Take our Survey

Chromosome I History Help


This page lists all sequence and annotation changes that have been made to the Chromosome I systematic reference sequence since its intial release on 1996-07-31.

SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of ChangeOld SequenceNew Sequence
YAL067C, YAL067W-A
59275927Insertion G
 Several nucleotide sequence changes were made in the intergenic region between ORFs YAL067W-A and SEO1/YAL067C.
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
               ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YAL064C-A, YAL064W
 A single nucleotide substitution and two separate single nucleotide deletions were made in the intergenic region between ORFs YAL064C-A and YAL064W.
               ||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YAL064W2153121531Insertion A
 A single A nucleotide was inserted within ORF YAL064W, near its 5' end, moving the start codon out of frame with the rest of the protein. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 14 amino acids shorter.
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YAL063C, YAL063C-A2325323253Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs YAL063C-A and FLO9/YAL063C.
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ARS104, YAL063C
2895328953Insertion T
 A single nucleotide deletion and a single nucleotide insertion were made in the intergenic region between ORF FLO9/YAL063C and ARS104.
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YAL062W, YAL063C
 The following changes were made to the systematic sequence of Chromosome I in the region encompassing features FLO9/YAL063C and GDH3/YAL062W: deletion of the A at 29254, deletion of AAT at 29289-29291, transversion of T to A at 29301, and deletion of the A at 29307.
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
           ||||||||   ||||||||| ||||| |||||||||||||||||||||||||||||||||
 A single nucleotide substitution within the coding region of BDH1/YAL060W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine.
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YAL059C-A, YAL059W3681436814SubstitutionAC
 A single nucleotide substitution within the coding regions of overlapping ORFs ECM1/YAL059W and YAL059C-A resulted in altered protein sequences for both ORFs. The start, stop, and reading frames remain the same for both proteins, but ECM1/YAL059W protein residue 102 is now Alanine rather than Aspartic Acid, and YAL059C-A protein residue 36 is now Alanine rather than Serine.
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Nucleotide changes within the coding region of GPB2/YAL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 661 is now Valine rather than Isoleucine, residue 802 is now Cysteine rather than Phenylalanine, and residues 814-815 are now ED rather than AA.
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||

               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

               |||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Kellis et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the T at chromosomal coordinate 41778. As a consequence of this sequence change, YAL056W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein increasing from 847 to 880 amino acids.
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| 

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

 Nucleotide changes within the coding region of FLC2/YAL053W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 111 is now Cysteine rather than Serine, residue 312 is now Asparagine rather than Aspartic Acid, and residues 641-643 are now NDS rather than IDP.
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||

               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||

               |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Nucleotide changes within the coding region of OAF1/YAL051W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine.
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||

               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

               |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The work of Kellis et al. 2003 predicted the deletion of 2 separate G nucleotides in YAL051W at chromosomal coordinates 51688 and 51694, and these sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YAL051W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 1062 to 1047 amino acids.
           |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

 Nucleotide changes within the coding region of SPC72/YAL047C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 302 is now Asparagine rather than Isoleucine.
               ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||

               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Three single base substitutions were made within ORF YAL044C/GCV3 to correct errors in the systematic reference sequence for Chromosome I: Two separate A -> C transversions at 58196 and 58247, and a C -> T transition at 58424. These errors were verified by sequencing in 3 different strains, all of ResGen BY4741 (S288C) background. SGD thanks Michael E. Rice for bringing these errors to our attention, and for verifying the correct sequence.
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| 



             ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| 
2011-02-03YAL041W, YAL042W6276762767SubstitutionAG
 A single nucleotide substitution was made in the intergenic region between ORFs ERV46/YAL042W and CDC24/YAL041W.
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ARS106, YAL038W
 Two separate single nucleotide substitutions were made in the intergenic region between ARS106 and ORF CDC19/YAL038W.
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
               ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

9684196841Insertion C
 Nucleotide changes within the coding region of DRS2/YAL026C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 45-46 are now AN rather than GY, residue 450 is now Alanine rather than Arginine, residue 674 is now Proline rather than Glycine, residues 891-892 are now NT rather than KS, residues 953-954 are now GD rather than AS, and residue 987 is now Valine rather than Leucine.
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

               ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||

               |||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||

               ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||

               ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||

               |||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution was made within ncRNA HRA1.
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of MAK16/YAL025C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 250 is now Glutamic Acid rather than Glutamine.
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Due to the insertion of CC after the C at 108137, and the insertion of a G after the G at 108143 in the systematic sequence of Chromosome I, the coordinates of PMT2/YAL023C have been changed. Thanks to Verena Girrbach (verena.girrbach@biologie.uni-regensburg.de) for reporting this sequence error in the systematic sequence of PMT2/FUN25/YAL023C to SGD.
            |||||||||||||||||  |||||| ||||||||||||||||||||||||||||||||||
2011-02-03YAL021C, YAL022C110470110471SubstitutionCGGC
 A dinucleotide substitution was made in the intergenic region between ORFs FUN26/YAL022C and CCR4/YAL021C.
               ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The substitution of two nucleotides within the coding region of ATS1/YAL020C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 305 is now Glycine rather than Alanine.
               ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of PSK1/YAL017W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 73 is now Glutamic Acid rather than Glutamine.
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Due to the insertion of a single T nucleotide after the T at coordinate 128441 in the systematic sequence of Chromosome I, the ORF SUN8/YAL014C was extended 450 nucleotides in the 3' direction, making the protein product 150 amino acids longer at the C-terminus. Thanks to Lena Burri, Trevor Lithgow, and Hugh Pelham for reporting this sequence error in the systematic sequence of SYN8/UIP2/YAL014C to SGD.

            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||

Lewis MJ and Pelham HR (2002) A new yeast endosomal SNARE related to mammalian syntaxin 8. Traffic 3(12):922-9
SGD Papers Entry  Pubmed Entry  DOI full text  

 Kellis et al. 2003 and Brachat et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at position 130239 on Chromosome I. As a consequence of this sequence change, YAL013W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 362 to 420 amino acids. They also found an additional seqeuncing error: the CG at 130246-130247 should be GC.

            ||||||||||||||||||||||||||||||||||||||| ||||||  ||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Two nucleotides were deleted near the 3' end of ORF DEP1/YAL013W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 15 amino acids shorter.
               |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YAL010C, YAL011W134125134125Insertion C
 A single nucleotide substitution was made in the intergenic region between ORFs SWC3/YAL011W and MDM10/YAL010C.
               |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of MDM10/YAL010C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine.
               ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YAL004W, YAL005C
 Three single nucleotide substitutions were made within the coding sequence of SSA1 (at nucleotide positions 623, 1252, and 1265 relative to the SSA1 coding sequence), based on the sequence reported by Slater and Craig (1989) and corresponding to GenBank entry X12926. These changes result in phenylalanine to serine changes at amino acid residues 208 and 422 and a change from serine to proline at amino acid residue 418. Thanks to Andreas Bracher for bringing these corrections to our attention.

Note that the change at position 623 of SSA1 also affects the coding sequence of the Dubious ORF YAL004W.

638     ATACCGTCTTCAATGGACAACAAAGAGAC 610     new sequence, coordinates relative to SSA1 coding region
        ||||||||||||||| |||||||||||||       
140796  ATACCGTCTTCAATGAACAACAAAGAGAC 140824  old sequence, chromosomal coordinates

1279   TGGAAAAGATCTCGGACTTCTTTGTTGGAATGGTAGAGTTT 1239    new sequence, coordinates relative to SSA1 coding region
       |||||||||||||| |||||||||||| |||||||||||||
140155 TGGAAAAGATCTCGAACTTCTTTGTTGAAATGGTAGAGTTT 140195  old sequence, chromosomal coordinates

Slater MR and Craig EA (1989) The SSA1 and SSA2 genes of the yeast Saccharomyces cerevisiae. Nucleic Acids Res 17(2):805-6
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Kellis et al. 2003 and Cliften et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at chromosomal coordinate 143848. As a consequence of this sequence change, YAL002W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 1176 to 1274 amino acids.
            ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| 

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2011-02-03CEN1, YAR002W152189152190SubstitutionCAAC
 A dinucleotide substitution was made in the intergenic region between CEN1 and ORF NUP60/YAR002W
               ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YAR007C, YAR008W158934158934Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs RFA1/YAR007C and SEN34/YAR008W.
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Kellis et al. 2003 predicted and confirmed the deletion of a single G nucleotide at chromosomal coordinate 166772. As a consequence of this sequence change, YAR014C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 702 to 707 amino acids.
            ||||||||||||||||||||||||||||||||||||||||| |||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

167084167084Insertion C
167113167113Insertion T
167133167133Insertion A
167138167138Insertion T
167142167142Insertion A
167149167149Insertion T
 Six separate single nucleotides were inserted within ORF BUD14/YAR014C, and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different.
               |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||

               ||||||||||||||||||||| |||||||||||||||||||| ||||| |||| ||||||

               | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||

               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YAR018C, YAR019C
171882171882Insertion C
172041172041Insertion T
172042172042Insertion T
172170172170Insertion T
 Several nucleotide sequence changes were made in the intergenic region between ORFs KIN3/YAR018C and CDC15/YAR019C.
               ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
               ||||||||||||||||||||| ||| ||   ||||| |||||||||||||||||||||||
               ||||||||||| | ||||||||||||||||||||| | ||||||||||||||||||||||
               |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

172425172425Insertion G
 Nucleotide changes within the coding region of CDC15/YAR019C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC.
               |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||

               |||||||||| |||||||||||||  ||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YAR019W-A175305175305Insertion C
 A single C nucleotide was inserted very near the 3' end of ORF YAR019W-A, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 4 amino acids shorter.
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ARS110, YAR019W-A
 A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORF YAR019W-A and ARS110.
               ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YAR020C, YAR023C
177135177135Insertion T
178618178618Insertion A
 Several nucleotide sequence changes were made in the intergenic region between ORFs PAU7/YAR020C and YAR023C.
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
               ||||| ||||||||||||||||| ||||||||||||||||||| |||||||| |||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The substitution of two nucleotides within the coding region of YAR023C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 20 is now Phenylalanine rather than Valine, and residue 46 is now Phenylalanine rather than Isoleucine.
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||

               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YAR023C, tL(CAA)A180961180961Insertion CAAA
 A tetranucleotide insertion was made in the intergenic region between ORF YAR023C and tRNA-Leu SUP56/tL(CAA)A.
               ||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2003-09-27YAR042W, YAR044W193300193300InsertionG
 Insertion of a single G after the G at 193300 merged SWH1/YAR042W and OSH1/YAR044W. After merging YAR042W (coordinates 192613-193383 (1-771)) and YAR044W (coordinates 193599-196178 (1-2580)), the coordinates of the merged ORF, SWH1/YAR042W, are 192613-196179 (1-3567). OSH1 and YAR044W are now aliases of SWH1/YAR042W. This sequence change was predicted by several studies, then verified in S288c by SGD.

            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||

Schmalix WA and Bandlow W (1994) SWH1 from yeast encodes a candidate nuclear factor containing ankyrin repeats and showing homology to mammalian oxysterol-binding protein. Biochim Biophys Acta 1219(1):205-10
SGD Papers Entry  Pubmed Entry  DOI full text  
Beh CT, et al. (2001) Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics 157(3):1117-40
SGD Papers Entry  Pubmed Entry  PMC full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 When confirming the G nucleotide insertion that resulted in the merger of SWH1/YAR042W and OSH1/YAR044W (see 2003-09-27), SGD detected an additional sequencing error. The substitution of an A nt for a G nt changes amino acid 248 from a serine to an asparagine.
Substitute an A nt for the G nt at 193355
            |||||||||||||| ||||||||||||||||
2011-02-03YAR042W, YAR047C198900198900Insertion A
 A single nucleotide insertion was made in the intergenic region between ORFs SWH1/YAR042W and YAR047C.
               ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YAR047C, YAR050W
202933202933Insertion A
203327203327Insertion T
 Two separate single nucleotide insertions were made in the intergenic region between ORFs YAR047C and FLO1/YAR050W.
               ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
               |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The following sequence change was made to the systematic sequence of Chromosome I within the ORF YAR050W/FLO1: transversion of T to G at 203939.
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
YAR060C, YARCdelta8
 The following changes were made to the systematic sequence of Chromosome I in the region encompassing features YARCdelta8 and YAR060C: deletion of the T at 210804, transversion of T to A at 210810, and transition of C to T at 211011.
            ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
2011-02-03TEL01R, TEL01R-XC229568229568Insertion G
 A single nucleotide insertion was made within the right telomere of Chromosome 1, TEL01R, specifically within the X element Core sequence TEL01R-XC.
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2014-11-18ARS104, ARS106, ARS107, ARS110, ARS111
 New ARS consensus sequences were annotated within the following ARS elements on Chromosome I based on Liachko et al. 2013: ARS104, ARS106, ARS107, ARS110, ARS111.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-18ARS102, ARS105, ARS106, ARS108
 The chromosomal coordinates of the following ARS elements on Chromosome I were updated based on Liachko et al. 2013: ARS102, ARS105, ARS106, ARS108.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-18YAR061W, YAR062W
 The two pseudogenes YAR061W + YAR062W have been combined into a single pseudogene, keeping the name YAR061W. This region is homologous to parts of FLO1/YAR050W and FLO9/YAL063C, but contains stop codons at several positions.

Teunissen AW and Steensma HY (1995) Review: the dominant flocculation genes of Saccharomyces cerevisiae constitute a new subtelomeric gene family. Yeast 11(11):1001-13
SGD Papers Entry  Pubmed Entry  DOI full text  

 Updated coordinates of snR18 based on GenBank U12981.

Hiraga K, et al. (1993) Cloning and characterization of the elongation factor EF-1 beta homologue of Saccharomyces cerevisiae. EF-1 beta is essential for growth. FEBS Lett 316(2):165-9
SGD Papers Entry  Pubmed Entry  DOI full text  

 Updated coordinates of HRA1 based on Yang & Altman 2007.

Yang L and Altman S (2007) A noncoding RNA in Saccharomyces cerevisiae is an RNase P substrate. RNA 13(5):682-90
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2007-03-07ARS102, ARS103, ARS105, ARS108, ARS111, ARS112
 The following ARS elements were added to the genome annotation on Chromosome I based on Xu et al. 2006: ARS102, ARS103, ARS105, ARS108, ARS111, ARS112.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The ACS within ARS101/ARS109 at coordinates 159946-159936 was added based on Xu et al. 2006 and Theis & Newlon 2001.

Theis JF and Newlon CS (2001) Two compound replication origins in Saccharomyces cerevisiae contain redundant origin recognition complex binding sites. Mol Cell Biol 21(8):2790-801
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 This RNA gene, HRA1, was described by Samanta et al. (2006). Approximate start and stop coordinates, which are accurate to within 25 nucleotides, have been specified for this non-coding RNA. Many thanks to Manoj Samanta for alerting us to this noncoding RNA.

Samanta MP, et al. (2006) Global identification of noncoding RNAs in Saccharomyces cerevisiae by modulating an essential RNA processing pathway. Proc Natl Acad Sci U S A 103(11):4192-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

 An ARS Consensus Sequence (ACS) was added to ARS109 based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-09-06ARS104, ARS106, ARS107
 The following ARS elements on Chromosome I were added to SGD based on Nieduszynski et al. 2006: ARS104, ARS106, ARS107.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-09-06ARS109, ARS110
 Updated coordinates of the following ARS elements on Chromosome I based on Nieduszynski et al. 2006: ARS101/109, ARS110.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

 The previously annotated boundaries of CEN1 were adjusted to coincide with the 5' end of CDEI and the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 This ARS element ARS110 was added to the genome annotation based on Wyrick et al. 2001 and Dimock et al. 1984.

Dimock K, et al. (1984) Molecular cloning of the ADE1 gene of Saccharomyces cerevisiae and stability of the transformants. Gene 27(2):233-7
SGD Papers Entry  Pubmed Entry  DOI full text  
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

 ARS101 was added to SGD based on Theis and Newlon 2001 and Wyrick et al. 2001.

Theis JF and Newlon CS (2001) Two compound replication origins in Saccharomyces cerevisiae contain redundant origin recognition complex binding sites. Mol Cell Biol 21(8):2790-801
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The start site of GCV3/YAL044C was moved 21 nt (7 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 The start site of FUN19/YAL034C was moved 150 nt (50 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 The start site of YAL011W was moved 39 nt (13 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL01L, TEL01R
 The chromosomal locations for the following telomeric features on Chromosome I were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL01L, TEL01L-TR, TEL01L-XC, TEL01L-XR, TEL01R, TEL01R-TR, and TEL01R-XC.
 Thanks to Kessler et al. 2003 for providing the coordinates of ORF YAL016C-B on Chromosome I.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YAL037C-B, YAL067W-A, YAL068W-A, YAR035C-A
 Thanks to Kumar et al. 2002 for providing the coordinates of the following ORFs on Chromosome I: YAL037C-B, YAL067W-A, YAL068W-A, YAR035C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

2003-07-29YAL016C-A, YAL019W-A, YAL026C-A, YAL031W-A, YAL037C-A, YAL047W-A, YAL059C-A, YAR019W-A
 Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome I: YAL016C-A, YAL019W-A, YAL026C-A, YAL031W-A, YAL037C-A, YAL047W-A, YAL059C-A, and YAR019W-A.
 Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of ORF YAL063C-A on Chromosome I.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

 ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
1999-07-17YAR043C, YAR052C, YAR074C
 Deleted ORF, does not encode a protein; this putative ORF was included in the original annotation of Chromosome I but was later withdrawn

Jump to: Sequence Changes | Annotation Changes without Sequence Changes