Chromosome IX History |
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
| Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2011-02-03 | tK(CUU)I | 300235 | 300235 | Insertion | G | |
|   | A single nucleotide was inserted near the 3' end of tK(CUU)I, altering the coding sequence and making this tRNA one nucleotide longer.
New 300179 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTAGGGGGCTCGAAC 300248
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 300178 CGTCTCTAATGATTTAATTTTTCTATTGAATTGAAAATGGTAAAAAGATAGCCCTGTA-GGGGCTCGAAC 300246Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YIL123W | ||||||
| 128409 | 128409 | Insertion | CT | |||
| 128403 | 128403 | Insertion | C | |||
|   | Three nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New 128401 CTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128460
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old 128401 CTG-GGATAG--CCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAGAATGAGAAAA 128457
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YIL012W | 333321 | 333321 | Insertion | C | |
|   | A single C nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New 333299 TTGGCCTTATACGAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333358
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old 333297 TTGGCCTTATACGAGGCGTACTTCG-CTTGCGGGAAAAAAAATTTCTTTTGTAAGCGAGG 333355
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YIL083C | 203638 | 203638 | Substitution | A | C |
|   | A single nucleotide substitution in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine.
New 203631 CTCTTCAATGCTATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203700
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 203628 CTCTTCAATGATATGGTGTTTTTCATCCAAACGTACCCAATCTCCCTTTCTGTTTTCAGGGGATACGAAA 203697
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YIR041W, YIR042C | 435029 | 435029 | Deletion | G | |
|   | A single nucleotide was deleted in the intergenic region between PAU15/YIR041W and YIR042C.
New 434999 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCT-GGTTTAAATCAAAACCGAGAGCCCA 435057
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old 434995 TGTGAGCCTTAGTAAGGTGAGAGCTACGCTTCCTGGGTTTAAATCAAAACCGAGAGCCCA 435054Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YIR039C, YIRCdelta6 | 427189 | 427189 | Insertion | A | |
|   | A single nucleotide was inserted in the intergenic region between YIRCdelta6 and YPS6/YIR039C.
New 427139 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAGAAAACTTCAGTACCAC 427208
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old 427136 GGAAAAACGGCAACAGTATTTGTAAGCGCTTTCCAGTAAAATAACGAAAAAGAG-AAACTTCAGTACCAC 427204Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YIL056W, tS(UGA)I | 249623 | 249623 | Deletion | T | |
|   | A single nucleotide was deleted from the intergenic region between SUP17/tS(UGA)I and VHR1/YIL056W.
New 249601 GAAATCTTTCTACCGTCGTCTTCTC-TTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249659
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old 249598 GAAATCTTTCTACCGTCGTCTTCTCTTTTTTTTTTTTTTTACTATAAATCAATGTGCTCT 249657Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YIL051C, YIL052C | 257479 | 257479 | Deletion | A | |
|   | A single nucleotide was deleted in the intergenic region between ORFs RPL34B/YIL052C and MMF1/YIL051C.
New 257460 AAAGTAAAAATTCAAAAATTC-AAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257518
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old 257458 AAAGTAAAAATTCAAAAATTCAAAAAAAAAAAAAGCTGAAAGGAAAACACCCAAACAACA 257517Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2010-01-05 | PWR1 |
|   | New ncRNA PWR1 was added to the genome annotation based on Bumgarner et al. 2009.Bumgarner SL, et al. (2009) Toggle involving cis-interfering noncoding RNAs controls variegated gene expression in yeast. Proc Natl Acad Sci U S A 106(43):18321-6 ![]() |
| 2010-01-05 | ICR1 |
|   | New ncRNA ICR1 was added to the genome annotation based on Bumgarner et al. 2009.Bumgarner SL, et al. (2009) Toggle involving cis-interfering noncoding RNAs controls variegated gene expression in yeast. Proc Natl Acad Sci U S A 106(43):18321-6 ![]() |
| 2009-05-07 | ARS902, ARS904, ARS910, ARS915, ARS918, ARS921 |
|   | The following ARS elements on Chromosome 9 were added to the genome annotation based on Raveendranathan et al. 2006: ARS902, ARS904, ARS910, ARS915, ARS918, and ARS921.Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 |
| 2007-04-04 | YIL123W |
|   | SIM1/YIL123W mRNA contains an intron in the 5' untranslated region (UTR).Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 |
| 2007-04-03 | YILWdelta2 |
|   | YILCdelta2, a Ty2 LTR on Chromosome IX, was mistakenly annotated on the wrong strand (i.e., on Crick instead of Watson). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YILWdelta2 and is annotated on the Watson strand. Thanks go to Bertrand Llorente for bringing this annotation error to our attention. The name YILCdelta2 is being retained as an alias. |
| 2006-10-03 | ARS923 |
|   | ARS923, also known as ARS913.5, was added to the genome annotation based on Nieduszynski et al. 2006.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-09-08 | ARS909, ARS911, ARS912, ARS914, ARS919, ARS920, ARS922 |
|   | The following new ARS elements on Chromosome IX were added to SGD based on Nieduszynski et al. 2006: ARS909, ARS911, ARS912, ARS914, ARS919, ARS920, ARS922.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-09-08 | ARS913 |
|   | The coordinates of ARS element ARS901, also known as ARS913, were updated based on Nieduszynski et al. 2006.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-05-09 | CEN9 |
|   | The previously annotated 3' boundary of CEN9 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 |
| 2006-01-24 | YIL053W |
|   | Based on 5' SAGE transcription start site data and experimental verification of the start methionine, the start site for YIL053W was moved 63 bp downstream. As a consequence, YIL053W was shorted on the 5' end, altering the N-terminus and shortening the size of the predicted protein from 271 amino acids to 250 amino acids.Norbeck J and Blomberg A (1997) Metabolic and regulatory changes associated with growth of Saccharomyces cerevisiae in 1.4 M NaCl. Evidence for osmotic induction of glycerol dissimilation via the dihydroxyacetone pathway. J Biol Chem 272(9):5544-54 Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 |
| 2006-01-23 | YIL043C |
|   | Based on based on 5' SAGE TSS data, Zhang and Dietrich suggest that the start site for CBR1/YIL043C be moved 114 nt (38 codons) downstream. These data corroborate the start site that Kellis et al. predicted based on the alignment of multiple orthologous sequences. This change has been incorporated into SGD and the numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 |
| 2005-11-22 | YIL076W |
|   | Based on 5' SAGE transcription start site data and experimental verification of the start methionine, the start site for YIL076W was moved 189 bp downstream. As a consequence, YIL076W was shortened on the 5' end, altering the N-terminus and shortening the size of the predicted protein from 359 amino acids to 296 amino acids.Duden R, et al. (1998) epsilon-COP is a structural component of coatomer that functions to stabilize alpha-COP. EMBO J 17(4):985-95 Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 |
| 2005-11-21 | YIL102C-A |
|   | Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YIL102C-A, be added to the S. cerevisiae genome annotation.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2004-10-12 | CEN9 |
|   | Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 |
| 2003-09-27 | YIL073C |
|   | Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for SPO22/YIL073C. The resulting ORF is in the same frame, but has an 89-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YIL145C |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PAN6/YIL145C be moved 108 nt (36 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YIR014W |
|   | The automated comparison of closely related Saccharomyces species suggests that the start site for YIR014W be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-09 | TEL09L, TEL09L-TR, TEL09L-XC, TEL09L-XR, TEL09L-YP, TEL09R, TEL09R-TR, TEL09R-XC, TEL09R-XR |
|   | The chromosomal locations for TEL09L-XC, TEL09L-YP, TEL09R-TR, TEL09R-XR, TEL09R-XC, TEL09R, TEL09L-XR, TEL09L-TR, and TEL09L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
| 2003-07-29 | YIL002W-A, YIL046W-A, YIR018C-A, YIR021W-A |
|   | Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome IX ORFs: YIL002W-A, YIL046W-A, YIR018C-A, and YIR021W-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 |
| 2003-07-29 | YIL020C-A, YIL029W-A, YIL030W-A, YIL047C-A, YIL066W-A, YIL068W-A, YIL071W-A, YIL100C-A, YIL115W-A, YIL142C-A, YIL156W-A, YIL171W-A, YIR017W-A, YIR020C-B, YIR023C-A, YIR030W-A, YIR036W-A |
|   | Thanks to MIPS for providing the coordinates of the following Chromosome IX ORFs: YIL020C-A, YIL029W-A, YIL030W-A, YIL047C-A, YIL066W-A, YIL068W-A, YIL071W-A, YIL100C-A, YIL115W-A, YIL142C-A, YIL156W-A, YIL171W-A, YIR017W-A, YIR020C-B, YIR023C-A, YIR030W-A, and YIR036W-A. |
| 2003-07-29 | YIL021C-A, YIL105W-A, YIL177W-A |
|   | Thanks to Kumar et al. for providing the coordinates of the following Chromosome IX ORFs: YIL021C-A, YIL105W-A, and YIL177W-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 ![]() |
| 2003-07-29 | YIL134C-A |
|   | Thanks to Kessler et al. for providing the coordinates of YIL134C-A.Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 |
| 2003-07-29 | YIL156W-B |
|   | Thanks to Brachat et al and Cliften et al. for providing the coordinates of YIL156W-B.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2001-03-06 | ARS913 |
|   | Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan |
| 1999-11-17 | YIL106W |
|   | Spingola et al. 1999 identified an intron in YIL106W that was not previously annotated, and also identified a different start codon. The intron has been added, and the start shifted upstream. The old chromosomal coordinates for YIL106W were 166731-167441 (coding 1-711). The new chromosomal coordinates are 166412-167441 (coding 1-20..106-1030).Spingola M, et al. (1999) Genome-wide bioinformatic and molecular analysis of introns in Saccharomyces cerevisiae. RNA 5(2):221-34 |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |