Chromosome X History Help



 

This page lists all sequence and annotation changes that have been made to the Chromosome X systematic reference sequence since its intial release on 1996-07-31.


SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of ChangeOld SequenceNew Sequence
2011-02-03YJR154W, YJR155W727112727112SubstitutionCG
 A single nucleotide substitution was made within the intergenic region between ORFs YJR154W and AAD10/YJR155W.
New    727077  GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCGCAAAATGTGCTCTT  727136
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    727067  GTTGGGGACTGGTTAATTAATTGAATAGCTTCATAACCCACCGCCCCAAAATGTGCTCTT  727126

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJR153W, YJR154W
724992724992SubstitutionGT
724284724284SubstitutionTG
 Two separate single nucleotide substitutions were made in the intergenic region between ORFs PGU1/YJR153W and YJR154W.
New    724247  AAATGCGACTAAGTACTACAATTGAAACGAATGAGCGCACTTCATCTGCCTACAAAACGC  724306
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    724237  AAATGCGACTAAGTACTACAATTGAAACGAATGAGCGCACTTCATCTTCCTACAAAACGC  724296
New    724967  TTGTAATATGCGTTACTAGTAATTCCTTTGAATTTTTGAATGCTTTAACTGTGAGTTGGC  725026
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    724957  TTGTAATATGCGTTACTAGTAATTCCTTTGAATTTGTGAATGCTTTAACTGTGAGTTGGC  725016

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR152W, YJR153W722285722285SubstitutionGT
 A single nucleotide substitution was made within the intergenic region between ORFs DAL5/YJR152W and PGU1/YJR153W.
New    722267  CCGGATATGAGTAAGAGTGATCTTGCCGTAGAGATAATAGCTGCACAAAGGCCAAGGATT  722326
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    722257  CCGGATATGAGTAAGAGTGATCTTGCCGGAGAGATAATAGCTGCACAAAGGCCAAGGATT  722316

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJR151W-A, YJR152W
717775717775SubstitutionGA
717671717671SubstitutionCA
 Two separate single nucleotide substitutions were made in the intergenic region between ORFs YJR151W-A and DAL5/YJR152W.
New    717672  AAAAAAAAAACCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA  717731
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    717662  AAAAAAAAACCCAGATCTGTTGATCAGTTGTAATCGTGTAAACGAGTACAAAAGGCCAGA  717721
New    717732  GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAAGGAGTA  717791
               ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Old    717722  GACAGCTTCTACTCCAAGCTTAAGATACGTATACACAAAAGATTTTTACTTGAGGGAGTA  717781

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJR151C, YJR151W-A
716502716502SubstitutionCA
716149716149SubstitutionAT
 Two separate single nucleotide substitutions were made in the intergenic region between ORFs DAN4/YJR151C and YJR151W-A.
New    716147  TTGATGTCGTCGTTCAATAGACATTCACATAACTTTACTCTACGTGCTATACGCGCTACC  716206
               |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    716137  TTGATGTCGTCGATCAATAGACATTCACATAACTTTACTCTACGTGCTATACGCGCTACC  716196
New    716497  AGTCTACATGTGACAAAAAGAAAACCCAAATACTTCTTGGCTATGAATGTTATCGTTTGA  716556
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    716487  AGTCTACATGTGACACAAAGAAAACCCAAATACTTCTTGGCTATGAATGTTATCGTTTGA  716546

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR151C713832713832SubstitutionCG
 A single nucleotide substitution was made within ORF DAN4/YJR151C. Note that the protein sequence was not affected.
New    713807  CTCGAGGAAACAACGGCTGAAGTGAAAGTGGATGTGGCAGATAGACTTTCAGTAGAAGAA  713866
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    713797  CTCGAGGAAACAACGGCTGAAGTGAAAGTGGATGTCGCAGATAGACTTTCAGTAGAAGAA  713856

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR150C709354709354SubstitutionCT
 A single nucleotide substitution within the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine.
New    709317  TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTTCATTCGCAAGTG  709376
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    709307  TGGAAGAAGCCTCTGTGGTAGAAGCTGGTACTGCAGTAGCAATACCTCCATTCGCAAGTG  709366

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR149W, YJR150C708438708438SubstitutionAT
 A single nucleotide substitution was made within the intergenic region between ORFs YJR149W and DAN1/YJR150C.
New    708407  GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATATACGTCGCTATTGGATCGT  708466
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    708397  GACACAAATTTTCTGGATGACCTTTTTCTATATGATATATAAACGTCGCTATTGGATCGT  708456

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR149W708354708354SubstitutionTA
 A single nucleotide substitution within the coding region of YJR149W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 402 is now Aspartic Acid rather than Valine.
New    708347  CGCAAGATTGAAAATTGACGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT  708406
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    708337  CGCAAGATTGAAAATTGTCGGAAAATAATATAAATACATATAAAAGACCTGATACTTATT  708396

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR138W687982687982SubstitutionAG
 A single nucleotide substitution was made within ORF IML1/YJR138W. Note that the protein sequence was not affected.
New    687947  AGAGAAAGAAAAAAAAGGAAGAAAAACTAAGAGAGAAGAAATACAGCCTGAAGTTATGTT  688006
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    687937  AGAGAAAGAAAAAAAAGGAAGAAAAACTAAGAGAGAAGAAATACAACCTGAAGTTATGTT  687996

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR135C, YJR135W-A676910676910SubstitutionGA
 A single nucleotide substitution was made within the intergenic region between ORFs MCM22/YJR135C and TIM8/YJR135W-A.
New    676907  ATTCATTTATATGAAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA  676966
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    676897  ATTCATTTATATGGAAGTATTGAAGAAGAGGTAAAAAGGAAAACAAATTTACAAACAACA  676956

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR132W670283670283SubstitutionTG
 A single nucleotide substitution within the coding region of NMD5/YJR132W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 258 is now Alanine rather than Serine.
New    670247  TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGGCTATATCAGATAT  670306
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    670237  TTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGTCTATATCAGATAT  670296

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR129C664657664657SubstitutionGT
 A single nucleotide substitution within the coding region of YJR129C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 118 is now Lysine rather than Threonine.
New    664657  TTCCTCAATTTTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT  664716
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    664647  TTCCTCAATTGTGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCAT  664706

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR108W, YJR109C629480629480SubstitutionTA
 A single nucleotide substitution was made within the intergenic region between ORFs ABM1/YJR108W and CPA2/YJR109C.
New    629447  GATCTACTTTTGTTCAAGATAATAATACTGGGGTAGAATATACACTAAGAAGTCTCTTTG  629506
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    629437  GATCTACTTTTGTTCAAGATAATAATACTGGGGTAGAATATACTCTAAGAAGTCTCTTTG  629496

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR107W, YJR108W628634628634DeletionT
 A single nucleotide deletion was made within the intergenic region between ORFs YJR107W and YJR108W.
New    628608  TTATTCCAGTTCTCCTGGCCACTAATCCCGGCTACGC-TTTTGTTGAAATAGTATTCTTC  628666
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    628597  TTATTCCAGTTCTCCTGGCCACTAATCCCGGCTACGCTTTTTGTTGAAATAGTATTCTTC  628656

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJR107W
627524627525SubstitutionCCGG
627367627369SubstitutionCCTTCC
 Nucleotide change(s) in the coding region of YJR107W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 14 is now Proline rather than Leucine, and residue 66 is now Glycine rather than Proline.
New    627368  TGCCCATCACTCCATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC  627427
               |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||
Old    627357  TGCCCATCACCCTATATATCTATGAGCGTCTAGTATATTTCTTCAACGACGGAGGTTGTC  627416

New    627488  CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGGGTCAAACAGTGG  627547
               |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||
Old    627477  CACCACATATTAACTTCTGCAATGATGAGATAATTAACCCAACAGCGCCTCAAACAGTGG  627536

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR106W, YJR107W627314627314DeletionT
 A single nucleotide deletion was made within the intergenic region between ORFs ECM27/YJR106W and YJR107W.
New    627289  ATAACAATGATGCCTGCCAGACTTTTCATACTATATC-TTTTTGTAGTACTCATGCCTGT  627347
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    627277  ATAACAATGATGCCTGCCAGACTTTTCATACTATATCTTTTTTGTAGTACTCATGCCTGT  627336

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR106W625480625480SubstitutionGA
 A single nucleotide substitution within the coding region of ECM27/YJR106W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 219 is now Asparagine rather than Aspartic Acid.
New    625479  GAGCCTCAGAGAAAACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT  625538
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    625467  GAGCCTCAGAGAAGACTCCGTTTCTCCTTTTTTGGATGACTCTCTGATGGCTTCTGGTTT  625526

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJR103W622414622414Insertion C
 A single C nucleotide was inserted very near the 3' end of ORF URA8/YJR103W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 14 amino acids longer.
New    622379  GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGCCTCCGGCACACT  622438
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    622368  GAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAG-CTCCGGCACACT  622426

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJR098C
613918613918Insertion T
613905613905Insertion T
613904613904Insertion T
 Three nucleotides were inserted near the middle of ORF YJR098C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New    613899  TAAAAAAGTTGGTTTCTTTAGTGAAAATAGTTTTATTCCACATCACATCATCTCCAAACC  613958
               |||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||
Old    613891  TAAAAAAGTTGGTT-C-TTAGTGAAAATAG-TTTATTCCACATCACATCATCTCCAAACC  613947

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1997-07-27
YJR092W
601831601831SubstitutionAG
598745598745DeletionA
598678598678DeletionG
598510598510DeletionT
 Three separate single nucleotide deletions were made in the systematic sequence in the region upstream of the ORF BUD4/YJR092W. The T at 598510 was deleted, as was the G at 598678, and the A at 598745. In addition, a single nucleotide transition was made within BUD4/YJR092W. The A at 601831 was changed to a G.
New: 598501 ACGCAAAAT-GGTTCCGAAGATACACCACACAACTGGAAGCTTCCGCTGCAGGAAATAGG 598559
            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 598501 ACGCAAAATTGGTTCCGAAGATACACCACACAACTGGAAGCTTCCGCTGCAGGAAATAGG 598560
New: 598620 TAGAGGTCGATCACCTTCTAAGATGTCTACCATCTCAAATGAAAGCCTTAATTTGGG-TC 598678
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old: 598621 TAGAGGTCGATCACCTTCTAAGATGTCTACCATCTCAAATGAAAGCCTTAATTTGGGGTC 598680
New: 598739 AAAA-CTCTGTTGCCAACGGGGCACTTGGTCATGCCAATTCTCCCAAAGTGCTTAATAAT 598797
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 598741 AAAAACTCTGTTGCCAACGGGGCACTTGGTCATGCCAATTCTCCCAAAGTGCTTAATAAT 598800
New: 601798 TTTGAATTGCCCATAGATTTTAAAGGAAAAGCCGAAACATCCTCCGCTTCTTCTGAAAGA 601857
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old: 601801 TTTGAATTGCCCATAGATTTTAAAGGAAAAACCGAAACATCCTCCGCTTCTTCTGAAAGA 601860
2008-06-04
YJR092W
599750599750SubstitutionAT
599715599715DeletionA
599640599640DeletionA
599597599597DeletionA
 John Koschwanez from Andrew Murray's lab at Harvard University sequenced BUD4/YJR092W in the S288C background and noted errors in the systematic reference sequence. As a result, the following corrections were made to the sequence of Chromosome 10 within BUD4/YJR092W: change A to T at 599750, delete A at 599715, delete A at 599640, delete A at 599597.
  New: 841    AGTAACAATTCACATTCTGATTCAAGATC-GCCAACAGCCTCTGTGGAGGATTTAAACAT 899
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
  Old: 599568 AGTAACAATTCACATTCTGATTCAAGATCAGCCAACAGCCTCTGTGGAGGATTTAAACAT 599627

  New: 900    TTCAACGAATCT-GCCGGGTGCTGATTCCAGCCAAAATAATCCAGTCACTACTGATGCGG 958
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
  Old: 599628 TTCAACGAATCTAGCCGGGTGCTGATTCCAGCCAAAATAATCCAGTCACTACTGATGCGG 599687

  New: 959    ATGCGCTTATTGAAAACGATGTTGTGC-GGGACCTTCAACAGAATATGGAACATATCGAT 1017
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
  Old: 599688 ATGCGCTTATTGAAAACGATGTTGTGCAGGGACCTTCAACAGAATATGGAACATATCGAT 599747

  New: 1018   GATGCTTTTGATGAGAAAAAAGTTCTTGACGAAGGTTGCAGCAATGAGCCCGTTACCTTT 1077
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
  Old: 599748 GAAGCTTTTGATGAGAAAAAAGTTCTTGACGAAGGTTGCAGCAATGAGCCCGTTACCTTT 599807

Koschwanez J and Murray A (2008)
SGD Papers Entry  

2004-02-12YJR013W460195460195DeletionT
 Brachat et al. predicted and confirmed the deletion of a single T nt. As a consequence of this sequence change, YJR013W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 305 to 403 amino acids. This change was also predicted by Cliften et al. and Kellis et al..
New: 460173 GTACACTGATATCGACTATTTT-GTGTTTCATGATGCTGCTAAATATGTATACGAAGGCA 460231 
            |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| 
Old: 460173 GTACACTGATATCGACTATTTTTGTGTTTCATGATGCTGCTAAATATGTATACGAAGGCA 460232 

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2011-02-03YJR001W, YJR002W438633438633Insertion A
 A single nucleotide insertion was made in the intergenic region between ORFs AVT1/YJR001W and MPP10/YJR002W.
New    438599  ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAAATTCATTTACATTAGCTC  438658
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    438592  ATTATTTCATAATCGACGAGGGGCATACTTACTCTACTTAAA-TTCATTTACATTAGCTC  438650

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJLWdelta10, YJLWtau4
422450422450Insertion C
422448422448SubstitutionGC
 A single nucleotide substitution and a single nucleotide insertion were made in the intergenic region between Ty4 LTR YJLWtau4 and Ty1 LTR YJLWdelta10.
New    422439  CAGTAAAATACTACGCGCCTAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT  422498
               ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
Old    422433  CAGTAAAATACTACGGGC-TAGTATAATGACTTCTATATCCAAAATTTTTAAGTTAACCT  422491

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJLWtau4422266422266DeletionC
 A single nucleotide deletion was made within Ty4 LTR YJLWtau4.
New    422260  TCATTAATAAAGC-TTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG  422318
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    422253  TCATTAATAAAGCCTTTTTGACCTCTACCTATGAGCAATAAACCATATCCATCAATAGTG  422312

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL008C421510421510SubstitutionGA
 A single nucleotide substitution was made within ORF CCT8/YJL008C. Note that the protein sequence was not affected.
New    421490  ATGGTTAACAATGATCTTGTTTCTACCACAGGGTCCCATAGAAGTCAAACACATTTGATG  421549
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    421483  ATGGTTAACAATGATCTTGTTTCTACCGCAGGGTCCCATAGAAGTCAAACACATTTGATG  421542

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL011C414287414288SubstitutionCGGC
 Nucleotide substitutions within the coding region of RPC17/YJL011C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 159 is now Glycine rather than Alanine.
New    414280  TACACTCATGCGTAGCCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT  414339
               ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
Old    414273  TACACTCATGCGTACGCAGAGATGATCTCTAGCATTTCCTCAATTGTTTTTTCGTCAAAT  414332

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-02-17YJL012C, YJL012C-A411268411268InsertionC
 Heinz Neumann and coworkers predicted and confirmed a single nt insertion in VTC4/YJL012C (Genbank accession number AY264259). As a consequence of this sequence change, VTC4/YJL012C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 648 to 721 amino acids. As a consequence of this change, YJL012C-A was merged with VTC4/YJL012C.
New: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCCCGGTGGGGCACGAATTTGAGT 411289
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 411230 TTTTGGTTCCACACGAACTGGCACACATATCGTCTTTCC-GGTGGGGCACGAATTTGAGT 411288 

Muller O, et al. (2003) Role of the Vtc proteins in V-ATPase stability and membrane trafficking. J Cell Sci 116(Pt 6):1107-15
SGD Papers Entry  Pubmed Entry  DOI full text  

2011-02-03YJL015C407437407437Insertion A
 A single nucleotide was inserted within the ORF YJL015C very near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 30 amino acids shorter.
New    407400  TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAAATAGCAAATCGCCACT  407459
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    407394  TAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAA-TAGCAAATCGCCACT  407452

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2003-09-29YJL016W, YJL017W406238406238InsertionG
 Due to insertion of G after the G at position 406238, the ORF YJL017W (405284-406261 (1-978)) was merged into YJL016W (406453-406968 (1-516)). The resulting longer ORF will retain the name YJL016W, with new coordinates 405284 - 406969 (1-1686). YJL017W is now an alias of YJL016W.

Old: 406201 TAGTGGATCCATCTATAGTAGTGCAAACAACGGCAGTG-TGACAGCAGCTCGACAGCATT 406259
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New: 406201 TAGTGGATCCATCTATAGTAGTGCAAACAACGGCAGTGGTGACAGCAGCTCGACAGCATT 406260

References:

1. Sequence verification in S288c strain at SGD
2. Personal Communication from Clyde Denis, University of New Hampshire.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-01-02YJL018W, YJL019W404443404443InsertionG
 Due to the insertion of a single G nucleotide after the G at 404443 on chromosome 10, YJL018W and YJL019W have been merged into one single ORF - MPS3/YJL019W. Note that YJL018W and NEP98 are now aliases for this merged ORF. We thank Sue L. Jasperson and Mark Winey for reporting this sequence error to SGD.

Old: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAG-ATTTGCAAATAATTGA 404459
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New: 404401 CATATCTCTGAGGAAATTTATCATCAACGGAGTGACACCGCAGGATTTGCAAATAATTGA 404460

Jaspersen SL, et al. (2002) Mps3p is a novel component of the yeast spindle pole body that interacts with the yeast centrin homologue Cdc31p. J Cell Biol 159(6):945-56
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2001-06-27
YJL020C, YJL021C
399923399923InsertionGG
399914399914InsertionGG
 Sequence update from MIPS introduces two Gs after position 399914, then two more Gs after position 399923 on chromosome 10. Due to these 4 G insertions, the earlier ORFs YJL020C and YJL021C are now merged into one long ORF YJL020C of 1157 amino acids.

Old: 399901 CTGGAGGTACTGGG--TACTGGG--TACTGAAGGTGCAGAGAGTGCTGGAGGTGCTGGAG 399956
            ||||||||||||||  |||||||  |||||||||||||||||||||||||||||||||||
New: 399901 CTGGAGGTACTGGGGGTACTGGGGGTACTGAAGGTGCAGAGAGTGCTGGAGGTGCTGGAG 399960

References:

  1. Personal communication - Dr. Charlie Boone, University of Toronto, Canada
  2. Sequence update notification from MIPS to SGD, dated June 27, 2001

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

1997-07-27YJL084C275144275145SubstitutionCCGG
 The two CC nucleotides at chromosomal coordinates 275144-275145 within the ORF YJL084C were changed to GG.
New: 275101 AAGTTCGTCTTCTATTAAAACTTGATTTAAATCTGTGAAAAAAGGATTATCGTGTCTTAT 275160
            |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||
Old: 275101 AAGTTCGTCTTCTATTAAAACTTGATTTAAATCTGTGAAAAAACCATTATCGTGTCTTAT 275160
2011-02-03YJL095W, YJL096W247045247045Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs MRPL49/YJL096W and BCK1/YJL095W.
New    247010  AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCGGCCCCAATGGCCATTCAAT  247069
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    247005  AAATCATGTAAATAACAATAAAATTTGACACACTTTCTTCG-CCCCAATGGCCATTCAAT  247063

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL112W205347205347SubstitutionCA
 A single nucleotide substitution was made within ORF MDV1/YJL112W. Note that the protein sequence was not affected.
New    205310  AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACAACGGCTTCCGCTTTTTT  205369
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    205305  AGTGAACGACCAAATAACTCATATAGGAAAAACATTGTCCACCACGGCTTCCGCTTTTTT  205364

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
ARS1008
204550204551SubstitutionGTTG
204535204535Insertion AAT
204533204533SubstitutionAT
204519204519Insertion T
 Several nucleotide changes were made within ARS1008.
New    204510  ATTACACGTTTTAAATACTAATTATTAAAATTTATCCTGATAAGTTGATCTTTATTTCCG  204569
               ||||||||||| ||||||||||||| ||   ||||||||||||||  |||||||||||||
Old    204508  ATTACACGTTT-AAATACTAATTATAAA---TTATCCTGATAAGTGTATCTTTATTTCCG  204564

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJL113W, YJL114W, YJLWTy4-1
198632198632DeletionG
198588198588DeletionA
 Two separate single nucleotide deletions were made within retrotransposon YJLWTy4-1, affecting Gag and Pol ORFs YJL114W and YJL113W.
New    198581  AAAAACAAA-TATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGG-AAAAGG  198639
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||
Old    198579  AAAAACAAAATATAGAAGTTTGCATGGTAGAGATGTCAGAATTAGAGCCTGGGGAAAAGG  198638

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL115W, YJL116C195502195502Insertion C
 A single nucleotide insertion was made in the intergenic region between ORFs NCA3/YJL116C and ASF1/YJL115W.
New    195472  GTCACGTGCGGGTCTAGGCCTGCATAATCGGCCCTCACAGAGGGATCCCGTTACCCATCT  195531
               ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    195470  GTCACGTGCGGGTCTAGGCCTGCATAATCGGCC-TCACAGAGGGATCCCGTTACCCATCT  195528

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL124C, YJL125C187027187027DeletionA
 A single nucleotide deletion was made in the intergenic region between ORFs GCD14/YJL125C and LSM1/YJL124C.
New    187013  ATTGTTCCATCTCCAAA-GGCAGTTGATTAAGTGTACGGATAGGTAAAACTGAATGTGGA  187071
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    187010  ATTGTTCCATCTCCAAAAGGCAGTTGATTAAGTGTACGGATAGGTAAAACTGAATGTGGA  187069

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL127C-B, YJL127W-A180996180996DeletionC
 A single nucleotide deletion was made in the intergenic region between ORFs YJL127W-A and YJL127C-B.
New    180954  TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGC-TCAAAATAGTAAT  181012
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    180950  TTCCGTGCCTGCTGCTATGCTCAAGGGGAACAGAAAAGCAACACGCCTCAAAATAGTAAT  181009

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJL128C
179435179435SubstitutionGC
179433179433SubstitutionCG
 Nucleotide changes within the coding region of PBS2/YJL128C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 222-223 are now GL rather than AV.
New    179394  TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGAGCCCTCGACGGGCACTT  179453
               ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||
Old    179390  TTAGTGGGCATTTTTAATGACATTCCTCCTGGTGGTAATTTGACCGCTCGACGGGCACTT  179449

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL130C171996171997SubstitutionCGGC
 Nucleotide changes within the coding region of URA2/YJL130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 123 is now Alanine rather than Arginine.
New    171954  AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTAGCAAGATAATGAGA  172013
               ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||
Old    171950  AGCTGGGATCCCTTCATTTTGTAACCATTTACCTAAGGAAGATTTACGAAGATAATGAGA  172009

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL155C, YJL156C129110129110SubstitutionTC
 A single nucleotide substitution was made in the intergenic region between ORFs SSY5/YJL156C and FBP26/YJL155C.
New    129104  TCCGCCGCGGCGTTCTACAATTTCACTTAAAATTAGTTTGGGTAATAATTACATACAATG  129163
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    129100  TCCGCCGCGGTGTTCTACAATTTCACTTAAAATTAGTTTGGGTAATAATTACATACAATG  129159

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2009-02-18YJL156C126896126896DeletionT
 Poulsen et al. 2005 report an error in the systematic reference sequence for SSY5/YJL156C. There is an extra A in codon 685 (GAC) that should not be present in the sequence. SGD curators have corrected the sequence as necessary. Deletion of the A results in a frameshift that makes the Ssy5 protein 12 amino acids longer than previously annotated. Many thanks to Thorsten Pfirrmann for bringing this error to our attention.
new: 2113   TCAAAAAGGCAAATCATCCATCTAGTTGTGGATCAATGTCCCATTGAATTTTAGTTACAG 2054
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
old: 126836 TCAAAAAGGCAAATCATCCATCTAGTTGTGGATCAATGTCCCATTGAATTTTAGTTACAG 126895

new: 2053   -CATGTAGTCTCTCCAGGATATCACCTATAGGTGTGAACAAACCAAACTGCCTCTGTTCA 1995
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
old: 126896 TCATGTAGTCTCTCCAGGATATCACCTATAGGTGTGAACAAACCAAACTGCCTCTGTTCA 126955

Poulsen P, et al. (2005) Constitutive Signal Transduction by Mutant Ssy5p and Ptr3p Components of the SPS Amino Acid Sensor System in Saccharomyces cerevisiae. Eukaryot Cell 4(6):1116-24
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2011-02-03
YJL157C, YJL158C
123314123314SubstitutionTC
123309123309SubstitutionTC
 Two separate single nucleotide substitutions were made in the intergenic region between ORFs CIS3/YJL158C and FAR1/YJL157C.
New    123294  GTATGGAATGCATAGGCGGCCCGGCCAGGCACCACGGAAAAAAGCTGATTGTCCTCTTTT  123353
               ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||
Old    123290  GTATGGAATGCATAGGCGGTCCGGTCAGGCACCACGGAAAAAAGCTGATTGTCCTCTTTT  123349

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-02-18YJL159W121258121258InsertionCTACTTCCGCTTCTGCAGCCGCTAC CTCCACTGACCCAGTCGATGCTGTC TCCTGTAAGACTTCTGGTACCTTAG AAATGAACTTAAAGGGCGGTATCTT AACTGACGGTAAGGGTAGAATTGGT TCTATTGTTGCTAACAGACAATTCC AATTTGACGGTCCACCACCACAAGC TGGTGCCATCTACGCTGCTGGTTGG TCTATAACTCCAGACGGTAA
 Both Brachat et al. 2003 and Moukadiri and Zueco 2001 independently predicted and confirmed a 220-bp insertion within HSP150/YJL159W. As a consequence of this sequence change, HSP150/YJL159W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 310 to 387 amino acids.
New: 121225 CAAGTAAGCGATGGCCAAGTCCAAGCTACTACTGCTACTTCCGCTTCTGCAGCCGCTACC 121284
            ||||||||||||||||||||||||||||||||||
Old: 121225 CAAGTAAGCGATGGCCAAGTCCAAGCTACTACTG-------------------------- 121258

New: 121285 TCCACTGACCCAGTCGATGCTGTCTCCTGTAAGACTTCTGGTACCTTAGAAATGAACTTA 121344
Old:        ------------------------------------------------------------

New: 121345 AAGGGCGGTATCTTAACTGACGGTAAGGGTAGAATTGGTTCTATTGTTGCTAACAGACAA 121404
Old:        ------------------------------------------------------------

New: 121405 TTCCAATTTGACGGTCCACCACCACAAGCTGGTGCCATCTACGCTGCTGGTTGGTCTATA 121464
Old:        ------------------------------------------------------------

New: 121465 ACTCCAGACGGTAACTTGGCTATTGGTGACAATGATGTCTTCTACCAATGTTTGTCCGGT 121524
                          |||||||||||||||||||||||||||||||||||||||||||||| 
Old: 121259 --------------CTTGGCTATTGGTGACAATGATGTCTTCTACCAATGTTTGTCCGGT 121304 

Moukadiri I and Zueco J (2001) YJL159w does encode Pir2/Hsp150. Yeast 18(4):323-4
SGD Papers Entry  Pubmed Entry  DOI full text  
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2006-10-04YJL159W120806120909SubstitutionGTGATGGTCAAATTCAAGCTACCAC CAAGACTACCTCTGCTAAGACTACC GCCGCTGCCGTTTCTCAAATCAGTG ATGGTCAAATCCAAGCTACCACCAC TACT AAATTGGTGATGGTCAAATTCAAGC TACCACCAAGACTACCTCTGCTAAG ACTACCGCCGCTGCCGTTTCTCAAA TCAGTGATGGTCAAATCCAAGCTAC CACCACTACTTTAGCCCCAAAGAGC ACCGCTGCTGCCGTTTCTCAAATCG GTGATGGTCAAGTTCAAGCTACCAC CACTACT
 Moukadiri and Zueco 2001 predicted, but did not confirm, two additional sequence insertions in HSP150/YJL159W. These two insertions (6 nts and 72 nts) were later confirmed in S288C by Marinangeli et al. 2004, and have been incorporated in SGD. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.
new 120745 TCTCAGATCGGTGATGGTCAAATCCAAGCTACTACTAAGACTACCGCTGCTGCTGTCTCT 120804
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
old 120745 TCTCAGATCGGTGATGGTCAAATCCAAGCTACTACTAAGACTACCGCTGCTGCTGTCTCT 120804

new 120805 CAAATTGGTGATGGTCAAATTCAAGCTACCACCAAGACTACCTCTGCTAAGACTACCGCC 120864
           |      |||||||||||||||||||||||||||||||||||||||||||||||||||||
old 120805 C------GTGATGGTCAAATTCAAGCTACCACCAAGACTACCTCTGCTAAGACTACCGCC 120858

new 120865 GCTGCCGTTTCTCAAATCAGTGATGGTCAAATCCAAGCTACCACCACTACTTTAGCCCCA 120924
           |||||||||||||||||||||||||||||||||||||||||||||||||||
old 120859 GCTGCCGTTTCTCAAATCAGTGATGGTCAAATCCAAGCTACCACCACTACT--------- 120909

new 120924 AAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAAGCTACCACCACT 120984

old        ------------------------------------------------------------ 

new 120985 ACTTTAGCCCCAAAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAA 121044
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
old 120910 ---TTAGCCCCAAAGAGCACCGCTGCTGCCGTTTCTCAAATCGGTGATGGTCAAGTTCAA 120966

Moukadiri I and Zueco J (2001) YJL159w does encode Pir2/Hsp150. Yeast 18(4):323-4
SGD Papers Entry  Pubmed Entry  DOI full text  
Marinangeli P, et al. (2004) Minisatellites in Saccharomyces cerevisiae genes encoding cell wall proteins: a new way towards wine strain characterisation. FEMS Yeast Res 4(4-5):427-35
SGD Papers Entry  Pubmed Entry  DOI full text  

2004-02-19YJL160C118303118303DeletionT
 Kellis et al. and Brachat et al. independently predicted and confirmed the deletion of a single T nt. As a consequence of this sequence change, YJL160C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 180 to 287 amino acids.
New: 118271 CTTTTTCATTATTTGGTTTCTTTGTTGGCTCT-AACTTACTCTTGGAAAGCACAGAACTA 118329
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old: 118271 CTTTTTCATTATTTGGTTTCTTTGTTGGCTCTTAACTTACTCTTGGAAAGCACAGAACTA 118330 

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2006-01-18
YJL162C
114328114328SubstitutionGC
114177114177SubstitutionTA
 SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, JJJ2/YJL162C has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 482 to 583 amino acids.
(1) Substitute A for the T at 114177
New: 114156 ATCTCTGGTATTTCCAAATCTAAGATCTCGGGTGTAAT 114193
            ||||||||||||||||||||| ||||||||||||||||
Old: 114156 ATCTCTGGTATTTCCAAATCTTAGATCTCGGGTGTAAT 114193

AND

(2) Substitute C for the G at 114328
New: 114311 TAACGAGTCATTAATTGCATCCATCATAAAATAATC 114346
            ||||||||||||||||| ||||||||||||||||||
Old: 114311 TAACGAGTCATTAATTGGATCCATCATAAAATAATC 114346

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03ARS1007, YJL162C113842113842SubstitutionGA
 A single nucleotide substitution was made in the intergenic region between ARS1007 and ORF JJJ2/YJL162C.
New    113814  ATTCAAATTATTTCCATCCTGGCGTAAGGACGACGGGTATATGCTCATTAAGAAGAGCGT  113873
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    113810  ATTCAAATTATTTCCATCCTGGCGTAAGGACGGCGGGTATATGCTCATTAAGAAGAGCGT  113869

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJL163C, YJL164C
111646111646DeletionC
111288111288DeletionG
 Two separate single nucleotide deletions were made in the intergenic region between ORFs TPK1/YJL164C and YJL163C.
New    111246  AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGG-TCAGATTCCTT  111304
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    111240  AAGCCGATTGAAAATGCAAGCAAGCCAAACAAAAAAAAAAGTATAGGGGTCAGATTCCTT  111299
New    111605  TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATAC-GGTATGTAAATGT  111663
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    111600  TAGCAGCACAGCTTCGAACAAGTAACTAAAAATATGTGGTGTATACCGGTATGTAAATGT  111659

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJL164C
110920110920Insertion T
110898110898DeletionT
 Nucleotide changes within the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN.
New    110877  TACCCAGTGTCCTTAATATCTGAAAGT-CTTGTAAACTATACTTCCCACTTGTAACTCTC  110935
               ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||
Old    110871  TACCCAGTGTCCTTAATATCTGAAAGTTCTTGTAAACTATACTTCCCACT-GTAACTCTC  110929

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJL168C, YJL169W
102642102643SubstitutionAAGC
102610102610SubstitutionAC
102276102276SubstitutionCG
 Nucleotide changes within the coding regions of overlapping ORFs YJL169W and/or SET2/YJL168C resulted in altered protein sequences for both ORFs. The start, stop, and reading frame of YJL169W remain the same, but protein residue 62 is now Alanine rather than Proline. The start, stop, and reading frame of SET2/YJL168C also remain the same, but protein residue 594 is now Alanine rather than Phenylalanine, residue 605 is now Alanine rather than Serine, and residue 716 is now Alanine rather than Glycine.
New    102237  GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATGCCAACGCCTTTTTT  102296
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    102231  GTTGAAGGTGGAGGAGAAGACATCCTTGTTGATGCTGATGATAATCCCAACGCCTTTTTT  102290
New    102597  GCTTCCACTAGTTTTTTGGCCTCTTCCTTTTGTAACTCCTTCTGTTTGTTGGCCTCCGCT  102656
               ||||||||||||||||||| |||||||||||||||||||||||||||||||  |||||||
Old    102591  GCTTCCACTAGTTTTTTGGACTCTTCCTTTTGTAACTCCTTCTGTTTGTTGAACTCCGCT  102650
2006-01-18YJL170C101726101726InsertionG
 SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, ASG7/YJL170C has been extended on the 5' end, altering the N-terminus and increasing the size of the predicted protein from 183 to 209 amino acids.
Insert a G after the G at 101726
New: 101713 TCTCGAAGGGCGCGGCTAGATGTTTTGTTTT 101743
            |||||||||||||| ||||||||||||||||
Old: 101713 TCTCGAAGGGCGCG-CTAGATGTTTTGTTTT 101742

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03
YJL171C
9979299793SubstitutionAATT
9977799778SubstitutionCGGC
9976799767SubstitutionGC
 Nucleotide changes within the coding region of YJL171C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 366 is now Lysine rather than Leucine, residue 371 is now Alanine rather than Arginine, and residue 374 is now Lysine rather than Asparagine.
New    99757   ATACACCGTTTTGCATCTTCGTTAAAGCAACACCATTCGACTTCGAGGTGGTCGAAGGCG  99816
               |||||||||||||||| |||||||||  |||||||||||||  |||||||||||||||||
Old    99751   ATACACCGTTTTGCATGTTCGTTAAACGAACACCATTCGACAACGAGGTGGTCGAAGGCG  99810

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
ARS1006
9964399643DeletionA
9963499634DeletionT
9957399574DeletionTA
9953299532Insertion T
9953199531Insertion A
9952599525Insertion TT
9946999469SubstitutionCG
 Several nucleotide changes were made within ARS1006.
New    99421   TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATGATTGA  99480
               |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old    99415   TTGCCTTTGTTTACGAGTATATCGTTAATGTTAACGAATACGCTTAAGCGCAATCATTGA  99474
New    99481   ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTTTTCATAGAA  99540
               |||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
Old    99475   ATAGTCAAAGATTTTTTTTTTTTAATTTTTTTTTTTTAATTTTTTTTTTTT--CATAGA-  99531
New    99541   CTTTTTATTTAAATAAATCACGTCTATATATGTATCAGTATA--ACGTAAAAAAAAAAAC  99598
               | ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||
Old    99532   C-TTTTATTTAAATAAATCACGTCTATATATGTATCAGTATATAACGTAAAAAAAAAAAC  99590
New    99599   ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGT-CAAATCAA-GTGTCAA  99656
               ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||
Old    99591   ACCGTCAGTTAAACAAAACATAAATAAAAAAAAAAAGAAGTGTTCAAATCAAAGTGTCAA  99650

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YJL172W, YJL173C
9765097650Insertion G
9758397583Insertion C
9748997489SubstitutionCG
9747497474SubstitutionAG
9725397253Insertion G
9725097250Insertion T
 Several nucleotide changes were made in the intergenic region between ORFs RFA3/YJL173C and CPS1/YJL172W.
New    97211   CAAGGGATTATAGTACCTTCGCGAGTATTGCATATAAGCTTTTAGCGATACACAAACAAA  97270
               |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
Old    97209   CAAGGGATTATAGTACCTTCGCGAGTATTGCATATAAGCTTT-AGC-ATACACAAACAAA  97266
New    97441   AGAAACACCCACTTCTAGTAGCTTTACGTGACGAATTGAACCGCGTGATCTTGTGCACTG  97500
               ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||
Old    97437   AGAAACACCCACTTCTAGTAGCTTTACGTGACGAATTAAACCGCGTGATCTTCTGCACTG  97496
New    97561   CTTATCATAGCGGCCTTTTATTTTCCCCTTTGGGCAAAATACGATACAGCCTTCCAAGGT  97620
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    97557   CTTATCATAGCGGCCTTTTATTTTCCC-TTTGGGCAAAATACGATACAGCCTTCCAAGGT  97615
New    97621   CGGGCAAGAAAGTTTATGACATATAAAAGAAACGGGTACCCCAAATACGTCTCTTCCCAT  97680
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    97616   CGGGCAAGAAAGTTTATGACATATAAAAGAAACGG-TACCCCAAATACGTCTCTTCCCAT  97674

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL173C, YJL174W9605796057SubstitutionGC
 A single nucleotide substitution was made in the intergenic region between ORFs KRE9/YJL174W and RFA3/YJL173C.
New    96011   GGAAGGCGTTAAGGCAGCAAGTACACATTCATTTATCTATCTATACATCTATAAACACAA  96070
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    96009   GGAAGGCGTTAAGGCAGCAAGTACACATTCATTTATCTATCTATACATGTATAAACACAA  96068

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL177W, YJL178C9036590365SubstitutionAC
 A single nucleotide substitution was made in the intergenic region between ORFs ATG27/YJL178C and RPL17B/YJL177W.
New    90351   GGCGTGGGAAGTGAAGCTCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG  90410
               |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    90349   GGCGTGGGAAGTGAAGATCTTTCGCTCTTTCTGTGATGATCTCCTTCCAGCTAGGCTCGG  90408

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-02-12YJL178C8989389893InsertionG
 Brachat et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YJL178C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 196 to 271 amino acids.
 
New: 89864 ATAGCATGTCATTTTTTTTACATTCTTCAGGAGGTTCTACGTTATGCTCTTCGCAAACGT 89923
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old: 89864 ATAGCATGTCATTTTTTTTACATTCTTCAG-AGGTTCTACGTTATGCTCTTCGCAAACGT 89922 

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2011-02-03YJL179W8900589005SubstitutionCA
 A single nucleotide substitution within the coding region of PFD1/YJL179W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 74 is now Aspartic Acid rather than Alanine.
New    88981   CAAATACGTTAATGATTTATCACATGACGAAACTGTTCTTCTGGATCAAAGAAAAACATT  89040
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old    88979   CAAATACGTTAATGATTTATCACATGCCGAAACTGTTCTTCTGGATCAAAGAAAAACATT  89038

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL183W8495884958SubstitutionGA
 A single nucleotide substitution within the coding region of MNN11/YJL183W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 298 is now Aspartic Acid rather than Glycine.
New    84911   AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGATGGTAATATT  84970
               ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    84909   AATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGGTGGTAATATT  84968

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL185C, YJL186W8192781927SubstitutionAT
 A single nucleotide substitution was made in the intergenic region between ORFs MNN5/YJL186W and YJL185C.
New    81901   GGGGAGAAAAACTAATGAAGTGATTAACTATAATAATTTAATAATAACTCGCCATCCGAC  81960
               |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    81899   GGGGAGAAAAACTAATGAAGTGATTAACAATAATAATTTAATAATAACTCGCCATCCGAC  81958

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL186W8133581335SubstitutionTG
 A single nucleotide substitution within the coding region of MNN5/YJL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 395 is now Valine rather than Phenylalanine.
New    81301   CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCGTCGCTGCTGCCCATGCCTTGAAT  81360
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    81299   CAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCTTCGCTGCTGCCCATGCCTTGAAT  81358

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL186W, YJL187C7935079350Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs SWE1/YJL187C and MNN5/YJL186W.
New    79321   AGTAAGACCTGTTCAGTAGTAATCCTTTTTTTATTGGACTAACTGCGCAAGATGATGTGC  79380
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    79320   AGTAAGACCTGTTCAGTAGTAATCCTTTTTT-ATTGGACTAACTGCGCAAGATGATGTGC  79378

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJL188C, YJL189W7624176241SubstitutionTC
 A single nucleotide substitution within the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine. This nucleotide change is also present in the intron of the overlapping ORF, RPL39/YJL189W, but does not change the protein coding sequence of RPL39/YJL189W.
New    76201   TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCACATTGATGAGTTTGAACAT  76260
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    76200   TTTATGTCAGGTGGTATTGCCTTGGATCCGTGAATGCATCATATTGATGAGTTTGAACAT  76259

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YJLWdelta1, tT(AGU)J5947159471Insertion C
 A single nucleotide insertion was made in the intergenic region between tRNA-Thr tT(AGU)J and Ty1 LTR YJLWdelta1.
New    59461   GAGGCTTCGCCCATTCATTAAAGAGTATAGCTACCGCATACTGTTTAGTAGTATACTATC  59520
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    59461   GAGGCTTCGCC-ATTCATTAAAGAGTATAGCTACCGCATACTGTTTAGTAGTATACTATC  59519

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2014-11-19ARS1004, ARS1006, ARS1007, ARS1008, ARS1009, ARS1025
 New ARS consensus sequences were annotated within the following ARS elements on Chromosome X based on Liachko et al. 2013: ARS1004, ARS1006, ARS1007, ARS1008, ARS1009, ARS1025.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-19ARS1005, ARS1006, ARS1007, ARS1010, ARS1021
 The chromosomal coordinates of the following ARS elements on Chromosome X were updated based on Liachko et al. 2013: ARS1005, ARS1006, ARS1007, ARS1010, ARS1021.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-19IRT1
 IRT1 was added to the genome annotation based on van Werven et al. 2012.

van Werven FJ, et al. (2012) Transcription of two long noncoding RNAs mediates mating-type control of gametogenesis in budding yeast. Cell 150(6):1170-81
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  SGD Curated Comments & Errata

2014-11-18ETC3
 The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.

Hiraga SI, et al. (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2007-05-08snR3
 Updated coordinates of snR3 based on GenBank Z49627, Z49629, and K01089. Changed from 195 nt in length to 194 nt by removing 1 nt from the 5' end.

Tollervey D, et al. (1983) A U4-like small nuclear RNA is dispensable in yeast. Cell 35(3 Pt 2):753-62
SGD Papers Entry  Pubmed Entry  DOI full text  

2007-04-04YJL130C
 URA2/YJL130C mRNA contains an intron in the 5' untranslated region (UTR).

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  
Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2007-04-04YJRCdelta19
 YJLWdelta19, a Ty1 LTR on Chromosome X, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YJRCdelta19 and is annotated on the Crick strand. The name YJLWdelta19 is being retained as an alias.
2007-04-04YJRCdelta16
 YJLWdelta16, a Ty1 LTR on Chromosome X, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YJRCdelta16 and is annotated on the Crick strand. The name YJLWdelta16 is being retained as an alias.
2007-04-04YJRCdelta15
 YJLWdelta15, a Ty1 LTR on Chromosome X, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YJRCdelta15 and is annotated on the Crick strand. The name YJLWdelta15 is being retained as an alias.
2006-09-07ARS1011, ARS1012, ARS1014, ARS1018, ARS1020, ARS1022, ARS1024
 The coordinates of the following ARS elements on Chromosome X were updated based on Nieduszynski et al. 2006: ARS1011, ARS1012, ARS1014, ARS1018, ARS1020, ARS1022, ARS1024.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-05-09YJR003C
 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for YJR003C was moved 60 nt (20 codons) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2005-12-01YJL046W
 The start site of YJL046W is being moved 126 bp downstream from 352176 to 352302 based on 5' SAGE data used by Zhang & Dietrich 2005 to study transcription start sites. The size of the predicted protein is reduced from 451 aa to 409 aa.

Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2004-10-12CEN10
 The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003).

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-04-20YJR092W
 Based on the automated comparison of closely related Saccharomyces species by Kellis et al., the start site for BUD4/YJR092W was moved 384 nt upstream. Evidence supporting this change: 1) This is the predicted start methionine in S. paradoxus, S. mikatae, and S. bayanus orthologs; 2) Significant sequence conservation begins abruptly at this ATG. 3) Sanders and Herskowitz 1996 reported cloning and sequencing the BUD4 gene. Their sequence, GenBank accession number U41641, predicts a protein sequence beginning at the same place (starting with the peptide sequence MHDAE) as in the other three species and with a high level of similarity to them; 4) MIPS also annotates the protein sequence for this ORF as beginning at the earlier possible start site.

Sanders SL and Herskowitz I (1996) The BUD4 protein of yeast, required for axial budding, is localized to the mother/BUD neck in a cell cycle-dependent manner. J Cell Biol 134(2):413-27
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2004-01-27YJL031C
 Moved start 198 bp upstream, added an intron which was previously absent from the annotation. Encoded protein is 327 aa, as opposed to the previously annotated 290 aa.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-09-22YJL153C
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for INO1/YJL153C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 2) this N-terminus confirmed by sequencing of purified protein (Dean-Johnson M and Henry SA).

Dean-Johnson M and Henry SA (1989) Biosynthesis of inositol in yeast. Primary structure of myo-inositol-1-phosphate synthase (EC 5.5.1.4) and functional analysis of its structural gene, the INO1 locus. J Biol Chem 264(2):1274-83
SGD Papers Entry  Pubmed Entry  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YJR017C
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ESS1/YJR017C be moved 60 nt (20 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This is the start site published by Hanes et al.

Hanes SD, et al. (1989) Sequence and mutational analysis of ESS1, a gene essential for growth in Saccharomyces cerevisiae. Yeast 5(1):55-72
SGD Papers Entry  Pubmed Entry  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YJR022W
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for LSM8/YJR022W be moved 57 nt (19 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YJL096W
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MRPL49/YJL096W be moved 189 nt (63 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Graack et al (1998) identify MRPL49/YJL096W as 16kDa protein, a size consistent with the proposed change.

Graack HR and Wittmann-Liebold B (1998) Mitochondrial ribosomal proteins (MRPs) of yeast. Biochem J 329 ( Pt 3)():433-48
SGD Papers Entry  Pubmed Entry  PMC full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YJL091C
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for GWT1/YJL091C be moved 24 nt (8 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL10L, TEL10R
 The chromosomal locations for TEL10L-XC, TEL10L-TR, TEL10L-XR, TEL10L, TEL10R-XC, TEL10R-XR, TEL10R-TR, TEL10L-YP and TEL10R were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2003-07-29YJL127C-B, YJR005C-A, YJR112W-A
 Thanks to Brachat et al. for providing the coordinates of the following Chromosome X ORFs: YJR005C-A, YJR112W-A and YJL127C-B.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YJL020W-A, YJL026C-A, YJL077W-A, YJL077W-B, YJL222W-A, YJL222W-B, YJL225W-A, YJR140W-A
 Thanks to Kumar et al. for providing the coordinates of the following Chromosome X ORFs: YJL026C-A, YJL077W-B, YJL222W-B, YJL225W-A, YJR140W-A, YJL222W-A, YJL077W-A, and YJL020W-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

2003-07-29YJL197C-A
 Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of YJL197C-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2003-07-29YJL047C-A, YJL133C-A, YJL136W-A
 Thanks to MIPS for providing the coordinates of the following Chromosome X ORFs: YJL047C-A, YJL133C-A, and YJL136W-A.
2003-07-29YJR151W-A
 Thanks to Kessler et al. for providing the coordinates for YJR151W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2002-12-16ARS1001, ARS1002, ARS1003, ARS1004, ARS1005, ARS1006, ARS1007, ARS1008, ARS1009, ARS1010, ARS1011, ARS1012, ARS1013, ARS1014, ARS1015, ARS1016, ARS1017, ARS1018, ARS1019, ARS1020, ARS1022, ARS1023, ARS1024, ARS1025
 Coordinates courtesy of Dr. Oscar M. Aparicio, University of Southern California.

Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

2002-11-19YJLWTy4-1, YJLWdelta2
 The YJLWdelta2 element was initially mistakenly annotated as a separate LTR, though its coordinates completely overlapped with the full length transposon YJLWTy4-1. Thus, YJLWdelta2 has been deleted from the database.
2001-05-16snR128, snR190
 2. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706
2000-10-17ARS1021
 ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501.

Raychaudhuri S, et al. (1997) Functional analysis of a replication origin from Saccharomyces cerevisiae: identification of a new replication enhancer. Nucleic Acids Res 25(24):5057-64
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Walker SS, et al. (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2000-08-11YJL205C
 Old name: YJL206C-A; new name: YJL205C-A; date: 11/1998; old coord: ChrX 50443 50139; SGDID: S0003742; Name changed due to nomenclature

Jump to: Sequence Changes | Annotation Changes without Sequence Changes