Chromosome VIII History Help


This page lists all sequence and annotation changes that have been made to the Chromosome VIII systematic reference sequence since its intial release on 1996-07-31.

SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of Change Old SequenceNew Sequence
ARS814, YHR092C
287178287178Insertion C
 One single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer. The two nucleotide deletions also alter the sequence of the overlapping ARS814.
              ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||

              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YHR132C, YHR132W-A
369889369889Insertion A
 A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs ECM14/YHR132C and IGO2/YHR132W-A.
               ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

RUF5-1, YHR052W
 A single nucleotide deletion and a heptanucleotide deletion were made in the intergenic region between ORF YHR052W and ncRNA RUF5-1.
               ||||||||||||||||||||||||||||||||||| |||||||||||       |||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-02-01YHR056C, YHR056W-A217751217751DeletionT
 Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. both suggest that the start site for RSC30/YHR056C be moved 155 nt upstream. Based on experimental evidence, Angus-Hill et al. proposed the deletion of a single T nt upstream of RSC30/YHR056C, allowing a 51 amino acid N-terminal extension. This sequence change was confirmed in S288c by SGD. As a consequence of this sequence change, two ORFs were extended: (1) RSC30/YHR056C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 832 to 883 amino acids; (2) YHR056W-A was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 143 to 144 amino acids.
            |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||

Angus-Hill ML, et al. (2001) A Rsc3/Rsc30 zinc cluster dimer reveals novel roles for the chromatin remodeler RSC in gene expression and cell cycle control. Mol Cell 7(4):741-51
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2011-02-03YHR095W, YHR096C294437294437DeletionA
 A single nucleotide deletion was made in the intergenic region between ORFs YHR095W and HXT5/YHR096C.
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter.
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHL047C83588358Insertion G
 A single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03TEL08L-YP, YHL050C22512251Insertion C
 A single nucleotide insertion was made in the left telomere of chromosome 8, specifically within Y' element TEL08L-YP and the intron of overlapping ORF YHL050C.
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHL040C, YHL041W1856718567Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs YHL041W and ARN1/YHL040C.
               ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHR170W, YHR171W445615445615Insertion G
 A single nucleotide insertion was made in the intergenic region between NMD3/YHR170W and ATG7/YHR171W.
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHR168W441869441869Insertion G
 A single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHR162W, YHR163W423723423723Insertion C
 A single nucleotide insertion was made in the intergenic region between ORFs YHR162W and SOL3/YHR163W.
               |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Kellis et al. predicted and confirmed the insertion of a single C nt. As a consequence of this sequence change, YHL006C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 159 to 150 amino acids.
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03YHL002W, YHL003C102564102564Insertion C
 A single nucleotide insertion was made in the intergenic region between ORFs LAG1/YHL003C and HSE1/YHL002W.
               ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single C nucleotide was inserted after the C at chromosomal coordinate 370331, resulting in the creation of a new ORF YHR132W-A spanning coordinates 370055-370450. See GenBank files: YSCH9315 GenBank entry, accession U10398, U00093. Thank you to Atsuko Horiuchi for alerting SGD to this omission.
New:  aatcctagcggtttaagagag
      |||| ||||||||||||||||
Old:  aatc-tagcggtttaagagag
 Based on the automated comparison of closely related Saccharomyces species, Cliften et al. suggest that the start site for YHL026C be moved 141 nt upstream. SGD confirmed the insertion of a single G nt between the G at 54135 and the T at 54136. As a consequence of this sequence change, YHL026C will be extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 268 to 315 amino acids.
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2011-02-03ARS8056439264392Insertion A
 A single nucleotide insertion was made within ARS805.
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHL012W, YHL013C7873478734Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs OTU2/YHL013C and YHL012W.
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Based on the comparison of related fungi, Brachat et al. suggested that the C-terminus of Fmo1p/YHR176Wp be extended at the C-Terminus. Zhang and Robertus resequenced this gene (in 2 S288C derived strains, X2180 and TR2), confirming the insertion of two nucleotides. As a consequence of these sequence changes, FMO1/YHR176W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 373 to 432 amino acids.
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||



            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||

Zhang M and Robertus JD (2002) Molecular cloning and characterization of a full-length flavin-dependent monooxygenase from yeast. Arch Biochem Biophys 403(2):277-83
SGD Papers Entry  Pubmed Entry  DOI full text  
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-07-26YHR131C, YHR131W-A367891367891InsertionC
 The work of Kellis et al. proposed an insertion that would extend the YHR131C reading frame. This sequence error was confirmed in S288C by SGD. As a consequence of this change, YHR131C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 840 to 850 amino acids. In addition, YHR131W-A was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 115 to 81 amino acids.
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03YHR095W293374293374Insertion C
 A single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHR009C, YHR010W126326126326Insertion C
 A single nucleotide insertion was made in the intergenic region between ORFs YHR009C and RPL27A/YHR010W.
               |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHR013C, YHR014W131454131454Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs ARD1/YHR013C and SPO13/YHR014W.
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHL023C, tH(GUG)H6268762687SubstitutionGA
 A single nucleotide substitution was made in the intergenic region between ORF NPR3/YHL023C and tRNA tH(GUG)H.
               ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YHR056C, YHR056W-A217753217753SubstitutionGT
 A single nucleotide substitution within the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine. This nucleotide change also altered the DNA sequence, but not the amino acid sequence, of overlapping ORF RSC30/YHR056C.
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid.
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||

Engel SR, et al. (2014) The reference genome sequence of Saccharomyces cerevisiae: then and now. G3 (Bethesda) 4(3):389-98
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2014-11-19ARS802, ARS805, ARS807, ARS813, ARS818, ARS820
 As part of SGD's genome annotation revision R64.2, new ARS consensus sequences were annotated within the following ARS elements on Chromosome VIII based on Liachko et al. 2013: ARS802, ARS805, ARS807, ARS813, ARS818, ARS820.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-19ARS802, ARS805, ARS807, ARS809, ARS813, ARS815, ARS818, ARS820
 The chromosomal coordinates of the following ARS elements on Chromosome VIII were updated based on Liachko et al. 2013 as part of SGD's genome annotation revision R64.2: ARS802, ARS805, ARS807, ARS809, ARS813, ARS815, ARS818, ARS820.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2009-05-06ARS801, ARS806, ARS810, ARS811, ARS814, ARS815
 The following ARS elements on Chromosome 8 were added to the genome annotation based on Raveendranathan et al. 2006: ARS801, ARS806, ARS810, ARS811, ARS814, and ARS815.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 An intron was annotated within PTC7/YHR076W at relative coordinates 56..148 based on GenBank EF123135, Juneau et al. 2007, and Zhang et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 55%). Note that the currently annotated start and stop remain the same.

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  
Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2006-09-07ARS802, ARS807, ARS809, ARS813, ARS818, ARS820, ARS822, ARS824
 The following new ARS elements on Chromosome VIII were added to SGD based on Nieduszynski et al. 2006: ARS802, ARS807, ARS809, ARS813, ARS818, ARS820, ARS822, ARS824.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

 The coordinates of ARS805 were updated based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

 ARS808, also known as ARS2, was added to the genome annotation for Chromosome VII at coordinates 140342-141267 based on Wyrick et al. 2001 and Hsiao & Carbon 1981. "ARS2" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS808" is being used for consistency purposes, to indicate that this ARS is part of Chromosome VIII.

Hsiao CL and Carbon J (1981) Characterization of a yeast replication origin (ars2) and construction of stable minichromosomes containing cloned yeast centromere DNA (CEN3). Gene 15(2-3):157-66
SGD Papers Entry  Pubmed Entry  DOI full text  
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

 ARS805, also known as "SPO11 ARS", was added to the genome annotation for Chromosome VIII at coordinates 64155-64459 based on Wyrick et al. 2001 and Atcheson et al. 1987.

Atcheson CL, et al. (1987) Isolation, DNA sequence, and regulation of a meiosis-specific eukaryotic recombination gene. Proc Natl Acad Sci U S A 84(22):8035-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

 High-throughput identification of transcription start sites by Zhang and Dietrich 2005 confirmed that the start site for YHR163W should be moved 93 nt downstream from 423632 to 423725. As a consequence of this annotation change, YHR163W was shortened at the 5' end, decreasing the size of the predicted protein from 280 amino acids to 249 amino acids.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

 The following intron predicted by Brachat, et al was added to SAE3/YHR079C-A on the basis of experimental evidence provided by Hayase, et al and Tsubouchi and Roeder:
exon 1: ...tgtctaaaga aaagaaaaa

intron: g tatgtagcta ttttttccag tcggcaaaaa tcggtataac aaacaaaaaa tatttagttt ctgttattaa cagaacttgt caaag

exon2: tgatg agacaccaaa aaaaatttcc tcgacgtaca ttaaagagtt...

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Hayase A, et al. (2004) A protein complex containing Mei5 and Sae3 promotes the assembly of the meiosis-specific RecA homolog Dmc1. Cell 119(7):927-40
SGD Papers Entry  Pubmed Entry  DOI full text  
Tsubouchi H and Roeder GS (2004) The budding yeast mei5 and sae3 proteins act together with dmc1 during meiotic recombination. Genetics 168(3):1219-30
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-04-01RUF5-1, RUF5-2
 Start and stop coordinates updated per McCutcheon & Eddy 2004.

McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003
SGD Papers Entry  Web Supplement  

 Thanks to Cliften et al. for providing the coordinates of YHR199C-A.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SSZ1/YHR064C be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) protein sequence conservation with other chaperone homologs in S. cerevisiae begins sharply at about 30 amino acids from the current start.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for RRP3/YHR065C be moved 126 nt (42 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for FUR1/YHR128W be moved 106 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL08L, TEL08R
 The chromosomal locations for TEL08L, TEL08L-TR, TEL08L-XC, TEL08L-XR, TEL08L-YP, TEL08R, TEL08R-TR1 , TEL08R-TR2, TEL08R-XC, TEL08R-XR, and TEL08R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2003-07-29YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, YHR218W-A
 Thanks to MIPS for providing the coordinates for the following Chromosome VIII ORFs: YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR032C-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, and YHR218W-A.
2003-07-29YHR086W-A, YHR175W-A, YHR180C-B, YHR180W-A
 Thanks to Kessler et al. for providing the coordinates of the following Chromosome VIII ORFs: YHR180C-B, YHR180W-A, YHR175W-A, and YHR086W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YHL050W-A, YHR022C-A, YHR032C-A, YHR052W-A, YHR054W-A, YHR137C-A, YHR212W-A, YHR213W-A, YHR213W-B, YHR214C-D, YHR214C-E, YHR219C-A
 Thanks to Kumar et al. for providing the coordinates of the followinc Chromosome VIII ORFs: YHL050W-A, YHR052W-A, YHR137C-A, YHR213W-A, YHR213W-B, YHR214C-D, YHR214C-E, YHR219C-A, YHR212W-A, YHR054W-A, YHR032C-A, and YHR022C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

2003-07-29YHL015W-A, YHL048C-A, YHR007C-A, YHR032W-A, YHR050W-A, YHR073C-B, YHR073W-A
 Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome VIII ORFs: YHL015W-A, YHL048C-A, YHR007C-A, YHR032W-A, YHR050W-A, YHR073C-B, and YHR073W-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2003-03-06RUF5-1, RUF5-2
 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  SGD Curated Comments & Errata

 Old name: YHR039C-B; new name: YHR039C-A; date: 11/1998; old coord: ChrVIII 187670 187164; SGDID: S0002100; Name changed due to nomenclature
 Old name: YHR079C-B; new name: YHR079C-A; date: 11/1998; old coord: ChrVIII 262554 262402; SGDID: S0001957; Name changed due to nomenclature

Jump to: Sequence Changes | Annotation Changes without Sequence Changes