Take our Survey

Chromosome III History Help


This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31.

SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of Change Old SequenceNew Sequence
 The systematic sequence was updated in the region upstream of feature snR33. Note that coordinates listed are chromosomal coordinates.
              ||| ||||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||
              |||||||||   ||||||||||||||||||| ||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
New:   142781 ATGATTC--------------------------------------------------- 142787
New:   142787 ---------------------------------------------------GAGAAAAGCAACAATATTATGTA 142810
 The systematic sequence was updated in the region encompassing feature snR43. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
2011-02-03YCR072C, YCR073C242444242444DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs YCR072C and YCR073C.
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YCL039W, YCL040W
 Several changes were made within the intergenic region between ORFs YCL040W and YCL039W to correct the systematic reference sequence:
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
 The systematic sequence was updated within ORF YCR073C. As a result, YCR073C was extended at the 3' end, so that the coding region increased in length from 3945 nt to 3996 nt. Note that coordinates listed below are chromosomal coordinates.
 The systematic sequence was updated within ORF YCR077C. As a result, the annotated stop site was moved 1 codon upstream, reducing the length of the coding region from 2394 nt to 2391 nt. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
              |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region encompassing feature tQ(UUG)C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||     |||||||||||||||||||||||||||
YCL012W, YCL014W
 Several sequence changes were made in the systematic sequence in the region encompassing feature YCL014W, resulting in the merge of ORF YCL012W into YCL014W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
YCR080W, YCR081W
 Two single nucleotide deletions were made in the systematic sequence within ORF YCR080W: The A at chromosomal coordinate 253495 was removed, as was the A at 253512.
              ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: The G at 253653 was changed to C.
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
 Several sequence changes were made in the systematic sequence in the region encompassing feature ARS305. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
             |||||  ||||||||||| |||||||||||||||||||||||||||||||||||||||||
             ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
 Several sequence changes were made in the systematic sequence in the region upstream of ARS306. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||
 Three sequence changes were made to Chromosome III within ARS307 to correct the systematic reference sequence: A single G was inserted after chromosomal coordinate 108796, the G at 108844 was changed to a C, and the A at 109259 was deleted.
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||

              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 Three single nucleotide changes were made to the systematic sequence in the region encompassing ARS307. The G at chromosomal coordinate 108792 was deleted, the C at 108840 was changed to G, and an A was inserted after the T at 109254. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region encompassing feature ARS310. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||  |||||
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region encompassing feature YCL004W. Note that coordinates listed are chromosomal coordinates.
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              |||||||     |||||||||||||||||||||||||||||||||||||||||||  |||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 The systematic sequence was updated in the region encompassing feature YCL005W, and at the same time the stop site for YCL005W was moved 6 nucleotides downstream, increasing the length of the coding region from 765 to 771 nt. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||
              |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR038C. In addition, the start codon has been shifted forward 312 nt, leading to an N-terminal extension of the protein by 104 aa. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
 Based on Brachat et al. 2003 and GenBank AY260880, the T at 105970 was deleted. This change resulted in a frameshift, moving the stop 267 bp downstream, and extending the protein from 296 aa to 385 aa.
              ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| 

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Three nucleotide substitutions, one single nucleotide deletion, and one single nucleotide insertion were made in Chromosome III within the ORF YCL008C to correct the systematic reference sequence: The G at 105943 was changed to CC, the Cs at 105986 and 106435 were changed to Gs, the C at 106349 was deleted, and an A was inserted after chromosomal coordinate 106407.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||

              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
1998-02-26YCL008C, YCL009C105580105580DeletionT
 One single nucleotide was deleted in Chromosome III in the intergenic region between ORFs YCL009C and YCL008C to correct the systematic sequence. The T at chromosomal coordinate 105580 was removed.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
 Several sequence changes were made to the systematic sequence in the region encompassing ORF YCL008C. The CC at chromosomal coordinate 105937 was changed to a G, the G at 105981 was changed to C, a C was inserted after the C at 106343, the A at 106402 was deleted, and a C was inserted after the T at 106429. Note that while the coordinates may appear to be different, the first four of these five changes are exact reciprocals of changes made on 1997-07-27, returning the systematic sequence to its original state in these areas. The insertion of the C after the T at 106429 is a novel change.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
YCL010C, YCL011C
 Four single nucleotide changes were made within the intergenic region between ORFs YCL011C and YCL010C to correct the systematic reference sequence: A T was inserted after chromosomal coordinate 103074, the T at chromosomal coordinate 103519 was removed, as was the C at 103531, and the G at 103543.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
YCL010C, YCL011C
 Four single nucleotide changes were made in the systematic sequence in the intergenic region between ORFs YCL011C and YCL010C. A single T was deleted at chromosomal coordinate 103071, a single T was inserted after the T at chromosomal coordinate 103515, a C was inserted after the C at 103526, and a G was inserted after the G at 103537. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of some made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
2000-09-13YCR042C, YCR043C204348204348DeletionT
 The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
 Two single nucleotide deletions and two single nucleotide insertions were made within the ORF YCL014W to correct the systematic reference sequence: The G at chromosomal coordinate 100475 was removed, as was the G at 100539, a single A was inserted after chromosomal coordinate 98842, and a single G was inserted after chromosomal coordinate 100478.
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||

              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
 Four separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL014W. A single A was deleted at chromosomal coordinate 98839, as was the G at 100475, and a single G was inserted after the A at 100471, and also after the G at 100535. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
 A sequence change was made in the systematic sequence in the region encompassing feature YCL016C, and the start of YCL016C was moved 213 nt upstream, extending the protein N-terminally by 71 amino acids. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
 A single nucleotide substitution was made in the systematic sequence within the ORF YCL017C. Several sequence changes were also made in the region upstream of YCL017C. Note that coordinates listed are chromosomal coordinates.
Within YCL017C
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Upstream of YCL017C
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
             ||||||||||||| |||||||||||||||||||||||||||||||||||  | |||||||
 Several sequence changes were made in the systematic sequence in the region encompassing feature YCL019W. Note that coordinates listed are chromosomal coordinates.
             |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||
             ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
YCR031C, snR189
 The systematic sequence was updated in the region between features RPS14A/YCR031C and snR189. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||

              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||

              ||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||
YCR032W, snR189
 The systematic sequence was updated in the region between features snR189 and BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||

              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
YCL022C, YCL024W
 Two separate single nucleotide deletions were made in the systematic sequence in the region encompassing overlapping ORFs YCL024W and YCL022C. A single C was deleted at chromosomal coordinate 81527, and another C was deleted at 81746. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
YCL073C, YCLWomega2
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
             | ||| || |    | |||||||||||||||||||||||    | ||||| ||||||||||||||||||||||||
             |||||| || ||||||| ||||| ||||||||||||||||||||||||||||||| ||||
             |||||||||||||||||||||||||| ||||||||||||||| || ||| ||||||||||
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
YCL073C, YCLWomega2
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    6249 -----------------TCTTTAGTG 6257
                              ||||||  |
             ||| ||||| ||||||||||| | ||||||||||||||||||||||||||||||||| ||
             ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||| | |||||| |||||||||||||||||||||||||||||||||| ||||
             |||||    ||||||||||||||||||| ||||||||||||| ||| ||||| |||||||
 Five sequence changes were made in the systematic sequence in the region encompassing ORF YCL025C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic reference sequence of Chromosome III was updated within ORF YCR057C: The T at chromosomal coordinate 220245 was removed, and the G at chromosomal coordinate 221416 was removed.
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 The systematic reference sequence of Chromosome III was updated upstream of ORF YCR057C: The C at chromosomal coordinate 221663 was removed.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 A single nucleotide deletion was made in Chromosome III within the ORF YCR028C-A to correct the systematic reference sequence: The G at chromosomal coordinate 173207 was removed.
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region upstream of feature YCR028C-A. Note that coordinates listed are chromosomal coordinates.
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
              ||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||
 Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL028W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
             |||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             ||||||||||||| |||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR065W. Note that coordinates listed below are chromosomal coordinates. As a result, the annotated stop site of YCR065W has been moved downstream, increasing the size of the coding region from 1599 nt to 1695 nt.
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 The systematic reference sequence of Chromosome III was updated in the region downstream of ORF YCR065W.
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
 Two single nucleotide deletions were made within the ORF YCL034W to correct the systematic reference sequence: the G at chromosomal coordinate 62138 and the G at 62141 were removed.
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
YCR067C, YCR068W
 The systematic sequence was updated in the region between ORFs YCR067C and YCR068W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
 One single nucleotide deletion was made in the systematic sequence in the region downstream of ORF YCR068W. The C at chromosomal coordinate 237282 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
YCL037C, YCL038C
 Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL038C and YCL037C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 Several sequence changes were made in the systematic sequence in the region downstream of YCLCdelta1. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
             |||||||||||||||||||||| |||||||||| |||| |||| ||||||  ||| || |
             ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
YCL050C, YCL051W
 Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL051W and YCL050C. The G at 37638 was changed to A, the T at 37705 was changed to C, and the TA dinucleotide at 37772-3 was deleted. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
             ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 Three single nucleotide deletions were made within the ORF YCL054W to correct the systematic reference sequence: The A at chromosomal coordinate 33604 was removed, as was the G at 33666, and the A at 33689.
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR018C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
              ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
 Two single nucleotide deletions and five single nucleotide insertions were made within the ORF YCL061C to correct the systematic reference sequence: The T at chromosomal coordinate 19446 was removed, as was the C at 21561, single Gs were inserted after chromosomal coordinates 19496, 19501, and 19507, and single Ts were inserted after chromosomal coordinates 20325 and 20419.
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||

             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||

             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
 Seven separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. A single T was inserted after the G at chromosomal coordinate 19443, single G nucleotides were deleted at 19494, 19500, and 19507, single T nucleotides were deleted at 20326 and 20421, and a C was inserted after the C at 21562. Note that while some coordinates appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
 Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. The C at 21801 was deleted, a T was inserted after the T at 21911, and the T at 21923 was changed to G, resulting in the N-terminal extension of the predicted protein sequence by 243 amino acids. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
             |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
 Two single nucleotide deletions were made within the ORF YCL063W to correct the systematic reference sequence: The C at chromosomal coordinate 17607 was removed, as was the C at 17833.
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||

             |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
 Three sequence changes were made in the systematic sequence within ORF YCL064C. The T at 15918 was deleted, a single C was inserted after the C at 15921, and the G at 16068 was changed to T. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
 Two sequence changes were made in the systematic sequence in the region encompassing ORF YCL068C. The G at 12049 was changed to C, and the T at 12268 was deleted. These changes resulted in the N-terminal elongation of the predicted protein sequence by 70 amino acids. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
YCL069W, YCL073C
 Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL073C and YCL069W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
             |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||| ||||||||
             ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
YCR020W-B, YCR021C
 The systematic sequence was updated in the intergenic region between features YCR020W-B and YCR021C. Note that coordinates listed are chromosomal coordinates.
              ||| |   ||||||  ||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
              |||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region between features YCR028C and YCR028C-A. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||

New:   172962 ------------------------------------ 172962
2000-09-13YCR104W, YCR105W307323307323DeletionT
 The systematic sequence was updated in the region between ORFs YCR104W and YCR105W. Note that coordinates listed are chromosomal coordinates.
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 Five deletions were made in Chromosome III in the region downstream of ORF YCL001W to correct the systematic reference sequence: The Cs at chromosomal coordinates 112490, 112497, and 112872 were deleted, as was the T at 112529, and the CA at 112531-2.
              |||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |  |
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
YCL001W, YCL002C
 Three separate sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL002C and YCL001W. The TT at chromosomal coordinate 111841 was changed to G, and the C at 111859 and the T at 111893 were removed. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||
              ||||||||||| ||||||||||||||||||||||||||||
 Thirteen separate sequence changes were made in the systematic sequence in the region encompassing ORF YCL001W. The G at chromosomal coordinate 111924 was changed to C, the AG at 111939 was changed to GA, the T at 111956 was changed to G, and the following single nucleotides were deleted: the Ts at 111950, 111963, 111967, 111971, 111975, 111978, 111983, and 111987, the G at 112025, and the C at 112074. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||| ||||||||||||||  |
              |||||||| ||||| |||||| ||| ||| ||| || |||| ||| ||||||||||||||
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
 A single nucleotide deletion was made in the systematic sequence in the region encompassing ORF YCL002C. The T at chromosomal coordinate 111511 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 The systematic sequence was updated in the region encompassing feature YCL002C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
 Several sequence changes were made in the systematic sequence in the region encompassing TEL03L. Note that coordinates listed below are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
             |||| | || |||||||||||||||||||||||||||| |||||||||||||||||||||
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 Four single nucleotide insertions were made in the region now spanning new feature YCL012C. This feature was independently predicted by Cliften et al. 2003 and Zhang & Dietrich 2003. The sequence changes were confirmed by Zhang and Dietrich (GenBank AY178910).
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| 

            | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| 

            |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| 

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Zhang Z and Dietrich FS (2003) Verification of a new gene on Saccharomyces cerevisiae chromosome III. Yeast 20(8):731-8
SGD Papers Entry  Pubmed Entry  DOI full text  

YCL022C, YCL024W
 Two single nucleotide insertions were made within the ORF YCL024W to correct the systematic reference sequence: A C was inserted after chromosomal coordinate 81532, and also after 81750. Note that the change at 81750 is also within overlapping ORF YCL022C.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||

             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
2000-09-13YCL022C, YCL024W8186181861InsertionC
 One sequence change was made in the systematic sequence in the region encompassing overlapping features YCL024W and YCL022C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
YCL025C, YCL026C-A
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCL026C-A and YCL025C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
YCL023C, YCL025C
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCL025C and YCL023C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||| ||  ||||||||||||||||||
 SGD confirmed the sequence error predicted by the work of Brachat et al and Schreve et al., and has updated the systematic sequence accordingly. As a consequence of this sequence change, AGP1/YCL025C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 595 to 633 amino acids
           ||||||||||| ||||||||||||||||||||||||||||||||

Schreve JL, et al. (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The systematic reference sequence of Chromosome III was updated within ORF YCR057C: A single T was inserted after the T at chromosomal coordinate 220246, and a single G was inserted after the G at chromosomal coordinate 221416. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
 The systematic reference sequence of Chromosome III was updated in the region upstream of ORF YCR057C: A single C was inserted after the G at 221662. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
2000-09-13YCR057C, YCR059C222085222085InsertionT
 The systematic sequence was updated in the region between features YCR057C and YCR059C. Note that coordinates listed are chromosomal coordinates.
 A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCR028C-A. A single G was inserted after the G at chromosomal coordinate 173209. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
YCL027W, YCL028W
 Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL028W and YCL027W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||| |||
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
2000-09-13YCL001W-A, YCL001W-B113232113232InsertionAG
 The systematic sequence was updated in the region between YCL001W-A and YCL001W-B. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
2000-09-13ARS300, YCL076W, YCLWTy5-114351435InsertionC
 A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W. A single C was inserted after the T at 1435. This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids. Note that coordinates listed are chromosomal coordinates.
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
YCR102C, YCR102W-A
 The systematic sequence was updated in the region between ORFs YCR102C and YCR102W-A. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
YCR102W-A, YCR104W
 The systematic sequence was updated in the region between ORFs YCR102W-A and YCR104W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
2000-09-13YCR063W, YCR065W227805227805InsertionC
 The systematic sequence was updated in the region between ORFs YCR063W and YCR065W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
 Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL034W. A single G nucleotide was inserted after the G at chromosomal coordinate 62133, and another G was inserted after the G at 62135. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
 A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCL034W, extending the predicted protein sequence N-terminally by 89 amino acids. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
 One single nucleotide insertion was made in Chromosome III downstream of ORF YCR068W to correct the systematic reference sequence: A single C was inserted after the G at chromosomal coordinate 237282.
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR068W. Due to the single nucleotide insertion and resulting frameshift, the annotated stop site of YCR068W was moved downstream, increasing the length of the coding region from 1290 nt to 1563 nt. This annotation change incorporates the area that some had originally referred to as YCR068W-A into YCR068W. ORF YCR068W-A was originally included in the annotation data collected by MIPS on behalf of the European Yeast Chromosome III Sequencing project (see GenBank accession X59720). However, YCR068W-A was never included in SGD as an independent ORF. Note that coordinates listed are chromosomal coordinates.
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
YCL039W, YCL040W
 Five separate substitutions and one single nucleotide insertion were made in the systematic sequence in the intergenic region between ORFs YCL040W and YCL039W. The T at chromosomal coordinate 52435 was changed to C, the CC at 52562 was changed to TGG, the C at 52566 was changed to G, the G at 52580 was changed to A, the GC at 52583 was changed to CT, and a G was inserted after the G at 52593. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
YCR018C-A, YCR019W
 The systematic sequence was updated in the intergenic region between features YCR018C-A and YCR019W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR071C. One nucleotide was inserted causing a frameshift, leading to a C-terminally altered and elongated protein from amino acid 120 onward. The annotated coding region has been increased in length from 366 nt to 441 nt. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
YCR071C, YCR072C
 The systematic sequence was updated in the region between ORFs YCR071C and YCR072C. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
The systematic sequence was updated within ORF YCR072C. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
 One single nucleotide insertion, one dinucleotide insertion, and two single nucleotide substitutions were made in the systematic sequence within ORF YCL042W, resulting in several amino acid changes in the predicted protein sequence, and increasing the size of the coding sequence from 357 nucleotides to 360 nt. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||| ||||||||||||||||||||||
               |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||
2000-09-13YCR073W-A, YCR075C246726246726InsertionAT
 The systematic sequence was updated in the region between ORFs YCR073W-A and YCR075C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
 The systematic sequence was updated within ORF YCR079W, causing frameshifts leading to a C-terminally altered and extended protein from amino acid 415 onward. The annotated coding region has been extended from 1308 nt to 1329 nt. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||
A single nucleotide insertion has also been made immediately downstream of the newly-extended YCR079W coding region.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
YCRWdelta11, tQ(UUG)C
 The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
YCR080W, YCR081W
 Two single nucleotide insertions were made in Chromosome III within the ORF YCR080W to correct the systematic reference sequence: An A was inserted after the G at chromosomal coordinate 253494, and another A was inserted after the G at 253510.
              |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: the C at 253651 was changed to G.
 Thirteen sequence changes were made in Chromosome III within the ORF YCL001W to correct the systematic reference sequence: The C at chromosomal coordinate 111925 was changed to G, the GA at 111940-1 was changed to AG, the G at 111956 was changed to T, a single G was inserted after the A at 112017, a single C was inserted after the A at 112065, and single Ts were inserted after chromosomal coordinates 111950, 111962, 111965, 111968, 111971, 111973, 111977, and 111980.
              ||||||||||||||||||||| ||||||||||||||  ||
              ||||||| ||||| |||||| ||| ||| ||| || |||| ||| |||||||||||||||
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 Five separate insertions were made in the systematic sequence in the region downstream of ORF YCL001W. Single C nucleotides were inserted after the Cs at chromosomal coordinates 112498, 112504, and 112875, a T was inserted after the T at 112535, and a CA was inserted after the C at 112536. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
2011-02-03YCL001W, YCL002C111718111718Insertion C
 A single nucleotide insertion was made in the intergenic region between ORFs YCL002C and YCL001W.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single sequence change was made in Chromosome III within the ORF YCL002C to correct the systematic reference sequence: A single T was inserted after chromosomal coordinate 111515.
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
2011-02-03YCL002C110880110880Insertion A
 A single nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The systematic sequence was updated in the region encompassing feature tN(GUU)C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
2000-09-13YCL008C, YCL009C105585105585InsertionT
 The systematic sequence was updated in the intergenic region between features YCL009C and YCL008C. Note that coordinates listed are chromosomal coordinates. This change is the exact reciprocal of the sequence change made on 1998-02-26.
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
 Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL026C-A. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||
 Several sequence changes were made in the systematic sequence in the region downstream of feature YCL011C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
2000-09-13YCR048W, YCR051W212559212559InsertionC
 The systematic sequence was updated in the intergenic region between ORFs YCR048W and YCR051W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
 A large insertion was made in the systematic sequence in the intergenic region between tRNA-Glu and YCLCdelta1. The following sequence was inserted after the TAAAATATTTCCTCTTTAGTACT ending at 82662:
 One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta3. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
YCL051W, YCL052C
 Four single nucleotide insertions were made in the systematic sequence in the intergenic region between ORFs YCL052C and YCL051W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
              || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 Several sequence changes were made in the systematic sequence within ORF YCL051W, resulting in a number of amino acid changes in the predicted protein sequence. In addition, the stop site was moved upstream 9 nucleotides, shortening the coding sequence from 1761 nt to 1752 nt. Note that coordinates listed are chromosomal coordinates.
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
             || |||| || ||||||||||||||||||||||||||  ||||||||||||||||||||||
 Three separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL054W. A single A was inserted after the A at chromosomal coordinate 33604, a single G was inserted after the T at 33665, and an A was inserted after the A at 33687. Note that while some coordinates may appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
 The systematic sequence was updated in the region upstream of ORF YCR010C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
 The systematic sequence was updated in the region encompassing ORF YCR091W, causing a frameshift leading to a C-terminally altered and shortened protein from aa 690 onward. The coding region of YCR091W had been annotated as 2181 nt long, but is now 2163 nt. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
 Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL063W. Note that these sequence changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
YCL063W, YCL064C
 Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL064C and YCL063W. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
             ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||
               |||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
2000-09-13YCL067C, YCL068C1234012340InsertionAT
 A dinucleotide insertion was made in the systematic sequence in the intergenic region between ORFs YCL068C and YCL067C. An AT was inserted after the T at 12340. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
2011-02-03YCR020W-B, YCR021C155961155961Insertion TG
 A dinucleotide insertion was made in the intergenic region between ORFs YCR020W-B and YCR021C.
             |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The systematic sequence was updated in the region between features YCR027C and YCR028C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
Old:   168201 AATGGGTGAATAATTTGAATGGTTGGAAAT------------------------------------- 168230
              |||||||||||||||||||||||| |||||
Old:   168231 ----------------------------------------------CTATTCTCGGTA 168242
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
YCR030C, YCR031C
 The systematic sequence was updated in the region between features YCR030C and YCR031C. Coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
              |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
 The systematic sequence was updated within ORF YCR005C. The T at coding coordinate 1158 was changed to a C, resulting in a silent substitution within codon 386, which codes for threonine. Note that coordinates listed below are chromosomal coordinates, and the Watson strand is shown (YCR005C is a Crick strand ORF).
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
 A sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta5. Note that coordinates listed are chromosomal coordinates.
             ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
 Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL050C. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
2000-09-13ARS305, YCL050C3909939099SubstitutionTA
 One sequence substitution was made in the systematic sequence in the intergenic region between features YCL050C and ARS305. The T at 39099 was changed to A. Note that coordinates listed are chromosomal coordinates.
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13YCR088W, YCR089W265773265773SubstitutionAG
 The systematic sequence was updated in the region between ORFs YCR088W and YCR089W. Note that coordinates listed below are chromosomal coordinates.
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR089W. Note that coordinates listed below are chromosomal coordinates.
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR011C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
2000-09-13YCR011C, YCR012W136620136620SubstitutionCT
 The systematic sequence was updated in the intergenic region between features YCR011C and YCR012W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 The systematic sequence was updated within ORF YCR012W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
 The systematic sequence was updated in the region encompassing feature YCR014C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
YCR014C, YCR015C
 The systematic sequence was updated in the intergenic region between features YCR014C and YCR015C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
 A single nucleotide substitution was made in Chromosome III within the ORF YCR024C-A to correct the systematic reference sequence: The G at chromosomal coordinate 163027 was changed to A.
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
1997-07-27YCR024C-A, YCR025C163256163256SubstitutionAG
 A single nucleotide substitution was made in Chromosome III within the intergenic region between ORFs YCR024C-A and YCR025C to correct the systematic reference sequence: The A at chromosomal coordinate 163256 was changed to G.
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
 A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCR024C-A. The A at chromosomal coordinate 163030 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
1998-02-26YCR024C-A, YCR025C163259163259SubstitutionGA
 A single nucleotide substitution was made in the systematic sequence in the intergenic region between ORFs YCR024C-A and YCR025C. The G at chromosomal coordinate 163259 was changed to A. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region encompassing feature YCR015C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the intergenic region between features tG(GCC)C and YCR016W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR016W. Note that coordinates listed are chromosomal coordinates.
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
YCR016W, YCR017C
 The systematic sequence was updated in the intergenic region between features YCR016W and YCR017C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
 The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
YCR017C, YCR018C
 The systematic sequence was updated in the intergenic region between features YCR017C and YCR018C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
 A single nucleotide substitution was made in the intergenic region upstream of ORF YCR019W/MAK32.
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The systematic sequence was updated within ORF YCR093W. Note that coordinates listed below are chromosomal coordinates.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL065W. The C at 13811 was changed to G. This is coding nucleotide 72 (codon 24, TGC to TGG) resulting in one amino acid substitution in the predicted protein sequence (Cys to Trp). Note that coordinates listed below are chromosomal coordinates.
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region encompassing ORF YCR073W-A. Note that coordinates listed below are chromosomal coordinates.
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR023C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
YCR023C, YCR024C
 The systematic sequence was updated in the intergenic region between ORFs YCR023C and YCR024C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region encompassing feature YCR024C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
YCR024C, YCR024C-B
 Two single nucleotide substitutions were made in the intergenic region between ORFs YCR024C and YCR024C-B.
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||

             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The systematic sequence was updated within ORF YCR025C. Note that coordinates listed are chromosomal coordinates.
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13YCR025C, YCR026C163801163801SubstitutionAG
 The systematic sequence was updated in the intergenic region between features YCR025C and YCR026C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
 The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
YCR026C, YCR027C
 The systematic sequence was updated in the intergenic region between features YCR026C and YCR027C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||
 The systematic sequence was updated within ORF YCR027C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region between features YCR027C and YCR028CC. Note that coordinates listed are chromosomal coordinates.
Old:   168081 AGGACCAGGACTTCTTGTAG--------------------------------------- 168100
Old:   168101 -----------------------TATCAACGTTCTAGATACCAACATATCAATATAAAAAT 168138
                                     |||| || ||||||||||| ||||||||||||||||||
 The systematic sequence was updated in the region upstream of feature YCR027C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
 The systematic sequence was updated within ORF YCR028C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
              |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
 The following nucleotide substitutions were made within the ORF YCL073C to correct the systematic reference sequence: G to A at chromosomal coordinate 6608, G to A at 6718, C to T at 6738, T to C at 6872, C to T at 6884, G to A at 6921, A to G at 7016, T to C at 7100.
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||

             ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||

             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 Eight separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
           ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
YCL073C, YCLWomega2
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||
             ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||
             ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
             |||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
 Twelve separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. These changes resulted in 4 amino acid differences in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
             |||||||||||| ||| ||||| |||||||
             |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
             ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
 Five single nucleotide substitutions were made in the systematic sequence in the region encompassing pseudogene YCL074W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
             ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
2000-09-13YCL074W, YCLWomega238583858SubstitutionCA
 A single nucleotide substitution was made in the systematic sequence in the intergenic region between features YCL074W and YCLWomega2. The C at 3858 was changed to A. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
 One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta2a. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR030C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR031C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
 The systematic sequence was updated within ORF BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
               || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
              |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region between ORFs YCR032W and YCR033W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
2000-09-13YCR105W, YCR106W309312309312SubstitutionGA
 The systematic sequence was updated in the region between ORFs YCR105W and YCR106W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
              |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated in the region encompassing ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
              | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
              || ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR107W. Note that coordinates listed below are chromosomal coordinates.
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR035C. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
YCR035C, YCR036W
 The systematic sequence was updated in the region between ORFs YCR035C and YCR036W. Note that coordinates listed are chromosomal coordinates.
              |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||
 The systematic sequence was updated within ORF YCR036W. Coordinates listed are chromosomal coordinates.
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
 The systematic sequence was updated within ORF YCR037C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
YCR037C, YCR038C
 The systematic sequence was updated in the region between ORFs YCR037C and YCR038C. Coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
 A single nucleotide substitution was made in Chromosome III within the ORF YCL005W to correct the systematic reference sequence: The C at 108620 was changed to a T.
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
 One single nucleotide substitution was made to the systematic sequence in the region encompassing ORF YCL005W. The T at chromosomal coordinate 108615 was changed to C. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
 A single nucleotide substitution was made in Chromosome III within the ORF YCL009C to correct the systematic reference sequence: The G at 104260 was changed to a C.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
2000-09-13YCL009C, YCL010C104419104419SubstitutionTC
 The systematic sequence was updated within ORF YCL009C. Note that coordinates listed are chromosomal coordinates.
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
 One single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL010C. The C at chromosomal coordinate 104254 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
 Three single nucleotide sequence changes were made in the systematic sequence within ORF YCL018W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
YCRWdelta11, tQ(UUG)C
 The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
              ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
              ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
 The systematic sequence was updated in the region encompassing feature YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
YCL019W, YCL020W
 Several sequence changes were made in the systematic sequence in the region encompassing overlapping features YCL019W and YCL020W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
 The systematic sequence was updated within feature snR189. Note that coordinates listed are chromosomal coordinates.
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1997-07-27YCR054C, YCR055C219173219173SubstitutionGA
 A single nucleotide substitution was made in Chromosome III between ORFs YCR054C and YCR055C to correct the systematic reference sequence: The G at chromosomal coordinate 219173 was changed to A.
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
1998-02-26YCR054C, YCR055C219175219175SubstitutionAG
 A single nucleotide substitution was made in the systematic sequence in the region between ORFs YCR054C and YCR055C. The A at chromosomal coordinate 219175 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
2000-09-13YCR054C, YCR057C219173219173SubstitutionGA
 The systematic sequence was updated in the region betweeen ORFs YCR054C and YCR057C. Note that coordinates listed below are chromosomal coordinates. Note also that this same change was made on 1997-07-27, but changed back to its original state on 1998-02-26, so that this current change restores one originally made on 1997-07-27.
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
 The systematic sequence was updated within ORF YCR028C-A. Note that coordinates listed are chromosomal coordinates.
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
 Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL027W. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
             ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||
 Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL029C. Note that coordinates listed are chromosomal coordinates.
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
             ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||
 The systematic sequence was updated downstream of ORF YCR060W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
 The systematic sequence was updated in the region encompassing ORF YCR061W. Note that coordinates listed below are chromosomal coordinates.
              ||||||||||||||||||||||||||||    ||  |   ||  ||  ||    ||||||
 One sequence change was made in the systematic sequence in the region encompassing ORF YCL030C, resulting in one amino acid substitution. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
 The systematic sequence was updated within feature snR33. Note that coordinates listed are chromosomal coordinates.
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
 A single nucleotide substitution in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine.
               |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL049C, resulting in 4 amino acid substitutions in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
             |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
 A dinucleotide substitution was made in the systematic sequence in the region encompassing feature ARS304. The GT at 30504-5 was changed to TG. Note that coordinates listed are chromosomal coordinates.
             ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
 Two sequence changes were made in the systematic sequence in the region encompassing feature ARS306. Note that coordinates listed are chromosomal coordinates.
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
 Two single nucleotide substitutions were made within the intron of YCL012C.
             ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
 The position of the annotated ACS within ARS318 was updated based on Chang et al. 2008.

Chang F, et al. (2008) Analysis of chromosome III replicators reveals an unusual structure for the ARS318 silencer origin and a conserved WTW sequence within the origin recognition complex binding site. Mol Cell Biol 28(16):5071-81
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Carol Newlon identified an additional delta element on Chromosome III. This delta element is present in the current Chromosome III sequence, but was not in Newlon's clone A5C, which was used to generate the original Chromosome III sequence. The new delta element is being named YCLWdelta15, and is between tE(UUC)C and YCLCdelta1.

Newlon C (2008)
SGD Papers Entry  

 YCRCtau1 was erroneously annotated on the Watson strand instead of the Crick strand. This error has been corrected. Thank you to Douda Bensasson from bringing this mistake to our attention.

Bensasson D (2008)
SGD Papers Entry  

2007-12-14HML, HMR, MATALPHA
 The W, X, Y, Z1 and Z2 regions of the mating-type loci (HML, MAT, and HMR cassettes) were annotated based on Abraham et al. 1984, Astell et al. 1981, Tatchell et al. 1981, and Wang et al. 2001.

Astell CR, et al. (1981) The sequence of the DNAs coding for the mating-type loci of Saccharomyces cerevisiae. Cell 27(1 Pt 2):15-23
SGD Papers Entry  Pubmed Entry  DOI full text  
Abraham J, et al. (1984) Regulation of mating-type information in yeast. Negative control requiring sequences both 5' and 3' to the regulated region. J Mol Biol 176(3):307-31
SGD Papers Entry  Pubmed Entry  DOI full text  
Tatchell K, et al. (1981) In vitro mutation analysis of the mating-type locus in yeast. Cell 27(1 Pt 2):25-35
SGD Papers Entry  Pubmed Entry  DOI full text  
Wang Y, et al. (2001) DNA replication forks pause at silent origins near the HML locus in budding yeast. Mol Cell Biol 21(15):4938-48
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Based on experimental evidence published by Harrington and Kolodner, the start site for MSH3/YCR092C was moved 84 nt (28 codons) downstream. This change is consistent with that predicted by Kellis et al.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Harrington JM and Kolodner RD (2007) Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs. Mol Cell Biol 27(18):6546-54
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2007-04-02YCLCdelta1, YCRCdelta14, YCRCdelta6, YCRCdelta7
 The following LTRs on Chromosome III were mistakenly annotated in the wrong direction (i.e., on the Watson strand instead of Crick), and the error has now been corrected: YCLCdelta1, YCRCdelta6, YCRCdelta7, YCRCdelta14. Thanks go to Marc Gartenberg for bringing this annotation error to our attention.
 The ACS annotation was added based on Xu et al. 2006 and Brand et al. 1987.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Brand AH, et al. (1987) A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 51(5):709-19
SGD Papers Entry  Pubmed Entry  DOI full text  

2006-09-06ARS313, ARS314, ARS315, ARS316
 The coordinates of the following ARS elements on Chromosome III were updated based on Nieduszynski et al. 2006: ARS313, ARS314, ARS315, ARS316.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

 YCL058W-A was originally added per Brachat et al., based on conservation with Ashbya gossypii. Kellis et al. also predicted a protein in the same frame, but with a 19 amino acid N-terminal deletion relative to the ORF predicted by Brachat et al. SGD has changed the annotation to that predicted by Kellis et al., based on conservation of that start site in sensu stricto strains of Saccharomyces.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that a new ORF, YCL048W-A, be added to the S. cerevisiae genome annotation. This suggestion was later confirmed by Zhang and Dietrich 2005 using high-throughput identification of transcription start sites.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The ORF YCR095W-A was added per Oshiro et al. 2002.

Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

 Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for YCL002C. The resulting ORF is in the same frame, but has a 99-residue extension at the N-terminus.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely-related Saccharomyces species in Kellis et al. 2003, the start site for SRO9/YCL037C was moved 96 nt (32 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL03L, TEL03L-TR, TEL03L-XC, TEL03L-XR, TEL03R, TEL03R-TR, TEL03R-XC, TEL03R-XR
 The chromosomal locations for the following telomeric features were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL03L, TEL03L-XC, TEL03L-XR, TEL03L-TR, TEL03R, TEL03R-XC, TEL03R-XR, TEL03R-TR.
2003-07-29YCL005W-A, YCL058W-A, YCR075W-A
 Thanks to Brachat et al. 2003 for providing the coordinates of the following ORFs on Chromosome III: YCL005W-A, YCL058W-A, YCR075W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Thanks to Kessler et al. for providing the coordinates of ORF YCR108C.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YCR045W-A, YCR047W-A, YCR081C-A
 Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome III: YCR045W-A, YCR047W-A, YCR081C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

 The stop site of ORF YCL024W was moved 366 nt downstream, changing the relative coding coordinates from 1-2748 to 1-3114. Chromosomal coordinates change from 79125-81872 to 79161-82274.
 The stop site of YCL010C was moved 339 nt upstream, increasing the size of the coding region from 441 nt to 780 nt. The chromosomal coordinates have changed from 103995-103515 to 104345-103566.
 The start site of YCL008C was moved 252 nt upstream, and the stop site was moved 179 nt downstream, increasing the size of the coding region from 360 nt to 891 nt. The chromosomal coordinates have changed from 106208-105849 to 106849-105959.
 YCR103C was originally annotated as an ORF, but upon further review was removed from the genome annotation.
2000-09-14YCR061W, YCR062W
 After resequencing and annotation of Chromosome III, ORF YCR062W has been merged into neighboring ORF YCR061W. The coding region of YCR061W had been 1752 nt long, but is now 1896 nt in length.
2000-09-14YCL021W-A, YCL026C-B, YCL057C-A
 The following ORFs were added after the MIPS ChrIII sequence update: YCL021W-A, YCL026C-B, YCL057C-A.
 YCRCdelta7 was shortened from 380 bp to 323 bp, a net decrease of 57 bp.
 The stop site of ORF YCL025C was moved 114 nt upstream, changing the relative coding coordinates from 1-1902 to 1-1788. Chromosomal coordinates change from 77886-75985 to 77918-76131.
 YCL006C was deleted as a result of a sequence change that created a stop codon after residue 23.
 Old name: YCR070W; new name: YCR069W; date: 2/15/2000; old coord: ChrIII; SGDID: Unknown; YCR070W incorporated into YCR069W
2000-02-10YCL003W, YCL004W
 YCL003W was originally annotated as an independent ORF, but as a result of a sequence change, it was merged with an adjacent ORF into a single reading frame, designated YCL004W. YCL004W + YCL003W = YCL004W from MIPS.
 The stop site of ORF YCL054W was moved 351 nucleotides downstream, increasing the length of the coding sequence from 2175 nt to 2526 nt.
 The stop site of ORF YCL012W was moved 137 nt downstream, lengthening the coding region from 459 nt to 696 nt. Chromosomal coordinates change from 100110-100568 to 100113-100808.
 ORF YCL053C has been deleted due to a sequence correction.
 ORF YCL021W was deleted as a result of corrections to the systematic sequence.
 The ORF YCL013W has been deleted as a result of updates to the systematic sequence.
 The start site of ORF YCL039W was moved 42 nucleotides downstream, reducing the length of the coding sequence from 2280 nt to 2238 nt.
 The stop site of ORF YCL024W was moved 297 nt downstream, changing the relative coding coordinates from 1-2451 to 1-2748. Chromosomal coordinates change from 79119-81569 to 79125-81872.
 ORF YCL026C was deleted due to a sequence correction.
1998-07-24YCR055C, YCR057C, YCR058C
 ORFs YCR055C and YCR058C were merged with existing ORF YCR057C. The coding region of YCR057C had been 1320 nt long, but is now 2772 nt in length.
 ORF YCR029C has been deleted from the genome annotation due to sequence correction.
1998-07-24YCL062W, YCL063W
 Due to several sequence changes in the region encompassing ORFs YCL062W and YCL063W, YCL062W has been merged into adjacent ORF YCL063W. The coding region of YCL063W had been 387 nt long, and is now 1272 nt in length.
1998-07-24YCR029C-A, YCR030C
 ORF YCR029C-A has been merged into neighboring ORF YCR030C. The coding region YCR030C had been annotated as 1974 nt long, but is now 2613 nt in length.
1998-07-24YCR080W, YCR081W
 YCR080W was originally annotated as an independent ORF, but upon further review was merged with neighboring ORF YCR081W. As a result, the annotated start site of YCR081W was moved 603 nt upstream, increasing the coding region of YCR081W in length from 3681 nt to 4284 nt.
 YCR074C was originally annotated as an ORF, but upon further review was removed from the genome annotation.
 ORF YCR056W was deleted from the genome annotation due to sequence correction.
1998-07-24YCL060C, YCL061C
 Due to several sequence changes in the region encompassing ORFs YCL060C and YCL061C, YCL060C has been merged into adjacent ORF YCL061C.
 ORF YCR070W has been deleted from the genome annotation.
 The following putative ORFs were originally included in the annotation of Chromosome III, but were later withdrawn: YCLX01W, YCLX02C, YCLX03C, YCLX04W, YCLX05C, YCLX06C, YCLX07W, YCLX09W, YCLX10C, YCLX11W, YCLX12W, YCRX01W, YCRX02C, YCRX03C, YCRX04W, YCRX05W, YCRX06W, YCRX07W, YCRX08W, YCRX09C, YCRX10W, YCRX11W, YCRX12W, YCRX14W, YCRX15W, YCRX16C, YCRX17W, YCRX18C, YCRX19W, YCRX20C, and YCRX21C.

SGD (1998) Putative ORF Annotations on Chromosome III
SGD Papers Entry  

 The start site of ORF YCL001W was moved 159 nt downstream.
1998-05-21YCR018C-A, YCR102W-A
 The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  

1997-07-26YCR097W-A, YCR097WA
 The original YCR097W-A ORF (SGDID: S0000693) was deleted because: HMRA1/YCR097W contains two introns and the 3'' intron is spliced less efficiently but probably does NOT create an alternative form of the protein. Because there is no evidence for a functional protein at the original YCR097W-A coordinates, this ORF was deleted.

Note that a new ORF with the same name (YCR097W-A, SGDID: S0007632) has been added because of homology to a hemiascomycetous yeast protein, but that these two ORFs (the original vs the new YCR097W-A) are completely different, except that they have the same name.

Jump to: Sequence Changes | Annotation Changes without Sequence Changes