YBL005W, YBLWdelta8220413220414SubstitutionAGGA
 A dinucleotide substitution was made in the intergenic region between ORF PDR3/YBL005W and Ty1 LTR YBLWdelta8.
New    220372  ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAGAAAATAGGGAAGCAGAGCATA  220431
               ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
Old    220375  ATGACAATACTTCATATCCCTTCTTATGAAAACGCAAAAGAAATAGGGAAGCAGAGCATA  220434

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL008W210433210433SubstitutionAG
 A single nucleotide substitution within the coding region of HIR1/YBL008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 260 is now Valine rather than Methionine.
New    210412  AATGGGCCCGTAAGTTCTGTGGCAATTGTAAATAGAGGAACTTGGGATACAAATGTTAGT  210471
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    210415  AATGGGCCCGTAAGTTCTATGGCAATTGTAAATAGAGGAACTTGGGATACAAATGTTAGT  210474

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL080C7345073450SubstitutionCG
 A single nucleotide substitution within the coding region of PET112/YBL080C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 415 is now Proline rather than Alanine.
New    73438   CGAAAACCGGAGGAGGCAAAATTTCTTTTGCTTTGGCCAATGGAATTTGTAGCTTGTTCA  73497
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    73435   CGAAAACCGGAGGAGCCAAAATTTCTTTTGCTTTGGCCAATGGAATTTGTAGCTTGTTCA  73494

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL084C6815468155SubstitutionTGGA
 The substitution of two nucleotides within the coding region of CDC27/YBL084C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 430 is now Serine rather than Glutamine.
New    68108   CGACCTTAATATTAAAGCGAAATTATACATGATTTCAGGCAGCGTAATTGAATAATCACT  68167
               |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||
Old    68105   CGACCTTAATATTAAAGCGAAATTATACATGATTTCAGGCAGCGTAATTTGATAATCACT  68164

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL088C5514555145SubstitutionAC
 A single nucleotide substitution within the coding region of TEL1/YBL088C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1412 is now Cysteine rather than Phenylalanine.
New    55139   GCATCAAGGCAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT  55198
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    55136   GCATCAAGGAAGTATTTCCAAGTTTTTATTTTGATGAGATCCCGATGCTCTAAAAGCTTT  55195

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR043C323835323836SubstitutionCGGC
 Nucleotide substitutions within the coding region of QDR3/YBR043C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 37 is now Serine rather than Threonine.
Query  323809  CTATAATCGTTGTGCTCGCTGTGCGGGCTGCCGCTGCTTTCATCGCAGTGCATCATAACA  323868
               ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||
Sbjct  323809  CTATAATCGTTGTGCTCGCTGTGCGGCGTGCCGCTGCTTTCATCGCAGTGCATCATAACA  323868

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL014C201635201635SubstitutionGC
 A single nucleotide substitution within the coding region of RRN6/YBL014C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 39 is now Lysine rather than Asparagine.
New    201592  CCTCGGCCAATGTATCATCTACTGGTCTTAGCCATTGTGGCTTTTCTTGCTTCTTCGTAG  201651
               |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    201595  CCTCGGCCAATGTATCATCTACTGGTCTTAGCCATTGTGGGTTTTCTTGCTTCTTCGTAG  201654

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR265W739341739341SubstitutionAT
 A single nucleotide substitution within the coding region of TSC10/YBR265W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 255 is now Aspartic Acid rather than Glutamic Acid.
New    739302  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGAT  739361
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    739297  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGAAGACGTTTTTACAGAT  739356

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR266C, YBR267W740291740292SubstitutionCGGC
 Nucleotide substitutions within the coding regions of overlapping genes REI1/YBR267W and SLM6/YBR266C resulted in altered sequences for both proteins. The start, stop, and reading frames of both proteins remain the same, but protein residues 152-153 of REI1/YBR267W are now KL rather than NV, and protein residue 31 of SLM6/YBR266C is now Serine rather than Threonine.
New    740262  AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAAGCTACGCAACAGAGTCGATATTCCAC  740321
               ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
Old    740257  AGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAACGTACGCAACAGAGTCGATATTCCAC  740316

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1997-07-27YBL091C4861548615SubstitutionAC
 The A at chromosomal coordinate 48615 (upstream of the Crick strand ORF MAP2/YBL091C at coordinates 48402-47353) was changed to a C, and the start site of YBL091C was then moved 216 nucleotides (nt) upstream to the newly-created start codon, extending the size of the coding sequence from 1050 nt to 1266 nt, the size of the predicted protein from 349 amino acids (aa) to 421 aa. Note that the sequence presented below is from the Watson strand:
New: 48600 TATTTCAGCGTCTGTCATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659
           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old: 48600 TATTTCAGCGTCTGTAATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659
2011-02-03YBL091C4836948369SubstitutionAT
 A single nucleotide substitution within the coding region of MAP2/YBL091C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 86 is now Aspartic Acid rather than Valine.
New    48359   ACGTGATTCTTCATCCGTGGTTCTTTGCAGATTGAAATCTTGATGATAGTCCATCCACGC  48418
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    48356   ACGTGATTCTTCAACCGTGGTTCTTTGCAGATTGAAATCTTGATGATAGTCCATCCACGC  48415

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL092W, YBL093C4549545495SubstitutionTA
 A single nucleotide substitution was made in the intergenic region between ORFs ROX3/YBL093C and RPL32/YBL092W.
New    45479   ACTGGAGAAGAGTGTTTGAATCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA  45538
               ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old    45476   ACTGGAGAAGAGTGTTTGATTCCAGCAGAAGGTAATACGCACCTTTCTCATCTATTTGCA  45535

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL097W4237742377SubstitutionCG
 A single nucleotide substitution within the coding region of BRN1/YBL097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 517 is now Glycine rather than Alanine.
New    42359   CAAGATTGTTCATTAAACCGGGGCAGAAAATGAGTCTGTTCAGTCATAGGAAGCATACCA  42418
               ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    42356   CAAGATTGTTCATTAAACCGGCGCAGAAAATGAGTCTGTTCAGTCATAGGAAGCATACCA  42415

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBL098W, YBL099W
3872838728SubstitutionCA
3880038800SubstitutionCA
3891738917SubstitutionCT
3892038920SubstitutionCA
 Several single nucleotide substitutions were made in the intergenic region between ORFs ATP1/YBL099W and BNA4/YBL098W.
New    38699   AAAAAAATAAAAATGAATATAAGGTACGTCTCAAAAAGAAATGTAAATATAGAAATTTTA  38758
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    38696   AAAAAAATAAAAATGAATATAAGGTACGTCTCCAAAAGAAATGTAAATATAGAAATTTTA  38755
New    38759   AAAAAAAAAACGAAAAAAAACATAACTAAATTTAAAGTGCAGCCAAACAATAACCCTGAA  38818
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    38756   AAAAAAAAAACGAAAAAAAACATAACTAAATTTAAAGTGCAGCCCAACAATAACCCTGAA  38815
New    38879   GTAAATAATGCCCCTACTTTTCTTCTAAGGAAATGAGTTACTACAAAAATAAGGAAATAT  38938
               |||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||
Old    38876   GTAAATAATGCCCCTACTTTTCTTCTAAGGAAGTGAGTTACCACCAAAATAAGGAAATAT  38935

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBL099W
3806738067SubstitutionCT
3821038210SubstitutionAT
 The substitution of 2 nucleotides within the coding region of ATP1/YBL099W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 340 is now Serine rather than Proline.
New    38039   AGCCTACCCTGGTGATGTCTTTTACTTGCATTCAAGATTGCTAGAAAGAGCCGCTAAGCT  38098
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    38036   AGCCTACCCTGGTGATGTCTTTTACTTGCATCCAAGATTGCTAGAAAGAGCCGCTAAGCT  38095

New    38169   GCTTATATTCCAACCAATGTTATTTCCATTACCGATGGTCAAATTTTCTTGGAAGCTGAA  38228
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    38166   GCTTATATTCCAACCAATGTTATTTCCATTACCGATGGTCAAATATTCTTGGAAGCTGAA  38225

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBL099W, tF(GAA)B3667336673SubstitutionAT
 A single nucleotide substitution was made in the intergenic region between tRNA-Phe tF(GAA)B and ORF ATP1/YBL099W.
New    36659   ATTTATTGTAATTATTATACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA  36718
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    36656   ATTTATTGTAATTATTAAACATTGGTCATATCAAATTCACATCAGACTTCAATTTTTCAA  36715

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR121C481671481675SubstitutionTGATGGTAGT
 Nucleotide substitutions within the coding region of GRS1/YBR121C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 563-564 are now TT rather than HH.
New    481665  TTGGCGACTTCAGTAGTAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA  481724
               ||||||||||||  |  |||||||||||||||||||||||||||||||||||||||||||
Old    481659  TTGGCGACTTCATGATGAACAGGAACTAAATCTTTGTGGTTAGATAAAGGAACTAAAAGA  481718

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR125C, YBR126C488600488601SubstitutionTCAT
 A dinucleotide substitution was made in the intergenic region between ORFs PTC4/YBR125C and TPS1/YBR126C.
New    488565  CGTTATGCGGTGTGAACAGCGACAATAAAAAAAAATGTGGGATAAATTATGGCTTTTTTT  488624
               |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Old    488559  CGTTATGCGGTGTGAACAGCGACAATAAAAAAAAATGTGGGTCAAATTATGGCTTTTTTT  488618

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
ARS208, CEN2
238116238116SubstitutionGA
238133238133SubstitutionGA
 Two separate single nucleotide substitutions were made in the intergenic region between ARS208 and CEN2.
New    238082  AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGAACGTTCAAACAGACTGAAAATATAGCT  238141
               |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||
Old    238084  AGTACTTGCTTTCAGCAGAAAATGAAAAAAAGGACGTTCAAACAGACTGGAAATATAGCT  238143

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR270C743936743938SubstitutionGCCCCG
 Nucleotide substitutions within the coding region of BIT2/YBR270C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now SG rather than RA.
New    743922  AGTGCCGTAGTTTTTTGACCCGCTCCTGCTTCGATTTCTCATATTATCTTTTGAATTGGT  743981
               ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||
Old    743917  AGTGCCGTAGTTTTTTGACGCCCTCCTGCTTCGATTTCTCATATTATCTTTTGAATTGGT  743976

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR275C754908754908SubstitutionTC
 A single nucleotide substitution within the coding region of RIF1/YBR275C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 732 is now Alanine rather than Threonine.
New    754902  TACTTCAACAGCCTGGAACACAACTTTCATGATTTTATCGTATTCACGCTTGATGATCTG  754961
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    754897  TACTTCAACAGTCTGGAACACAACTTTCATGATTTTATCGTATTCACGCTTGATGATCTG  754956

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR202W
627421627421SubstitutionTG
627433627439SubstitutionATCCGGGCTTTGAA
627486627487SubstitutionATTA
 Nucleotide changes within the coding region of MCM7/YBR202W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 552-558 is now GINTTLN rather than VINTNPG, and residue 574 is now Tyrosine rather than Isoleucine.
New    627403  AACAATTTCGATATCCAAGGCGGGTATCAATACAACTTTGAACGCCAGAACCTCAATCTT  627462
               ||||||||||||||||||||||| ||||||||||| |  |  ||||||||||||||||||
Old    627398  AACAATTTCGATATCCAAGGCGGTTATCAATACAAATCCGGGCGCCAGAACCTCAATCTT  627457

New    627463  AGCGGCAGCAAATCCGTTGTATGGTAGATATAATCCTAGATTATCACCTCTGGACAATAT  627522
               ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
Old    627458  AGCGGCAGCAAATCCGTTGTATGGTAGAATTAATCCTAGATTATCACCTCTGGACAATAT  627517

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR203W
631342631353SubstitutionGCTGGCGAAACGCGTTTCGCCAGC
631907631907SubstitutionGA
631912631912SubstitutionGA
631924631924SubstitutionGA
631936631936SubstitutionGA
631940631940SubstitutionCA
 Nucleotide changes within the coding region of COS111/YBR203W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 727-731 are now TFRQH rather than SWRND, residue 917 is now Asparagine rather than Serine, and residue 921 is now Glutamic Acid rather than Glycine.
New    631303  TGTGTGGTGCAGGCAATATATGGTAAAGTATTTTGTAATGAGGACGTTTCGCCAGCATTT  631362
               ||||||||||||||||||||||||||||||||||||||||||||  |  ||  |  ||||
Old    631298  TGTGTGGTGCAGGCAATATATGGTAAAGTATTTTGTAATGAGGAGCTGGCGAAACGATTT  631357

New    631903  TGTTGGCGAAAATAACTACTATGCTGAAAGCATCATATAACGACTGCTCTCTTTTAACAG  631962
               ||||||||| |||| ||||||||||| ||||||||||| ||| |||||||||||||||||
Old    631898  TGTTGGCGAGAATAGCTACTATGCTGGAAGCATCATATGACGCCTGCTCTCTTTTAACAG  631957

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR204C633189633189SubstitutionTA
 A single nucleotide substitution within the coding region of YBR204C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 63 is now Valine rather than Glutamic Acid.
New    633163  CCTTATTCTTGAATTTCGATCCGATAGTTGTACATTAAAAAACTCCTCATGTTCTGCGAT  633222
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    633158  CCTTATTCTTGAATTTCGATCCGATAGTTGTTCATTAAAAAACTCCTCATGTTCTGCGAT  633217

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR205W, YBR207W634934634934SubstitutionCT
 A single nucleotide substitution was made in the intergenic region between ORFs KTR3/YBR205W and FTH1/YBR207W.
New    634903  ATATACACATAATTCAATGTAGTAGCCACCTCACTTTATTCTAGTGCCTTCTTGGGTTCA  634962
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    634898  ATATACACATAATTCAATGTAGTAGCCACCTCACTTCATTCTAGTGCCTTCTTGGGTTCA  634957

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBL105C
1533215332SubstitutionGC
1583515835SubstitutionTC
1745517455SubstitutionAC
 The substitution of three nucleotides within the coding region of PKC1/YBL105C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 81 is now Cysteine rather than Phenylalanine, residue 621 is now Arginine rather than Lysine, and residue 789 is now Alanine rather than Proline.
New    15301   TGCGGAGATTGTTGATCAGTGGTTCTGGAGGCATGAGTACTTGTAGGAGCCAAGGACACT  15360
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    15301   TGCGGAGATTGTTGATCAGTGGTTCTGGAGGGATGAGTACTTGTAGGAGCCAAGGACACT  15360

New    15791   TAAATTTATTTAGTTTCTCACGCCCGTGCGTTTGTAGTGAAATTCTTTTATCAATAATAG  15850
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    15791   TAAATTTATTTAGTTTCTCACGCCCGTGCGTTTGTAGTGAAATTTTTTTATCAATAATAG  15840

New    17411   CATTTGGCGATTTGGTAGAAAGAAACCCGTATTCCTTCGAATTGCATCGCTCATTATCTT  17470
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    17411   CATTTGGCGATTTGGTAGAAAGAAACCCGTATTCCTTCGAATTGAATCGCTCATTATCTT  17470

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBL105C, YBL106C
1396613966SubstitutionCA
1398213982SubstitutionGA
 Two separate single nucleotide substitutions were made in the intergenic region between ORFs SRO77/YBL106C and PKC1/YBL105C.
New    13941   AGAAATATGTTAGTAGTAATATAATACTGAGCTGTTTCTTAAATGCTTCCTTAATAATGT  14000
               ||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||
Old    13941   AGAAATATGTTAGTAGTAATATAATCCTGAGCTGTTTCTTAGATGCTTCCTTAATAATGT  14000

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR137W513365513365SubstitutionAG
 A single nucleotide substitution within the coding region of YBR137W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 110 is now Glycine rather than Serine.
New    513345  CAAGTTTCTATATGGGCTGCAAGAAAGGTGACAAAACACCGGAGGAAAAGTTTTTTGTGG  513404
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    513339  CAAGTTTCTATATGGGCTGCAAGAAAAGTGACAAAACACCGGAGGAAAAGTTTTTTGTGG  513398

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1999-04-22YBL033C159114159114SubstitutionCG
 The C at chromosomal coordinate 159114 within the ORF RIB1/YBL033C was changed to a G, altering translation by changing amino acid 181 from Lys (AAG) to Asn (AAC). Note that this ORF is on the Crick strand:
Old: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATCTTGCTT 159120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATGTTGCTT 159120

Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
SGD Papers Entry  

2011-02-03
YBL106C
1105311053SubstitutionTC
1130811309SubstitutionAATT
1134511345SubstitutionAG
1137911379SubstitutionAC
1310213102SubstitutionCA
1347713477SubstitutionGA
1349213492SubstitutionAT
1355313553SubstitutionGA
 Several nucleotide substitutions within the coding region of SRO77/YBL106C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 130 is now Isoleucine rather than Phenylalanine, residue 135 is now Serine rather than Proline, residue 260 is now Serine rather than Alanine, residue 834 is now Glycine rather than Valine, residue 858 is now Threonine rather than Serine, and 943 is now Glutamic Acid rather than Lysine.
New    11041   ACCTGTGATCTTCCGTACCGGGAGGTAACTTTCTGGCTGCATTACTACTACTGGAAGATA  11100
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    11041   ACCTGTGATCTTTCGTACCGGGAGGTAACTTTCTGGCTGCATTACTACTACTGGAAGATA  11100

New    11281   GTTGTGATATGTCAGCAGTATGATTCGTTCCGGTGGCACTTTCATTAAGTACTGAAATCA  11340
               |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
Old    11281   GTTGTGATATGTCAGCAGTATGATTCGAACCGGTGGCACTTTCATTAAGTACTGAAATCA  11340

New    11341   AAGAGGCTTGGAATTTCCCTGTGCGAATGACAATGTCACCATTTTCTAATATAGATGAAT  11400
               |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old    11341   AAGAAGCTTGGAATTTCCCTGTGCGAATGACAATGTCAACATTTTCTAATATAGATGAAT  11400

New    13081   TGACATCCCAAAATACCAAGGAATTATCTTCATGGACAGTTAATATATGTAAGGAATTTG  13140
               ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    13081   TGACATCCCAAAATACCAAGGCATTATCTTCATGGACAGTTAATATATGTAAGGAATTTG  13140

New    13441   ATCCACTCTCGAGGCCAATCAGCATCCAATCCAAGGACGGATCAGTCTCAATACAAGTGA  13500
               |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Old    13441   ATCCACTCTCGAGGCCAATCAGCATCCAATCCAAGGGCGGATCAGTCTCAAAACAAGTGA  13500

New    13501   TGCTGTTTGGACAGAAAACAGTAGTTAGAATCTGTTTCGAGTGTACTGAAAGAACTATTA  13560
               |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Old    13501   TGCTGTTTGGACAGAAAACAGTAGTTAGAATCTGTTTCGAGTGTACTGAAAGGACTATTA  13560

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR138C514965514966SubstitutionACCA
 Nucleotide substitutions within the coding region of YBR138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Cysteine.
New    514955  TAGGCTTGGCACCTATCAATTGTGAGCGACGCTTTCTTACATTCAATAACTGTTGGTTCT  515014
               ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
Old    514949  TAGGCTTGGCACCTATACATTGTGAGCGACGCTTTCTTACATTCAATAACTGTTGGTTCT  515008

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR068C
374011374011SubstitutionTA
375081375081SubstitutionCA
375272375272SubstitutionTA
 Nucleotide substitutions within the coding region of BAP2/YBR068C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 139 is now Valine rather than Glutamic Acid, and residue 203 is now Tryptophan rather than Glycine.
New    373969  GAAGTCAAGGTCAATCTTGTCGAGGGGATTTAATAGCGTAAAATCACGGTTGTAAACCAT  374028
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    373966  GAAGTCAAGGTCAATCTTGTCGAGGGGATTTAATAGCGTAAAATCTCGGTTGTAAACCAT  374025

New    375049  AAGAATATAAATGTCCGGATTTATTTTATCATTCCAAAATTGAATAGTCATAGACGCGGT  375108
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    375046  AAGAATATAAATGTCCGGATTTATTTTATCATTCCCAAATTGAATAGTCATAGACGCGGT  375105

New    375229  ATAGGTTACCGCCATCTCACCTGCAGCTTGGATCATGAAGTACGTCACGAAAGAAACCAA  375288
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    375226  ATAGGTTACCGCCATCTCACCTGCAGCTTGGATCATGAAGTACGTCTCGAAAGAAACCAA  375285

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR285W774080774080SubstitutionCG
 A single nucleotide substitution within the coding region of YBR285W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 55 is now Aspartic Acid rather than Histidine.
New    774041  CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCAGATAGAGAAATGGCTAC  774100
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    774037  CTTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCACATAGAGAAATGGCTAC  774096

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR285W, YBR286W774430774430SubstitutionCG
 A single nucleotide substitution was made in the intergenic region between ORFs YBR285W and APE3/YBR286W.
New    774401  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTGTGCTTCCATAAATATATAGTTCAAAA  774460
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    774397  CTTATCGTCAGAAAGAGTGTTCTCTATGTTTTTCTGCTTCCATAAATATATAGTTCAAAA  774456

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR288C779354779356SubstitutionTACACT
 Nucleotide substitutions within the coding region of APM3/YBR288C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 35-36 are now QS rather than RT.
New    779321  TCACTACTGCTATCTTCGAGCAATTGAGGACATGTGGACTGAACGCGGGTCCACAGGTGC  779380
               |||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||
Old    779317  TCACTACTGCTATCTTCGAGCAATTGAGGACATGTGGTACGAACGCGGGTCCACAGGTGC  779376

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR289W
780541780541SubstitutionCA
781354781354SubstitutionGC
 Two nucleotide substitutions within the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
New    780521  ACAACCTCCCACCAATGTTCAGCCAACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA  780580
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    780517  ACAACCTCCCACCAATGTTCAGCCCACTATTGGCCAACTTCCTCAACTTCCAAAATTAAA  780576

New    781311  GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGACATCTCTAATAGT  781370
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    781307  GATATTGTCGTGGGACAAAACCAGTTAATCGATCAATTTGAGTGGGAGATCTCTAATAGT  781366

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR141C527099527099SubstitutionAG
 A single nucleotide substitution within the coding region of YBR141C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 312 is now Proline rather than Serine.
New    527085  AAAGCTACTCGGCTGCGGTGGAACTACCTGCAATTGATACAAACAATAGTACAACTTATT  527144
               |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    527079  AAAGCTACTCGGCTGCGGTGAAACTACCTGCAATTGATACAAACAATAGTACAACTTATT  527138

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR073W385360385361SubstitutionCGGC
 Nucleotide substitutions within the coding region of RDH54/YBR073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 752 is now Alanine rather than Arginine.
New    385318  TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTGCTTCGCGACTTA  385377
               |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Old    385313  TCTTGTTGAGTGCAAAATCGGGAGGTGTAGGATTGAATCTAGTCGGTCGTTCGCGACTTA  385367

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR074W388774388775SubstitutionTTAA
 Nucleotide substitutions within the coding region of YBR074W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 832 is now Asparagine rather than Phenylalanine.
New    388738  ACGAACCAATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGAACAGGGCTTGCACTTTAA  388797
               |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Old    388733  ACGAACCAATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGTTCAGGGCTTGCACTTTAA  388792

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1999-04-26YBR294W791709791709SubstitutionTC
 A change was made to the systematic sequence of Chromosome II within the ORF SUL1/YBR294W. The T at chromosomal coordinate 791709 was changed to a C:
Old: 791700 TATGTGCTGTAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New: 791700 TATGTGCTGCAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759
2011-02-03YBR295W793986793987SubstitutionACCA
 Nucleotide substitutions within the coding region of PCA1/YBR295W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 382 is now Histidine rather than Threonine.
New    793961  GGATTGTGCTGTTACCTCAACTATTTCTGGACACTCTTCGAGTGAAATTTCAAGAATCGT  794020
               |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||
Old    793955  GGATTGTGCTGTTACCTCAACTATTTCTGGAACCTCTTCGAGTGAAATTTCAAGAATCGT  794014

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR295W, YBR296C796707796707SubstitutionAG
 A single nucleotide substitution was made in the intergenic region between ORFs PCA1/YBR295W and PHO89/YBR296C.
New    796671  TAAATTAGAAAAAAATTAATGCATCTTTAAGGTTTTAAATTAGAAATGTTTTAACTTTAA  796730
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    796665  TAAATTAGAAAAAAATTAATGCATCTTTAAGGTTTTAAATTAAAAATGTTTTAACTTTAA  796724

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR001C, YBR002C
241359241359SubstitutionGA
241396241396SubstitutionGA
 Two separate single nucleotide substitutions were made in the intergenic region between ORFs NTH2/YBR001C and RER2/YBR002C.
New    241352  AAAGGAAAAATATAAATAAATAAATAAAATTGAGAAATAAAGATATTTAGTTTTAATGGA  241411
               ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    241354  AAAGGGAAAATATAAATAAATAAATAAAATTGAGAAATAAAGGATATTAGTTTTAATGGA  241413

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR004C245111245111SubstitutionTA
 A single nucleotide substitution within the coding region of GPI18/YBR004C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 187 is now Serine rather than Threonine.
New    245092  TACGGGCACGGAAATGGAGCATTCACGACTCCAAATACCAACAAATGCAAAAAAAAAAGA  245151
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    245094  TACGGGCACGGAAATGGTGCATTCACGACTCCAAATACCAACAAATGCAAAAAAAAAAGA  245153

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1999-04-23
YBR006W
247262247262SubstitutionCG
247367247367SubstitutionCT
248278248278SubstitutionAT
248539248539SubstitutionAT
 Three single nucleotide (nt) substitutions were made to the systematic sequence of Chromosome II within the ORF UGA2/YBR006W, and one substitution was made in the adjacent intergenic region. The C at chromosomal coordinate 247262 was changed to a G, the C at 247367 was changed to a T, the A at 248278 was changed to a T (destroying the stop codon), and the A at 248539 was changed to a T. As a result, the stop was moved 186 nucleotides downstream, increasing the size of the coding sequence from 1308 nt to 1494 nt.
Old: 247261 TCGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320
            | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 247261 TGGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320
Old: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGCTTATATGGTGCTA 247380
            |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGTTTATATGGTGCTA 247380
AND
Old: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTAAT 248280
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTTAT 248280
AND
Old: 248521 GTATATATCTATTGCATGAATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580
            |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New: 248521 GTATATATCTATTGCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580
2011-02-03
YBR007C
250039250039SubstitutionTG
250403250403SubstitutionCG
 Two nucleotide substitutions within the coding region of DSF2/YBR007C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 205 is now Serine rather than Arginine, and residue 327 is now Proline rather than Threonine.
New    250012  AGACCGTTTAGGAGATGGTTTGATGGGTGTTGTATCACTCTTAGTTAACTTGAGTTTGGA  250071
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    250013  AGACCGTTTAGGAGATGGTTTGATGGTTGTTGTATCACTCTTAGTTAACTTGAGTTTGGA  250072

New    250372  CCTATATTTCTCGAAGTTGAAAGGATTAGGGCTATTTGTGCTTCTATTGCCATTTTCAAG  250431
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    250373  CCTATATTTCTCGAAGTTGAAAGGATTAGGCCTATTTGTGCTTCTATTGCCATTTTCAAG  250432

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBR152W, YBR153W547442547442SubstitutionAT
 A single nucleotide substitution was made in the intergenic region between ORFs SPP381/YBR152W and RIB7/YBR153W.
New    547425  GCTTCTTTGTATTACTATCAACATTTTTAGAAGATATGTCTTTGACACCACTGTGTGAAG  547484
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    547419  GCTTCTTTGTATTACTATCAACAATTTTAGAAGATATGTCTTTGACACCACTGTGTGAAG  547478

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2003-01-02YBR086C422272422273SubstitutionTAAT
 We received a direct notification from MIPS about the following sequence changes; we did not have this change in SGD, so the sequence was edited: The T at 422272 was changed to an A, and the A at 422273 was changed to a T. These differences changed amino acid residue 243 of IST2/YBR086C from Tyr (TAC) -> Ile (ATC). The coordinates of YBR086C are not changed due to this sequence update. References: (1) Sequence verification in FY1679 (S288c derivative strain) background by SGD, (2) Personal communication from Anna Kurlandzka (ania218@poczta.ibb.waw.pl).
Old: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGTAGAAAATT 422280
            |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
New: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGATGAAAATT 422280
2011-02-03
YBL056W
114868114868SubstitutionGA
114870114870SubstitutionAG
 Two nucleotide substitutions within the coding region of PTC3/YBL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 369 is now Glycine rather than Aspartic Acid.
New    114832  CGACATGGAAATTGATGATCTTGATACCGAATTAGGCAGCAGTGCTACTCCCTCAAAGTT  114891
               ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||
Old    114835  CGACATGGAAATTGATGATCTTGATACCGAATTGGACAGCAGTGCTACTCCCTCAAAGTT  114894

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YBLCtau1, tF(GAA)B3631236312SubstitutionTA
 A single nucleotide substitution was made in the intergenic region between Ty4 LTR YBLCtau1 and tRNA-Phe tF(GAA)B.
New    36299   TGTGCTTCAGTATTACATTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36358
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    36296   TGTGCTTCAGTATTACTTTTTTTGCCTTCAACGCCTTGATTGTTCTATTTTTGCTAATAA  36355

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR094W
432380432380SubstitutionTC
433377433378SubstitutionCGGC
 Nucleotide changes within the coding region of PBY1/YBR094W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 450 is now Alanine rather than Arginine.
New    432345  GAGTGGATATTAATCGATGGAACTCCAGCATCGTGCGCAAACATCGGGCTGCACCTATTG  432404
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    432339  GAGTGGATATTAATCGATGGAACTCCAGCATCGTGCGCAAATATCGGGCTGCACCTATTG  432398

New    433365  ACTATTGATTTAGATTATGCTGAATTTCTAGACGACGCATTAGATGAAAATTGGGAATTA  433424
               ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
Old    433359  ACTATTGATTTAGATTATCGTGAATTTCTAGACGACGCATTAGATGAAAATTGGGAATTA  433418

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YBR097W
437344437344SubstitutionAG
439496439496SubstitutionTG
 Nucleotide change(s) in the coding region of VPS15/YBR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 134 is now Alanine rather than Threonine, and residue 851 is now Arginine rather than Isoleucine.
New    437325  ATTCATTGCTTTCCAGTTGTTAAATGCATTAAAGGACATTCATAATCTGAATATTGTCCA  437384
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    437319  ATTCATTGCTTTCCAGTTGTTAAATACATTAAAGGACATTCATAATCTGAATATTGTCCA  437378

New    439485  CTTAACTGCTGAAGACAGAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA  439544
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    439479  CTTAACTGCTGAAGACATAAATTGGATTGATAAGTTCCACATTATTGGGCTAACAGAAAA  439538

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-07-16YBL066C9681296962SubstitutionGTGGTTGGATAGAGAACAGTGTTAG TCCCGTAGAATCGTGGTCGTTGTTC TATGATATCAACTTTGGAACAACTC AGAGGTGGATATCCCGTCTTTTAGA GGACCGGGGTCGGACGCGGAATCCA ACTGTCATATATTGACCGAAACAAA G GATGGTTTGGAAGTTAGAAGAAGTT ACAGTGTTAGTGCCCGTAGAAAATC GTTGGTTCGTTTTGTTGCTATTGAT ATCATTACTTTTGGAAAACAAGCTC AGAGGTGGATATGCCGTGCTTTTAG AGGAGCCGGGGTCGGAAACGACGGA ATGCAAATCTGTCATATTATTTGAC TTCGAAGCAATCG
 SGD re-sequenced this region in S288C and found that 37 nucleotide insertions and 4 nucleotide changes were necessary to correct the reference sequence. As a consequence of these changes, SEF1/YBL066C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 1,057 to 1,148 amino acids.
New:         1 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCGATGGTTTGGAAGTTAGAAGAAGTTA 60 
               ||||||||||||||||||||||||||||||||||| ||||| |||   ||| |||| 
Current: 96777 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCG-TGGTT-GGA---TAG-AGAA---- 96826

New:        61 CAGTGTTAGTGCCCGTAGAAAATCGTTGGTTCGTTTTGTTGCTATTGATATCATTACTTT 120
               |||||||||| |||||||||  |||| || |||||  ||| ||| ||||||||  ||||| 
Current: 96827 CAGTGTTAGT-CCCGTAGAA--TCGT-GG-TCGTT--GTT-CTA-TGATATCA--ACTTT 96875

New:       121 TGGAAAACAAGCTCAGAGGTGGATATGCCGTGCTTTTAGAGGAGCCGGGGTCGGAAACGA 180
                ||||  ||| ||||||||||||||| |||| ||||||||||| |||||||||||  ||
Current: 96876 -GGAA--CAA-CTCAGAGGTGGATATCCCGT-CTTTTAGAGGA-CCGGGGTCGGA--CG- 96926

New:       181 CGGAATGCAAATCTGTCATATTATTTGACTTCGAAGCAATCGGTGTACGTGAATGGGACA 240 
               |||||| |||  ||||||||| | |||||  |||| |||  ||||||||||||||||||| 
Current: 96927 CGGAATCCAA--CTGTCATAT-A-TTGAC--CGAAACAAA-GGTGTACGTGAATGGGACA 96979 
1999-04-23YBL066C9748497485SubstitutionTGGC
 A change was made to the systematic sequence of Chromosome II within the ORF SEF1/YBL066C. The two nucleotides TG at positions 575 and 576 (chromosomal coordinates 97484-97485) were changed to GC, altering translation by changing amino acid 192 from Gln (CAA) to Ala (GCA). Note that this ORF is on the Crick strand.
Old: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTTGCTGCTTTAAGGCATT 97500
           |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||
New: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTGCCTGCTTTAAGGCATT 97500

Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
SGD Papers Entry  

1999-04-23YBL067C9404094040SubstitutionGC
 A change was made to the systematic sequence of Chromosome II within the ORF UBP13/YBL067C. The G at chromosomal coordinate 94040 was changed to a C:
Old: 94021 CATAATGGCCGTGTTGTGGGCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New: 94021 CATAATGGCCGTGTTGTGGCCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080
2011-02-03YBL067C9534595345SubstitutionGT
 A single nucleotide substitution within the coding region of UBP13/YBL067C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glutamine rather than Histidine.
New    95333   TCTTTCTTGGTTGATCAGATTCTCTTGATTTTTTTGGAAATTGCAATATATTTTCACGTA  95392
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    95335   TCTTTCTTGGGTGATCAGATTCTCTTGATTTTTTTGGAAATTGCAATATATTTTCACGTA  95394

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
ARS208
237839237839SubstitutionGA
237892237892SubstitutionGA
 Two separate single nucleotide substitutions were made within ARS208.
New    237832  TTGCGAAAATTATTCTTTAATAGTTTAACTAAAAGTAAAAAGTTAGAAATCATAAATAAA  237891
               ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
Old    237834  TTGCGGAAATTATTCTTTAATAGTTTAACTAAAAGTAAAAAGTTAGAAATCATAAATAGA  237893

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
ARS221
631936631936SubstitutionGA
631940631940SubstitutionCA
631981631981SubstitutionAG
 Three single nucleotide substitutions were made within ARS221.
New    631933  CATCATATAACGACTGCTCTCTTTTAACAGCATACGTTCTGTTAATTTATTTGGCCAAAT  631992
               |||||||| ||| |||||||||||||||||||||||||||||||||||||||| ||||||
Old    631928  CATCATATGACGCCTGCTCTCTTTTAACAGCATACGTTCTGTTAATTTATTTGACCAAAT  631987

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2009-05-07YBR073W
 The start site for RDH54/YBR073W was reinstated 102 nt (34 codons) upstream. This is a reversal of the start site change made to this ORF on 2003-09-22. Thank you to Nancy Hollingsworth for bringing this issue to our attention.

Shinohara M, et al. (1997) Characterization of the roles of the Saccharomyces cerevisiae RAD54 gene and a homologue of RAD54, RDH54/TID1, in mitosis and meiosis. Genetics 147(4):1545-56
SGD Papers Entry  Pubmed Entry  PMC full text  
Petukhova G, et al. (2000) Promotion of Rad51-dependent D-loop formation by yeast recombination factor Rdh54/Tid1. Genes Dev 14(17):2206-15
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Chi P, et al. (2006) Yeast recombination factor Rdh54 functionally interacts with the Rad51 recombinase and catalyzes Rad51 removal from DNA. J Biol Chem 281(36):26268-79
SGD Papers Entry  Pubmed Entry  DOI full text  
Kwon Y, et al. (2008) ATP-dependent Chromatin Remodeling by the Saccharomyces cerevisiae Homologous Recombination Factor Rdh54. J Biol Chem 283(16):10445-52
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2009-05-07ARS212, ARS213, ARS221
 The following ARS elements on Chromosome 2 were added to the genome annotation based on Raveendranathan et al. 2006: ARS212, ARS213, and ARS221.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2007-07-09YBR215W
 The start of ORF HPC2/YBR215W was moved 90 nt upstream and an intron was added at relative coordinates 14..97 based on GenBank EF123149 and Juneau et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 85%). The ORF had been annotated as 1872 nt long, but is now 1962 nt in length.

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2007-04-05YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19
 The following Ty1 LTRs on Chromosome II were mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick); the error has now been corrected, so that the LTRs are annotated on the Crick strand: YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19.
2007-04-05YBRCtau2
 YBRWtau2, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBRCtau2 and is annotated on the Crick strand. The name YBRWtau2 is being retained as an alias.
2007-04-05YBLCtau1
 YBLWtau1, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBLCtau1 and is annotated on the Crick strand. The name YBLWtau1 is being retained as an alias.
2007-04-04YBR089C-A
 NHP6B/YBR089C-A mRNA contains an intron in the 5' untranslated region (UTR).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2007-04-04YBL092W
 RPL32/YBL092W mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2007-04-04YBL072C
 RPS8A/YBL072C mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2006-10-04LSR1
 The start site and the stop site for LSR1/snR20 (aka U2 snRNA) were each moved 4 nt upstream, to the positions determined by Ares M. Jr. (1986). Thanks to Wayne Decatur for bringing this update to our attention.

Ares M Jr (1986) U2 RNA from yeast is unexpectedly large and contains homology to vertebrate U4, U5, and U6 small nuclear RNAs. Cell 47(1):49-59
SGD Papers Entry  Pubmed Entry  DOI full text  

2006-10-02ARS230, ARS231
 ARS230 (also known as ARS201.5) and ARS231 (also known as ARS207.5) were added to the genome annotation based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-09-07ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228
 The following ARS elements on Chromosome II were added to SGD based on Nieduszynski et al. 2006: ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-03-02ARS209
 This new ARS element ARS209 was added to the genome annotation based on Bouton & Smith 1986 and Wyrick et al. 2001.

Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata
Bouton AH and Smith MM (1986) Fine-structure analysis of the DNA sequence requirements for autonomous replication of Saccharomyces cerevisiae plasmids. Mol Cell Biol 6(7):2354-63
SGD Papers Entry  Pubmed Entry  PMC full text  

2005-11-10snR161
 New snoRNA, snR161, added based on the work of Olivas et al. 1997 and Schattner et al. 2004. Note that Olivas et al. refer to this snoRNA as RNA161.

Olivas WM, et al. (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  SGD Curated Comments & Errata

2005-11-08YBR056C-B, YBR201C-A
 Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that two new ORFs, YBR056C-B and YBR201C-A, be added to the S. cerevisiae genome annotation.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2005-11-07YBR286W
 After consultation with MIPS, SGD will incorporate the annotation change suggested by Kellis et al. 2003 for APE3/YBR286W. The start site is being moved 78 nt downstream from chromosomal coordinate 774618 to 774696, resulting in a predicted protein of 537 aa, as opposed to the previously annotated 563 aa. The 1692-nt ORF is now 1614 nt.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2004-10-12CEN2
 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-04-01YBR230W-A
 ORF identified by John McCutcheon and Sean Eddy.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  SGD Curated Comments & Errata

2004-04-01RUF8
 Feature annotation removed per John McCutcheon and Sean Eddy.

McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713
SGD Papers Entry  

2004-01-07YBL091C-A
 Based on comparison to related fungi, Brachat et al., Blandin et al., and Cliften et al. all proposed an intron and 5' extension for YBL091C-A. The resulting ORF is in the same frame with the start codon shifted 316 bp upstream; the protein has a 76-residue extension at the N-terminus.

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
SGD Papers Entry  Pubmed Entry  DOI full text  
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-12-17YBR111W-A
 The size of the first intron of YBR111W-A was increased and a second intron was added on the basis of conserved splice sites predicted by Cliften et al. 2003, as well as subsequent experimental evidence (GenBank AY278445). The chromosomal coordinates of the coding sequence have changed from 462094-462172..462175-462392 to 462094-462164..462245-462384..462455-462534.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-12-17YBR255C-A
 The boundaries of the intron in ORF YBR255C-A were shifted by 1 bp on 5' end and 2 bp on 3' end on basis of conserved splice sites in other fungal species as predicted by Blandin et al. 2000.

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
SGD Papers Entry  Pubmed Entry  DOI full text  

2003-09-22YBR280C
 The start site for YBR280C was moved 15 nt (5 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBR172C
 The start site for SMY2/YBR172C was moved 150 nt (50 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBL068W
 The start site for PRS4/YBL068W was moved 84 nt (28 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBR073W
 The start site for RDH54/YBR073W was moved 102 nt (34 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBR058C
 The start site for UBP14/YBR058C was moved 66 nt (22 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBR122C
 The start site for MRPL36/YBR122C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The predicted protein translated from the conserved methionine contains a predicted mitochondrial targeting signal sequence (using both MitoProt (MIPS) and Predotar), while the predicted protein translated from the previously annotated S. cerevisiae start codon does not.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBL089W
 The start site for AVT5/YBL089W was moved 150 nt (50 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBR264C
 The start site for YPT10/YBR264C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBR263W
 The start site for SHM1/YBR263W was moved 225 nt (75 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YBR095C
 The start site for YBR095C was moved 69 nt (23 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL02L, TEL02L-XC, TEL02L-XR, TEL02L-YP, TEL02R, TEL02R-TR, TEL02R-XC, TEL02R-XR
 The chromosomal locations for the following telomeric elements on Chromosome 2 were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL02L, TEL02L-XC, TEL02L-XR, TEL02L-YP, TEL02R, TEL02R-XC, TEL02R-XR, TEL02R-TR.

Note that TEL02L does have telomeric repeats (TEL02L-TR), but they are missing from the genome annotation due to sequencing difficulties encountered during the initial genome sequencing efforts in the 1990s.
2003-07-29YBL006W-A, YBL071C-B, YBL100W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A
 Thanks to Kumar et al. for providing the coordinates of the following 11 ORFs on Chromosome 2: YBL006W-A, YBL071C-B, YBL101W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

2003-07-29YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A
 Thanks to Kessler et al. for providing the coordinates of the following seven ORFs on Chromosome 2: YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A
 Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following four ORFs on Chromosome 2: YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2003-07-29YBR056W-A, YBR109W-A, YBR126W-B
 Thanks to MIPS for providing the coordinates of the following three ORFs on Chromosome 2: YBR056W-A, YBR109W-A, YBR126W-B.
2003-07-29YBL039W-B, YBR111W-A
 Thanks to Brachat et al. for providing the coordinates of the following two ORFs on Chromosome 2 based on homology to Ashbya gossypii: YBL039W-B, YBR111W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-03-06RUF8
 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  SGD Curated Comments & Errata

2001-01-30YBL071W-A
 ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
2000-08-11YBR089C-A
 old name: YBR090C-A; new name: YBR089C-A; date: 11/1998; old coord: ChrII 426447 426148; SGDID: S0002157; Name changed due to nomenclature
2000-07-14YBR186W
 Davis et al. demonstrated an intron and 3' exon in PCH2/YBR186W that were not previously annotated. The addition of this intron and exon alters the C-terminus of the protein product and increases the protein size from 537 to 564 amino acids.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

1999-11-17YBL059C-A
 A new ORF, YBL059C-A, was identified from EST analysis (Evan Hurowitz in Pat Brown's lab).
1998-05-21YBL091C-A, YBL107W-A
 The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  

Jump to: Sequence Changes | Annotation Changes without Sequence Changes