Chromosome XIII History Help



 

This page lists all sequence and annotation changes that have been made to the Chromosome XIII systematic reference sequence since its intial release on 1996-07-31.


SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of Change Old SequenceNew Sequence
2004-02-28YMR268W-A, YMR269W804684804684DeletionC
 Deleted C at 804684 and moved YMR269W start 208 bp upstream from 804663 (old YMR269W start) to 804455 (YMR268W-A start) based on Brachat et al. 2003. This resulted in the merge of YMR268W-A, which was added in June 2003 based on Kessler et al. 2003, into YMR269W. As a result of this sequence correction and locus merge, the YMR269W protein increases in size from 142 amino acids to 211 amino acids, and YMR268W-A is no longer considered a separate ORF.
 
New:    181 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTC-AAAATGAGGC 239
            ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| 
Old: 804635 AACCTGGATGTAAGCACTGATTCGAATAATGGCAGTATTAAATTTACTCCAAAATGAGGC 804694 

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  
Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2011-02-03YML131W, YML132W95429542DeletionT
 A single nucleotide was deleted from the intergenic region between ORFs COS3/YML132W and YML131W.
New    9531    TTTTTTTTTTT-GCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC  9599
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    9531    TTTTTTTTTTTTGCCTTCTTCATACTTTTACTCCTGCTTTTATTACTCTAAATTTCATTTTTATTTATTC  9600

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03YMR008C, YMR009W283468283468Insertion G
 A single nucleotide was inserted in the intergenic region between ORFs PLB1/YMR008C and ADI1/YMR009W.
New    283440  GAAATATCGGAGTCTTGCTATTGTTCAGGGCTTTGCCGGTGCGTAAATAATAGGCTGAAG  283499
               ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    283440  GAAATATCGGAGTCTTGCTATTGTTCAGG-CTTTGCCGGTGCGTAAATAATAGGCTGAAG  283498

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03YMR315W-A, YMR316W904639904639Insertion G
 A single nucleotide was inserted in the intergenic region between ORFs YMR315W-A and DIA1/YMR316W.
New    904620  TTCTTTTTTTTGGCGCAGCAAGGGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG  904679
               ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    904619  TTCTTTTTTTTGGCGCAGCAA-GGACAATGGTCCCTTTTTGAGAAAATGTTGTAGGCTTG  904677

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03YML121W, YML122C2660226602Insertion T
 A single nucleotide was inserted in the intergenic region between ORFs YML122C and GTR1/YML121W.
New    26580   TTTTATTGAATCTTTTTTTTTTTGTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA  26639
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    26581   TTTTATTGAATCTTTTTTTTTT-GTAAGAAAATTAAGGTTTATTAGGCAGAGTATACCGA  26639

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03
YMR317W
908194908201SubstitutionCGTCAACAGGGCAACG
908172908183SubstitutionTCAGTGAGTTCGGTAATTAGTTCA
908216908216SubstitutionTC
 Nucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS.
New    908160  CGGCAACGTCTAGCGTAATTAGTTCAGAAGCTTCATGGGCAACGTCTAGCTCAGTGAGCTCGGAAGCTCC  908229
               ||||||||||||||  | | ||||| |||||||||| | |||| |||||||||||||| |||||||||||
Old    908158  CGGCAACGTCTAGCTCAGTGAGTTCGGAAGCTTCATCGTCAACATCTAGCTCAGTGAGTTCGGAAGCTCC  908227

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03YMRCtau3, YMRWdelta20808976808976SubstitutionAT
 A single nucleotide substitution was made in the intergenic region between LTRs YMRCtau3 and YMRWdelta20.
New    808920  TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCATCGTTTCACTTAC  808989
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    808919  TGATTTGCGCAACGCAGATACAGATTTTACTTTATTCTTCGTGCCTAAAATGGACCAACGTTTCACTTAC  808988

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03YMR262W794225794225SubstitutionGC
 Nucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan.
New    794220  ATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA  794279
               |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    794219  ATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACACGATGTAAAGTGCCA  794278

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03
YMR290W-A
851740851740SubstitutionGA
851734851734SubstitutionGA
 Nucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR.
New    851700  TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAAGAAAAAGCAAATAAAAAATTTTCA  851759
               ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Old    851699  TAAAGCTAATATTGAAAAAAAAAAAAAAAAAAAAAGGAAAAGGCAAATAAAAAATTTTCA  851758

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

2011-02-03YMR299C864682864682SubstitutionGT
 Nucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine.
New    864660  TCGGTATTAATATCTCACTGCGTTTGACCATTTCAATATGATCTTTCATATCTCTATCTT  864719
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    864659  TCGGTATTAATATCTCACTGCGTGTGACCATTTCAATATGATCTTTCATATCTCTATCTT  864718

Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2009-05-08ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, ARS1335
 The following ARS elements on Chromosome 13 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1304, ARS1317, ARS1319, ARS1321, ARS1322, ARS1331, ARS1333, and ARS1335.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2007-07-10YMR242C
 The start of ORF RPL20A/YMR242C was moved 23 nt upstream, and the 5' end of the intron was moved 32 nt upstream, based on Miura et al. 2006, Zhang et al. 2007, and GenBank EF138821. The ORF had been annotated as 973 nt long with a 436-nt intron (178 aa), but is now 996 nt long with a 477-nt intron (172 aa).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  Web Supplement  yfgdb  
Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  yfgdb  

2007-07-10YML036W
 The stop of ORF CGI121/YML036W was moved 82 nt downstream and an intron was added at relative coordinates 457..562 based on GenBank EF123129, Juneau et al. 2007, and Miura et al. 2006. The ORF had been annotated as 570 nt long (189 aa), but is now 652 nt in length with a 106-nt intron (181 aa).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  yfgdb  

2007-05-08snR78
 Updated coordinates of snR78 based on GenBank AJ010801. Extended 3' end by 1 nt.

Qu LH, et al. (1999) Seven novel methylation guide small nucleolar RNAs are processed from a common polycistronic transcript by Rat1p and RNase III in yeast. Mol Cell Biol 19(2):1144-58
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2006-10-05snR86
 This snoRNA gene, snR86, was identified by Torchet et al. Many thanks to Wayne Decatur and Dorota Piekna-Przybylska for alerting us to this new gene.

Torchet C, et al. (2005) The complete set of H/ACA snoRNAs that guide rRNA pseudouridylations in Saccharomyces cerevisiae. RNA 11(6):928-38
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2006-09-07ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332
 The following new ARS elements on Chromosome XIII were added to SGD based on Nieduszynski et al. 2006: ARS1303, ARS1305, ARS1307, ARS1308, ARS1309, ARS1310, ARS1312, ARS1316, ARS1320, ARS1323, ARS1324, ARS1325, ARS1327, ARS1328, ARS1329, ARS1330, ARS1332.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  

2006-05-10YMR059W
 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported their proposal., so the start codon for SEN15/YMR059W was moved 60 nt (20 amino acids) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  

2006-01-24snR85
 New snoRNA added to genome annotation (GenBank accession # AY679773).

Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  SGD Curated Comments & Errata

2006-01-23RNA170
 ncRNA added based on work published by Olivas et al.

Olivas WM, et al. (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2004-10-12CEN13
 The coordinates of this centromere were updated to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. 2001, and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2004-04-01snR83
 Start and stop coordinates updated per McCutcheon and Eddy
2004-01-30YML017W
 Based on analyses of homology and synteny in Ashbya gossypii, followed by verification using 5' RACE, Brachat et al. (2003) proposed an intron and 5' extension for PSP2/YML017W. The updated ORF is in the same frame with the start codon shifted 407 bp upstream and a 362-bp intron at relative coordinates 5-366; the protein has a 15-residue extension at the N-terminus. GenBank Accession AY245793.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2003-09-27YMR242C
 Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for RPL20A/YMR242C. The resulting ORF is in the same frame, but has an altered N-terminus and is 2 residues shorter. This change was reviewed and accepted by SGD curators.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  

2003-09-22YMR214W
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SCJ1/YMR214W be moved 81 nt (27 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Insertions and deletions in S. paradoxus, S. mikatae and S. bayanus relative to the S. cerevisiae sequence create frameshifts between the upstream and downstream ATGs; 4) Mori et al. demonstrate that a beta-galactosidase fusion is expressed when fused immediately downstream of Met28, but not when fused downstream of Met1; 5) an NCBI BLAST against the non-redundant dataset shows that there are many DnaJ-related proteins from various species with strong sequence similarity to SCJ1 beginning around amino acid 50 (C-terminal to the predicted Met28), with no strong similarity before amino acid 50.

Mori K, et al. (1998) Palindrome with spacer of one nucleotide is characteristic of the cis-acting unfolded protein response element in Saccharomyces cerevisiae. J Biol Chem 273(16):9912-20
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  

2003-09-22YML107C
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YML107C be moved 156 nt (52 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) In S. paradoxus and S. mikatae, the original upstream start is not conserved, and there are frameshifts between the two ATGs. The upstream start codon is conserved in S. bayanus, but there are frameshifts between the two ATGs.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  

2003-09-22YMR191W
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YMR191W be moved 255 nt (85 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Insertions and deletions in S. paradoxus, S. mikatae and S. bayanus relative to the S. cerevisiae sequence create frameshifts between the upstream and downstream ATGs; 4) a BLAST to the NCBI non redundant (nr) dataset indicates that the first 85 aa of S. cerevisiae Ymr191wp do not have significant homology to any other sequences.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  

2003-09-09TEL13L, TEL13L-TR1, TEL13L-TR2, TEL13L-XC, TEL13L-XR, TEL13L-YP, TEL13R, TEL13R-TR, TEL13R-XC, TEL13R-XR
 The chromosomal locations for TEL13L, TEL13L-TR1, TEL13L-TR2, TEL13L-XC, TEL13L-XR, TEL13L-YP, TEL13R, TEL13R-TR, TEL13R-XC, and TEL13R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2003-07-29YMR013C-A, YMR175W-A, YMR247W-A
 Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIII ORFs: YMR013C-A, YMR175W-A, and YMR247W-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  yfgdb  
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  yfgdb  

2003-07-29YML100W-A, YML133W-A, YML133W-B, YMR001C-A, YMR105W-A, YMR182W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A
 Thanks to Kumar et al. for providing the coordinates of the following ORFs: YML100W-A, YML133W-B, YMR105W-A, YMR242W-A, YMR272W-A, YMR272W-B, YMR315W-A, YMR182W-A, YMR001C-A, and YML133W-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Web Supplement  yfgdb  SGD Curated Comments & Errata

2003-07-29YML031C-A
 The ORF YML032C-A was included in the original annotation of Chromosome XIII, but was later withdrawn and was deleted from SGD on August 23, 1999. On the recommendation of MIPS, this ORF has subsequently added back to the genome annotation, but with a new name (YML031C-A). Thanks to MIPS for providing the coordinates of YML031C-A.

SGD (2007) Information without a citation in SGD
SGD Papers Entry  

2003-07-29YML054C-A, YMR030W-A, YMR141W-A, YMR230W-A, YMR268W-A, YMR307C-A
 Thanks to Kessler et al. for providing the coordinates of the following Chromosome XIII ORFs: YML054C-A, YMR030W-A, YMR141W-A, YMR268W-A, YMR307C-A, and YMR230W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2003-07-29YMR194C-B
 Thanks to Brachat et al. for providing the coordinates of YMR194C-B.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

2003-03-06snR83
 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Web Supplement  SGD Curated Comments & Errata

2003-01-07YML032C
 The start site of RAD52/YML032C has been moved 99 nt downstream from 214029 to 213930. Chromosomal coordinates change from old:214029-212515 to new:213930-212515. Relative coordinates change from old:1-1515 to new:1-1416. In S. paradoxus, S. bayanus, and S. mikatae, the first in-frame ATG aligns with the third start codon in S. cerevisiae. This change is also supported by the following evidence: (1) mutational analysis by the Rothstein lab (A. Antunez de Mayolo, M. Lisby, N. Erdeniz); (2) additional sequence analysis done by Tanja Thybo Frederiksen in Uffe Mortensen's lab; (3) mRNA analysis described in Adzuma et al.

Adzuma K, et al. (1984) Primary structure of the RAD52 gene in Saccharomyces cerevisiae. Mol Cell Biol 4(12):2735-44
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

1999-11-17YMR125W
 Two annotation changes were made to STO1/YMR125W based on Uemura et al. 1996: (1) The start was moved 331 bp upstream from chromosomal coordinate 517869 to 517538, and (2) a 322-bp intron was added at 517563-517884. The stop remains unmoved at 520445. The position for the intron relative to the ORF itself is 26-347, with the coding sequence now 1-25, 348-2908. Previous chromosomal coordinates were 517869-520445, representing a coding sequence with relative ORF coordinates of 1-2577.

Uemura H, et al. (1996) Mutations in GCR3, a gene involved in the expression of glycolytic genes in Saccharomyces cerevisiae, suppress the temperature-sensitive growth of hpr1 mutants. Genetics 142(4):1095-103
SGD Papers Entry  Pubmed Entry  Reference LINKOUT  Reference LINKOUT  Reference LINKOUT  

1999-07-17YML017W
 The original annotation of the YML017W ORF was incorrect because it did not include the stop codon. The stop coordinate has now been corrected so that the ORF extends an additional three nucleotides to include the stop codon.

Jump to: Sequence Changes | Annotation Changes without Sequence Changes