Take our Survey

Chromosome III History Help



 

This page lists all sequence and annotation changes that have been made to the Chromosome III systematic reference sequence since its intial release on 1996-07-31.


SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected Features Start Coordinate
of Change
End Coordinate
of Change
Type of ChangeOld SequenceNew Sequence
2000-09-13ARS300, YCL076W, YCLWTy5-114351435InsertionC
 A single nucleotide insertion was made in the systematic sequence in the region encompassing overlapping features ARS300, YCLWTy5-1, and YCL076W. A single C was inserted after the T at 1435. This change resulted in the predicted protein encoded by YCL076W being elongated at the N-terminal end by 51 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:    1434 CT-AGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1492
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    1441 CTCAGAGCAATGCTTCTGAGAACATAATCAATCTATCTAGCCCCAACAATTATAAACAGT 1500
2000-09-13ARS3043050430505SubstitutionGTTG
 A dinucleotide substitution was made in the systematic sequence in the region encompassing feature ARS304. The GT at 30504-5 was changed to TG. Note that coordinates listed are chromosomal coordinates.
Old:   30470 AAATCTCAAAGTCGAAGAAACACAGAACACAGAAGTAAACTGGACTAAATGATTTTCAAT 30529
             ||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||
New:   30487 AAATCTCAAAGTCGAAGAAACACAGAACACAGAATGAAACTGGACTAAATGATTTTCAAT 30546
2000-09-13
ARS305
3948839488SubstitutionGA
3951539516SubstitutionAATC
3952839528SubstitutionCT
3958339583SubstitutionGA
3962239622DeletionG
3930239302SubstitutionGT
3924139241SubstitutionCT
3950039501SubstitutionCCGA
 Several sequence changes were made in the systematic sequence in the region encompassing feature ARS305. Note that coordinates listed are chromosomal coordinates.
Old:   39210 ATGTTAACAAACAGTTCTGATTATTCGCCTTCTGACAGGACGATAATGTAAATAGTTGTG 39269
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   39234 ATGTTAACAAACAGTTCTGATTATTCGCCTTTTGACAGGACGATAATGTAAATAGTTGTG 39293
Old:   39270 GTAGTATCATTCAGGTATGTAACTGTTTACTTGGTATCGCTTGAAAAAAATAAGCATTTC 39329
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   39294 GTAGTATCATTCAGGTATGTAACTGTTTACTTTGTATCGCTTGAAAAAAATAAGCATTTC 39353
Old:   39450 TATTATTTTTTATTTACTTTGTAGTTCTTAAAGCTAAGGTTTTTTTCTTTCCTAAATTCT 39509
             |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
New:   39474 TATTATTTTTTATTTACTTTGTAGTTCTTAAAGCTAAGATTTTTTTCTTTGATAAATTCT 39533
Old:   39510 TGTTTAAATATCCTAAAACTAAAGGGAAAATAAACAATACATAACAAAACATATAAAAAC 39569
             |||||  ||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   39534 TGTTTTCATATCCTAAAATTAAAGGGAAAATAAACAATACATAACAAAACATATAAAAAC 39593
Old:   39570 CAACACAATAAAAGAAAGGATCAAATACTCATTAAAGTAACTTACACGGGGGGCTAAAAA 39629
             ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
New:   39594 CAACACAATAAAAAAAAGGATCAAATACTCATTAAAGTAACTTACACGGGGG-CTAAAAA 39652
2000-09-13ARS305, YCL050C3909939099SubstitutionTA
 One sequence substitution was made in the systematic sequence in the intergenic region between features YCL050C and ARS305. The T at 39099 was changed to A. Note that coordinates listed are chromosomal coordinates.
Old:   39090 GTTATGGGATTATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39149
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   39114 GTTATGGGAATATCGTGTAAGCTGGGGTGACTTTTGAGCTATTCGCGACGCCCGACGCCG 39173
2000-09-13
ARS306
7417374173SubstitutionTC
7372973729InsertionG
7431774317SubstitutionGA
7430674306SubstitutionCG
7429874298SubstitutionAC
7404574045SubstitutionCT
7397373973SubstitutionCT
7394873948DeletionC
 Several sequence changes were made in the systematic sequence in the region upstream of ARS306. Note that coordinates listed are chromosomal coordinates.
Old:   73691 CTCATCCCTTGCTGAAGCAGGCCTCTTTTGACCGGCAGG-CTTTCTATAGCCTTAGTCAC 73749
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   73720 CTCATCCCTTGCTGAAGCAGGCCTCTTTTGACCGGCAGGGCTTTCTATAGCCTTAGTCAC 73779
Old:   73930 TTTCAAATAAGTTGCAACCAGCAGACATGATATTGGATTGTTTCTTTGTATATATGTTGA 73989
             |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||
New:   73960 TTTCAAATAAGTTGCAAC-AGCAGACATGATATTGGATTGTTTTTTTGTATATATGTTGA 74018
Old:   73990 TATAGGATACTTCAGTCTACGAAAAAAGTACAAATTATGTAGTCAGTTCCTTCAGCATGG 74049
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   74019 TATAGGATACTTCAGTCTACGAAAAAAGTACAAATTATGTAGTCAGTTCCTTCAGTATGG 74078
Old:   74170 TTTTTCGAATAATCATTAGTAAAAGCGGTATACTGGATTATTGTACGATAACAAGGTAGA 74229
             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   74199 TTTCTCGAATAATCATTAGTAAAAGCGGTATACTGGATTATTGTACGATAACAAGGTAGA 74258
Old:   74290 AGAAGGAGAGGGTCTGCTGAATAGTGTGAGCAGTGTTTCTGAACTTTTTCTTCGTCTAAG 74349
             |||||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||
New:   74319 AGAAGGAGCGGGTCTGGTGAATAGTGTAAGCAGTGTTTCTGAACTTTTTCTTCGTCTAAG 74378
2000-09-13
ARS306
7454874548SubstitutionCT
7447674476SubstitutionTC
 Two sequence changes were made in the systematic sequence in the region encompassing feature ARS306. Note that coordinates listed are chromosomal coordinates.
Old:   74470 TTTTTTTAAATTTTCGAATTGTATTTATATTTATTTAGTACTTCTTGAGTTTACATATCC 74529
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   74499 TTTTTTCAAATTTTCGAATTGTATTTATATTTATTTAGTACTTCTTGAGTTTACATATCC 74558
Old:   74530 TTCGTAAAAATGCAACTTCTGTCGAAAAACACTTCCAAAAAAAAATAATAATGAATTTAT 74589
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   74559 TTCGTAAAAATGCAACTTTTGTCGAAAAACACTTCCAAAAAAAAATAATAATGAATTTAT 74618
1997-07-27
ARS307
108796108796InsertionG
108844108844SubstitutionGC
109259109259DeletionA
 Three sequence changes were made to Chromosome III within ARS307 to correct the systematic reference sequence: A single G was inserted after chromosomal coordinate 108796, the G at 108844 was changed to a C, and the A at 109259 was deleted.
New:   108769 TCTCCAGAAACCCTTCAATATAAAAAGGGCAGATGTCCGCTGCGAACCCTTCTCCATTTG 108828
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old:   108769 TCTCCAGAAACCCTTCAATATAAAAAGG-CAGATGTCCGCTGCGAACCCTTCTCCATTTG 108827
New:   108829 GCAATTATTTGAACACCATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCATT 108888
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old:   108828 GCAATTATTTGAACACGATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCATT 108887

New:   109249 GCTTACAACAT-TGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAACC 109307
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:   109248 GCTTACAACATATGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAACC 109307
1998-02-26
ARS307
109254109254InsertionA
108792108792DeletionG
108840108840SubstitutionCG
 Three single nucleotide changes were made to the systematic sequence in the region encompassing ARS307. The G at chromosomal coordinate 108792 was deleted, the C at 108840 was changed to G, and an A was inserted after the T at 109254. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   108763 CTCTCCAGAAACCCTTCAATATAAAAAGGGCAGATGTCCGCTGCGAACCCTTCTCCATTT 108822
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   108768 CTCTCCAGAAACCCTTCAATATAAAAAGG-CAGATGTCCGCTGCGAACCCTTCTCCATTT 108826
Old:   108823 GGCAATTATTTGAACACCATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCAT 108882
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   108827 GGCAATTATTTGAACACGATCACTAAGTCCCTACAACAGAATTTACAAACATGCTTTCAT 108886
Old:   109243 GGCTTACAACAT-TGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAAC 109301
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   109247 GGCTTACAACATATGAAAATATATGGGTTTGATAACGAGGTCATTCTTTCGGGAGCCAAC 109306
2000-09-13
ARS310
166780166780SubstitutionAG
166730166730DeletionA
166754166755DeletionAG
 The systematic sequence was updated in the region encompassing feature ARS310. Note that coordinates listed are chromosomal coordinates.
Old:   166701 CTTAGGTACAAAAAGATTAAGAAAGTCAAATTGTCCTTAGTTTTAAAAGACAGAGTTACT 166760
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||  |||||
New:   166982 CTTAGGTACAAAAAGATTAAGAAAGTCAA-TTGTCCTTAGTTTTAAAAGACAG--TTACT 167038
Old:   166761 TCATGTCTTTAACATCAACAGCAAATTACTTTGAAAAAATGCACTAAAAGTTAACACATG 166820
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   167039 TCATGTCTTTAACATCAACGGCAAATTACTTTGAAAAAATGCACTAAAAGTTAACACATG 167098
2000-09-13
TEL03L
459459SubstitutionGC
770770InsertionC
783783InsertionC
838838InsertionAC
786786InsertionC
814814InsertionA
784784InsertionC
 Several sequence changes were made in the systematic sequence in the region encompassing TEL03L. Note that coordinates listed below are chromosomal coordinates.
Old:     421 CTCTCCATTACCCTACCTCTCCACTCGTTACCCTGTCTGATTCAACCGTACCACTCCCAA 480
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:     421 CTCTCCATTACCCTACCTCTCCACTCGTTACCCTGTCTCATTCAACCGTACCACTCCCAA 480
Old:     721 ATCGGTCATACGCACACGGATGCTACAGTATATACCATCTCAAACTTACC-TACTTTCAT 779
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:     721 ATCGGTCATACGCACACGGATGCTACAGTATATACCATCTCAAACTTACCCTACTTTCAT 780
Old:     780 ATTC-A-TC-ATCACCCATCTCTCACCATCAGTACCAA-TGCACTCGCATCATTATGCAC 835
             |||| | || |||||||||||||||||||||||||||| |||||||||||||||||||||
New:     781 ATTCCACTCCATCACCCATCTCTCACCATCAGTACCAAATGCACTCGCATCATTATGCAC 840
Old:     836 GGC--TTGCCTCAGCGGTCTATACCCTGTGCCATTTACGCATAACGCCCATCATTATCCA 893
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:     841 GGCACTTGCCTCAGCGGTCTATACCCTGTGCCATTTACGCATAACGCCCATCATTATCCA 900
2011-02-03YCL001W, YCL002C111718111718Insertion C
 A single nucleotide insertion was made in the intergenic region between ORFs YCL002C and YCL001W.
New  111661  AACAATAACAAGCATGTGAATGATTCAATATAATTGCTTCGCAGGGCTCCTCAACCTCTCCTCTGGAAAA  111730
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old  111660  AACAATAACAAGCATGTGAATGATTCAATATAATTGCTTCGCAGGGCTCCTCAACCTCT-CTCTGGAAAA  111728

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1997-07-27
YCL001W
112490112490DeletionC
112497112497DeletionC
112529112529DeletionT
112531112532DeletionCA
112872112872DeletionC
 Five deletions were made in Chromosome III in the region downstream of ORF YCL001W to correct the systematic reference sequence: The Cs at chromosomal coordinates 112490, 112497, and 112872 were deleted, as was the T at 112529, and the CA at 112531-2.
New:   112474 ACACGTTTATAATGTC-ATACTC-GTGGCGTGCATGTGTTTTAGTGTATTAGTTT-C--A 112528
              |||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |  |
Old:   112474 ACACGTTTATAATGTCCATACTCCGTGGCGTGCATGTGTTTTAGTGTATTAGTTTTCCAA 112533
New:   112829 GATGTAATAGAGAATTATCTGCGCTATATAGCTAGCAC-AGTGAACATCTATTTACTGCT 112887
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old:   112834 GATGTAATAGAGAATTATCTGCGCTATATAGCTAGCACCAGTGAACATCTATTTACTGCT 112893
1998-02-26
YCL001W
112074112074DeletionC
111924111924SubstitutionGC
111939111940SubstitutionAGGA
111950111950DeletionT
111956111956SubstitutionTG
111963111963DeletionT
111967111967DeletionT
111971111971DeletionT
111975111975DeletionT
111978111978DeletionT
111983111983DeletionT
111987111987DeletionT
112025112025DeletionG
 Thirteen separate sequence changes were made in the systematic sequence in the region encompassing ORF YCL001W. The G at chromosomal coordinate 111924 was changed to C, the AG at 111939 was changed to GA, the T at 111956 was changed to G, and the following single nucleotides were deleted: the Ts at 111950, 111963, 111967, 111971, 111975, 111978, 111983, and 111987, the G at 112025, and the C at 112074. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   111894 AGAGCCACTGTCATTTCCCTCTTGTTGTCGGTATTTTCAATCTTCAGT 111941
              |||||||||||||||||||||||||||||| ||||||||||||||  |
New:   111895 AGAGCCACTGTCATTTCCCTCTTGTTGTCGCTATTTTCAATCTTCGAT 111942
Old:   111942 ATTCCAGTTATTTTTGCCCATTCTTTATTTGATTGTTATTTTCATTATTATTGTTTTTTT 112001
              |||||||| ||||| |||||| ||| ||| ||| || |||| ||| ||||||||||||||
New:   111943 ATTCCAGT-ATTTTGGCCCAT-CTT-ATT-GAT-GT-ATTT-CAT-ATTATTGTTTTTTT 111994
Old:   112002 TAACTATGAGAAGGCAGATTCAAGCATATGATAAAATATAGATATATACCCTTAGATATC 112061
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   111995 TAACTATGAGAAGGCAGATTCAA-CATATGATAAAATATAGATATATACCCTTAGATATC 112053
Old:   112062 GGTAAGAAGAAACTATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTC 112121
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   112054 GGTAAGAAGAAA-TATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTC 112112
1997-07-27
YCL001W
111965111965InsertionT
111925111925SubstitutionCG
111940111941SubstitutionGAAG
111950111950InsertionT
111956111956SubstitutionGT
111962111962InsertionT
111968111968InsertionT
111971111971InsertionT
111973111973InsertionT
111977111977InsertionT
111980111980InsertionT
112017112017InsertionG
112065112065InsertionC
 Thirteen sequence changes were made in Chromosome III within the ORF YCL001W to correct the systematic reference sequence: The C at chromosomal coordinate 111925 was changed to G, the GA at 111940-1 was changed to AG, the G at 111956 was changed to T, a single G was inserted after the A at 112017, a single C was inserted after the A at 112065, and single Ts were inserted after chromosomal coordinates 111950, 111962, 111965, 111968, 111971, 111973, 111977, and 111980.
New:   111908 GTCATTTCCCTCTTGTTGTCGGTATTTTCAATCTTCAGTA 111947
              ||||||||||||||||||||| ||||||||||||||  ||
Old:   111904 GTCATTTCCCTCTTGTTGTCGCTATTTTCAATCTTCGATA 111943
New:   111948 TTCCAGTTATTTTTGCCCATTCTTTATTTGATTGTTATTTTCATTATTATTGTTTTTTTT 112007
              ||||||| ||||| |||||| ||| ||| ||| || |||| ||| |||||||||||||||
Old:   111944 TTCCAGT-ATTTTGGCCCAT-CTT-ATT-GAT-GT-ATTT-CAT-ATTATTGTTTTTTTT 111995
New:   112008 AACTATGAGAAGGCAGATTCAAGCATATGATAAAATATAGATATATACCCTTAGATATCG 112067
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old:   111996 AACTATGAGAAGGCAGATTCAA-CATATGATAAAATATAGATATATACCCTTAGATATCG 112054
New:   112068 GTAAGAAGAAACTATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTCA 112127
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:   112055 GTAAGAAGAAA-TATTCTCATTCTTCTAACTGATATACCCTGACTCCACATACCTATTCA 112113
1998-02-26
YCL001W, YCL002C
111841111842SubstitutionTTG
111859111859DeletionC
111893111893DeletionT
 Three separate sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL002C and YCL001W. The TT at chromosomal coordinate 111841 was changed to G, and the C at 111859 and the T at 111893 were removed. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   111822 GAAAAATCAGAAGAATTCCTTTCCATTCATCAGAAGACTTACCAGAGTTCAAATTCTGGT 111881
              |||||||||||||||||||  |||||||||||||||| ||||||||||||||||||||||
New:   111826 GAAAAATCAGAAGAATTCCG-TCCATTCATCAGAAGA-TTACCAGAGTTCAAATTCTGGT 111883
Old:   111882 ATAACAGCATTTAGAGCCACTGTCATTTCCCTCTTGTTGT 111921
              ||||||||||| ||||||||||||||||||||||||||||
New:   111884 ATAACAGCATT-AGAGCCACTGTCATTTCCCTCTTGTTGT 111922
1998-02-26
YCL001W
112498112498InsertionC
112504112504InsertionC
112535112535InsertionT
112536112536InsertionCA
112875112875InsertionC
 Five separate insertions were made in the systematic sequence in the region downstream of ORF YCL001W. Single C nucleotides were inserted after the Cs at chromosomal coordinates 112498, 112504, and 112875, a T was inserted after the T at 112535, and a CA was inserted after the C at 112536. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   112482 CACACGTTTATAATGTC-ATACTC-GTGGCGTGCATGTGTTTTAGTGTATTAGTTT-C-- 112536
              ||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
New:   112473 CACACGTTTATAATGTCCATACTCCGTGGCGTGCATGTGTTTTAGTGTATTAGTTTTCCA 112532
Old:   112837 TGATGTAATAGAGAATTATCTGCGCTATATAGCTAGCAC-AGTGAACATCTATTTACTGC 112895
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   112833 TGATGTAATAGAGAATTATCTGCGCTATATAGCTAGCACCAGTGAACATCTATTTACTGC 112892
2000-09-13YCL001W-A, YCL001W-B113232113232InsertionAG
 The systematic sequence was updated in the region between YCL001W-A and YCL001W-B. Note that coordinates listed are chromosomal coordinates.
Old:   113215 AGAAGGAGCAAATAAGCC--TTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113272
              ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
New:   113605 AGAAGGAGCAAATAAGCCAGTTTTAAGGAACCGAGATAAGCTGTTTTCGCCCATTGTTCT 113664
1998-02-26YCL002C111511111511DeletionT
 A single nucleotide deletion was made in the systematic sequence in the region encompassing ORF YCL002C. The T at chromosomal coordinate 111511 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   111462 TTTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAGTCAAGATGGAT 111521
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   111467 TTTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAG-CAAGATGGAT 111525
2000-09-13YCL002C111325111325DeletionC
 The systematic sequence was updated in the region encompassing feature YCL002C. Note that coordinates listed are chromosomal coordinates.
Old:   111295 TAATTGCTTCGCAGGGCTCCTCAACCTCTCCTCTGGAAAACCTTACCTCAATGAGGTTAA 111354
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   111686 TAATTGCTTCGCAGGGCTCCTCAACCTCTC-TCTGGAAAACCTTACCTCAATGAGGTTAA 111744
2011-02-03YCL002C110880110880Insertion A
 A single nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
New 110871  TATGACCAATAAGGTGACAAATTGTATCAATTTTACCCAAAAGGGCGTTGAATTAAATGGTATCTCGTAA 110940
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 110871  TATGACCAAT-AGGTGACAAATTGTATCAATTTTACCCAAAAGGGCGTTGAATTAAATGGTATCTCGTAA 110939

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1997-07-27YCL002C111515111515InsertionT
 A single sequence change was made in Chromosome III within the ORF YCL002C to correct the systematic reference sequence: A single T was inserted after chromosomal coordinate 111515.
New:   111468 TTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAGTCAAGATGGATT 111527
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old:   111468 TTGGGACTAAGTGTTACACGAAAGGCATAGAGTATCAAAAAAAGGAAG-CAAGATGGATT 111526
2000-09-13
YCL004W
109996109996DeletionC
109930109930DeletionC
110557110557DeletionA
110330110331SubstitutionGAAG
110286110286InsertionTCTAT
110100110100InsertionG
 The systematic sequence was updated in the region encompassing feature YCL004W. Note that coordinates listed are chromosomal coordinates.
Old:   109921 TGCTATTACCATTAAGAGAATGGCAAAGAGGCGTAGTAAATAAGCCGAATGGTTGGTCAT 109980
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   110309 TGCTATTAC-ATTAAGAGAATGGCAAAGAGGCGTAGTAAATAAGCCGAATGGTTGGTCAT 110367
Old:   109981 ATCACGCAAAAGGTACTTTGGCTTTCCGCTCGTGATAAAAATGATGCTAACAATTGGAAA 110040
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   110368 ATCACGCAAAAGGTA-TTTGGCTTTCCGCTCGTGATAAAAATGATGCTAACAATTGGAAA 110426
Old:   110101 -AATCGAATGCTCTCATTATTACAAGAGATGAAGAGCTAAGAAAAAAAATGAAAGCAGAG 110159
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   110487 GAATCGAATGCTCTCATTATTACAAGAGATGAAGAGCTAAGAAAAAAAATGAAAGCAGAG 110546
Old:   110280 ATTCTAT-----CATAGTATGTCGCCTGTAAATATGGAAAAATAAAAGAAAAAATGATAA 110334
              |||||||     |||||||||||||||||||||||||||||||||||||||||||  |||
New:   110667 ATTCTATTCTATCATAGTATGTCGCCTGTAAATATGGAAAAATAAAAGAAAAAATAGTAA 110726
Old:   110515 AGGGCGTTGAATTAAATGGTATCTCGTAAAACAATGCATTGGATCGGTATTACCAGTCTA 110574
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   110907 AGGGCGTTGAATTAAATGGTATCTCGTAAAACAATGCATTGG-TCGGTATTACCAGTCTA 110965
2000-09-13
YCL005W
108457108457SubstitutionGC
108385108385DeletionA
107780107780InsertionG
107769107769InsertionG
107767107767InsertionG
107739107739DeletionA
107745107745InsertionG
 The systematic sequence was updated in the region encompassing feature YCL005W, and at the same time the stop site for YCL005W was moved 6 nucleotides downstream, increasing the length of the coding region from 765 to 771 nt. Note that coordinates listed are chromosomal coordinates.
Old:   107705 GCCTTTATCAATTTTCGTATGGAATGGGTTTCAGACTTGTG-CATTGCCTATCAACATCC 107763
              |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||
New:   108091 GCCTTTATCAATTTTCGTATGGAATGGGTTTCAG-CTTGTGGCATTGCCTATCAACATCC 108149
Old:   107764 CATT-AG-TTGTTCCTGGG-ACGTCGCTGAGCCGTTTAGTTGCACAAACAAGCACATTAG 107820
              |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   108150 CATTGAGGTTGTTCCTGGGGACGTCGCTGAGCCGTTTAGTTGCACAAACAAGCACATTAG 108209
Old:   108361 TCGTTAATATAAAGATTTTACGAAAGGAATTCTAGGTGATATTGCAATTACTTCTTCTCA 108420
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   108750 TCGTTAATATAAAGATTTTACGAA-GGAATTCTAGGTGATATTGCAATTACTTCTTCTCA 108808
Old:   108421 TGCACTAACAAGTGAATGATAGAAATATGTTGAGTTGCTAACTGCCTGATTTTAAATAAG 108480
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   108809 TGCACTAACAAGTGAATGATAGAAATATGTTGAGTTCCTAACTGCCTGATTTTAAATAAG 108868
1997-07-27YCL005W108620108620SubstitutionCT
 A single nucleotide substitution was made in Chromosome III within the ORF YCL005W to correct the systematic reference sequence: The C at 108620 was changed to a T.
New:   108589 TAGCACATGGACACATTCACGCCCGAACACTTCTAAAAAGCAGCCCACACAAGAAAGTAG 108648
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old:   108589 TAGCACATGGACACATTCACGCCCGAACACTCCTAAAAAGCAGCCCACACAAGAAAGTAG 108648
1998-02-26YCL005W108615108615SubstitutionTC
 One single nucleotide substitution was made to the systematic sequence in the region encompassing ORF YCL005W. The T at chromosomal coordinate 108615 was changed to C. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   108583 GTAGCACATGGACACATTCACGCCCGAACACTTCTAAAAAGCAGCCCACACAAGAAAGTA 108642
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   108588 GTAGCACATGGACACATTCACGCCCGAACACTCCTAAAAAGCAGCCCACACAAGAAAGTA 108647
2000-09-13YCL008C, YCL009C105585105585InsertionT
 The systematic sequence was updated in the intergenic region between features YCL009C and YCL008C. Note that coordinates listed are chromosomal coordinates. This change is the exact reciprocal of the sequence change made on 1998-02-26.
Old:   105548 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGTT 105606
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   105932 GTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGTT 105991
2004-02-19YCL008C105970105970DeletionT
 Based on Brachat et al. 2003 and GenBank AY260880, the T at 105970 was deleted. This change resulted in a frameshift, moving the stop 267 bp downstream, and extending the protein from 296 aa to 385 aa.
Query:    918 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGGACGTCTATCTGTGCGT 860 
              ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| 
Sbjct: 105931 AGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGGACGTCTATCTGTGCGT 105990

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

1998-02-26YCL008C, YCL009C105580105580DeletionT
 One single nucleotide was deleted in Chromosome III in the intergenic region between ORFs YCL009C and YCL008C to correct the systematic sequence. The T at chromosomal coordinate 105580 was removed.
Old:   105525 CGTCATCCACATGCGAAGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGTTCAGG 105584
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   105531 CGTCATCCACATGCGAAGTTGAGCTAAACTGTTGGACTTTGGCCCTATTTGCGGT-CAGG 105589
1998-02-26
YCL008C
106429106429InsertionC
105937105938SubstitutionCCG
105981105981SubstitutionGC
106343106343InsertionC
106402106402DeletionA
 Several sequence changes were made to the systematic sequence in the region encompassing ORF YCL008C. The CC at chromosomal coordinate 105937 was changed to a G, the G at 105981 was changed to C, a C was inserted after the C at 106343, the A at 106402 was deleted, and a C was inserted after the T at 106429. Note that while the coordinates may appear to be different, the first four of these five changes are exact reciprocals of changes made on 1997-07-27, returning the systematic sequence to its original state in these areas. The insertion of the C after the T at 106429 is a novel change.
Old:   105885 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTCCCTCCTG 105944
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
New:   105890 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTG-CTCCTG 105948
Old:   105945 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGGGCCTGATCTTGTGGCGGCTCGTG 106004
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   105949 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGCGCCTGATCTTGTGGCGGCTCGTG 106008
Old:   106305 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTC-AGCAGCGCTAAAGAATCGTG 106363
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   106309 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTCCAGCAGCGCTAAAGAATCGTG 106368
Old:   106364 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGAACTTTGAACAGCCAATTGACCA 106423
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   106369 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGA-CTTTGAACAGCCAATTGACCA 106427
Old:   106424 CCGCCT-GGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTT 106482
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   106428 CCGCCTCGGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTT 106487
1997-07-27
YCL008C
105943105943SubstitutionGCC
105986105986SubstitutionCG
106349106349DeletionC
106407106407InsertionA
106435106435SubstitutionCG
 Three nucleotide substitutions, one single nucleotide deletion, and one single nucleotide insertion were made in Chromosome III within the ORF YCL008C to correct the systematic reference sequence: The G at 105943 was changed to CC, the Cs at 105986 and 106435 were changed to Gs, the C at 106349 was deleted, and an A was inserted after chromosomal coordinate 106407.
New:   105891 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTCCCTCCTG 105950
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
Old:   105891 GGCGGTTTTAGGTGTGGAGACTTGGGCTTTGGGGGCAGTGGGGGAGTATTCTG-CTCCTG 105949
New:   105951 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGGGCCTGATCTTGTGGCGGCTCGTG 106010
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old:   105950 CTGGAGCTGCGTATTGGGCTTAGGGGGTAGACTGGGCGCCTGATCTTGTGGCGGCTCGTG 106009

New:   106311 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTC-AGCAGCGCTAAAGAATCGTG 106369
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old:   106310 AAATACCCTTGTTCTTGGCCTTAAACTGTGAAAATTGTCCAGCAGCGCTAAAGAATCGTG 106369
New:   106370 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGAACTTTGAACAGCCAATTGACCA 106429
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old:   106370 GAAAGTTGTTCTTCCGTCGTTATAAATGGGTTGAATGA-CTTTGAACAGCCAATTGACCA 106428
New:   106430 CCGCCTGGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTTT 106489
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   106429 CCGCCTCGGAACAGAGATCTTGCCGTTTGCAGACATCGTTGCTCTTCACTCTCTCTCTTT 106488
1997-07-27YCL009C104260104260SubstitutionGC
 A single nucleotide substitution was made in Chromosome III within the ORF YCL009C to correct the systematic reference sequence: The G at 104260 was changed to a C.
New:   104205 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACCATTTCGCTGA 104264
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old:   104211 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACGATTTCGCTGA 104270 
2000-09-13YCL009C, YCL010C104419104419SubstitutionTC
 The systematic sequence was updated within ORF YCL009C. Note that coordinates listed are chromosomal coordinates.
Old:   104408 TTTGCAGACAATTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104467
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   104792 TTTGCAGACAACTCCACAATACAGCTTGTTTCGCTGATGTCGACGACACGACCTCCAAAG 104851
1997-07-27
YCL010C, YCL011C
103531103531DeletionC
103519103519DeletionT
103074103074InsertionT
103543103543DeletionG
 Four single nucleotide changes were made within the intergenic region between ORFs YCL011C and YCL010C to correct the systematic reference sequence: A T was inserted after chromosomal coordinate 103074, the T at chromosomal coordinate 103519 was removed, as was the C at 103531, and the G at 103543.
New:   103072 TTTTCAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103131
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   103072 TTT-CAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103130
New:   103492 TGTACCATCTGCTACGACTTTGAGTACT-CACACTGTATC-ATTCGCCGTCG-CACTGCC 103548
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
Old:   103491 TGTACCATCTGCTACGACTTTGAGTACTTCACACTGTATCCATTCGCCGTCGGCACTGCC 103550
1998-02-26
YCL010C, YCL011C
103515103515InsertionT
103071103071DeletionT
103526103526InsertionC
103537103537InsertionG
 Four single nucleotide changes were made in the systematic sequence in the intergenic region between ORFs YCL011C and YCL010C. A single T was deleted at chromosomal coordinate 103071, a single T was inserted after the T at chromosomal coordinate 103515, a C was inserted after the C at 103526, and a G was inserted after the G at 103537. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of some made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   103068 TTTTCAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103127
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   103072 TTT-CAATTTTTTTCACCTTCAAGTGAATACATCACTTCCGACGATACCAAAATAATGAC 103130
Old:   103488 TGTACCATCTGCTACGACTTTGAGTACT-CACACTGTATC-ATTCGCCGTCG-CACTGCC 103544
              |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||
New:   103491 TGTACCATCTGCTACGACTTTGAGTACTTCACACTGTATCCATTCGCCGTCGGCACTGCC 103550
1998-02-26YCL010C104254104254SubstitutionCG
 One single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL010C. The C at chromosomal coordinate 104254 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   104205 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACCATTTCGCTGA 104264
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   104211 GCAAGGCCGAGAGACTAACCTAACCAGGTGGTAGTTGGGAAATGTCGACGATTTCGCTGA 104270
2000-09-13
YCL011C
101542101542SubstitutionAT
101506101506InsertionT
101485101485InsertionA
 Several sequence changes were made in the systematic sequence in the region downstream of feature YCL011C. Note that coordinates listed are chromosomal coordinates.
Old:   101470 ATATTCAGTTTAGAAT-CCCTTTTTTTTTTTTTTTTTT-CTTCGCTTTTCGCATCTCATC 101527
              |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||
New:   101852 ATATTCAGTTTAGAATACCCTTTTTTTTTTTTTTTTTTTCTTCGCTTTTCGCATCTCATC 101911
Old:   101528 GCTGGAAGTGGTGCACTTTTACAGGGATTAAATAAGGTTATTCTTTTTGGTCAAAATGAT 101587
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   101912 GCTGGAAGTGGTGCTCTTTTACAGGGATTAAATAAGGTTATTCTTTTTGGTCAAAATGAT 101971
2004-02-20
YCL012C
101648101648InsertionA
101461101461InsertionT
101615101615InsertionG
101692101692InsertionA
 Four single nucleotide insertions were made in the region now spanning new feature YCL012C. This feature was independently predicted by Cliften et al. 2003 and Zhang & Dietrich 2003. The sequence changes were confirmed by Zhang and Dietrich (GenBank AY178910).
New:    352 GTTTTCCATAATTTGTTTAATCTCATTCTTGGAGACATCATCCAAACCACCTCTTACGTC 293 
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| 
Old: 101436 GTTTTCCATAATTTGTTTAATCTCAT-CTTGGAGACATCATCCAAACCACCTCTTACGTC 101494

New:    172 TGCACGAAATTTGTCGGCTATTACAGCTGTTAGTAATTTGATACGGTTTGCACTTTGCAT 113 
            | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| 
Old: 101615 T-CACGAAATTTGTCGGCTATTACAGCTGTTAGTA-TTTGATACGGTTTGCACTTTGCAT 101672 

New:    112 TTTCAAATGCTTAAATATACATACCAACTTTGGTTTTCCGGTGTGCCATAAGAAGGCATA 53 
            |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| 
Old: 101673 TTTCAAATGCTTAAATATAC-TACCAACTTTGGTTTTCCGGTGTGCCATAAGAAGGCATA 101731

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Zhang Z and Dietrich FS (2003) Verification of a new gene on Saccharomyces cerevisiae chromosome III. Yeast 20(8):731-8
SGD Papers Entry  Pubmed Entry  DOI full text  

2011-02-03
YCL012C
101655101655SubstitutionTA
101652101652SubstitutionAT
 Two single nucleotide substitutions were made within the intron of YCL012C.
New  101641  AGCTGTTAGTATTTAGATACGGTTTGCACTTTGCATTTTCAAATGCTTAAATATACATAC  101700
             ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||
Old  101641  AGCTGTTAGTAATTTGATACGGTTTGCACTTTGCATTTTCAAATGCTTAAATATACATAC  101700

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-09-13
YCL012W, YCL014W
100016100016DeletionC
9711897118SubstitutionCG
9990799907InsertionC
9675196751SubstitutionCA
 Several sequence changes were made in the systematic sequence in the region encompassing feature YCL014W, resulting in the merge of ORF YCL012W into YCL014W. Note that coordinates listed are chromosomal coordinates.
Old:   96731 CAATTTGGTAGAATTTTTGCCAAAATTCCTGATCGCCTTGAGAGTCAGAGTACTCAATGA 96790
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   97113 CAATTTGGTAGAATTTTTGCAAAAATTCCTGATCGCCTTGAGAGTCAGAGTACTCAATGA 97172
Old:   97091 ACCTCAGGAAAAACTACTGAAGCTAAACTTAATTATAGAGAGATTGTGGAAGTCGAAAAA 97150
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   97473 ACCTCAGGAAAAACTACTGAAGCTAAAGTTAATTATAGAGAGATTGTGGAAGTCGAAAAA 97532
Old:    99851 TGACAAATTCTTCGAAATTGAAGAAGAACTTAAGGAAGAATTGAAGGGCAGCAAAAC-GG 99909
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   100233 TGACAAATTCTTCGAAATTGAAGAAGAACTTAAGGAAGAATTGAAGGGCAGCAAAACCGG 100292
Old:    99970 AGCATTCAAAGTTATTAGAACATCGCCTGTGAGAATTATCGGAAGGCACTTTTGAAGACA 100029
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   100353 AGCATTCAAAGTTATTAGAACATCGCCTGTGAGAATTATCGGAAGG-ACTTTTGAAGACA 100411
1997-07-27
YCL014W
100475100475DeletionG
100478100478InsertionG
100539100539DeletionG
9884298842InsertionA
 Two single nucleotide deletions and two single nucleotide insertions were made within the ORF YCL014W to correct the systematic reference sequence: The G at chromosomal coordinate 100475 was removed, as was the G at 100539, a single A was inserted after chromosomal coordinate 98842, and a single G was inserted after chromosomal coordinate 100478.
New:   98814 GTGACAGAAAATACCAGTAACGAAAAAAAATGTCGAACCAAAAGCGGATCAATCCACAAA 98873
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old:   98814 GTGACAGAAAATACCAGTAACGAAAAAAA-TGTCGAACCAAAAGCGGATCAATCCACAAA 98872

New:   100434 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCA-AGTGAGCACAAAGCATG 100492
              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
Old:   100433 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCAGAGT-AGCACAAAGCATG 100491
New:   100493 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGG-TTTCCCCTAGCA 100551
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old:   100492 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGGGTTTCCCCTAGCA 100551
1998-02-26
YCL014W
9883998839DeletionA
100471100471InsertionG
100475100475DeletionG
100535100535InsertionG
 Four separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL014W. A single A was deleted at chromosomal coordinate 98839, as was the G at 100475, and a single G was inserted after the A at 100471, and also after the G at 100535. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   98810 GTGACAGAAAATACCAGTAACGAAAAAAAATGTCGAACCAAAAGCGGATCAATCCACAAA 98869
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   98814 GTGACAGAAAATACCAGTAACGAAAAAAA-TGTCGAACCAAAAGCGGATCAATCCACAAA 98872
Old:   100430 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCA-AGTGAGCACAAAGCATG 100488
              |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||
New:   100433 TCAAGAGTCTCCTAGTGGACCATTAATCTATGTTTTGCCTCAGAGT-AGCACAAAGCATG 100491
Old:   100489 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGG-TTTCCCCTAGCA 100547
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   100492 AGAAAGAGGGGTTCCTTCGAAAGAAACAAAAAGACGAGCCCATTTGGGTTTCCCCTAGCA 100551
2000-09-13YCL016C9520095200DeletionG
 A sequence change was made in the systematic sequence in the region encompassing feature YCL016C, and the start of YCL016C was moved 213 nt upstream, extending the protein N-terminally by 71 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   95171 AGAACTGTGTTTGAATGTTTGCGCTGCTTGCAGCACCCAAGTCTTGTCGTGCGAACACAG 95230
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   95554 AGAACTGTGTTTGAATGTTTGCGCTGCTT-CAGCACCCAAGTCTTGTCGTGCGAACACAG 95612
2000-09-13
YCL017C
9414394143DeletionA
9396493964InsertionC
9410494104DeletionC
9414094141SubstitutionATTA
9343893438SubstitutionAG
 A single nucleotide substitution was made in the systematic sequence within the ORF YCL017C. Several sequence changes were also made in the region upstream of YCL017C. Note that coordinates listed are chromosomal coordinates.
Within YCL017C
Old:   93432 CTACGTAAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93491
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   93816 CTACGTGAGCTCTAGCATTTTCCACAGCAGTATTTGTTTCCCAACCGTAAGAGTGAGTGT 93875
Upstream of YCL017C
Old:   93912 TATGCGATATATTTTAATGAAAATGATGTATCTGAAATAGAAAATATAACACA-TAATGA 93970
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   94296 TATGCGATATATTTTAATGAAAATGATGTATCTGAAATAGAAAATATAACACACTAATGA 94355
Old:   94091 GGTAATAGGGTGCCATAATAGTATTGTAATATATATAAATATATAAAGCATCATATGATA 94150
             ||||||||||||| |||||||||||||||||||||||||||||||||||  | |||||||
New:   94476 GGTAATAGGGTGC-ATAATAGTATTGTAATATATATAAATATATAAAGCTAC-TATGATA 94533
2000-09-13
YCL018W
9198591985SubstitutionGC
9110691106SubstitutionCT
9114491144SubstitutionTC
 Three single nucleotide sequence changes were made in the systematic sequence within ORF YCL018W. Note that coordinates listed are chromosomal coordinates.
Old:   91092 GATGCTACAGGTGTCCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGTTGATGCC 91151
             |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||
New:   91476 GATGCTACAGGTGTTCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCC 91535
Old:   91932 GTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACGGAAGTC 91991
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   92316 GTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACCGAAGTC 92375
2000-09-13
YCL019W
8944289442InsertionC
8715987161DeletionCGC
8945289452DeletionC
8972789727SubstitutionGA
8659886599SubstitutionATTA
 Several sequence changes were made in the systematic sequence in the region encompassing feature YCL019W. Note that coordinates listed are chromosomal coordinates.
Old:   86593 AACGCATGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 86652
             |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   86980 AACGCTAGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAAACATAGACAT 87039
Old:   87133 GTCTCACCAAAAAACGATAAATCCGCCGCAAGACAACATGCAGGTTTAGCTGGACTGGAC 87192
             ||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||
New:   87520 GTCTCACCAAAAAACGATAAATCCGC---AAGACAACATGCAGGTTTAGCTGGACTGGAC 87576
Old:   89413 AGATTTGACTTACTATACTACATCAACACA-TTGCTCAACCATATACTATTCCCCTCTAG 89471
             |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||
New:   89797 AGATTTGACTTACTATACTACATCAACACACTTGCTCAAC-ATATACTATTCCCCTCTAG 89855
Old:   89712 AGCAGAAATACACGCGGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 89771
             ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   90096 AGCAGAAATACACGCAGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTCACCTTGT 90155
2000-09-13
YCL019W, YCL020W
8631686316SubstitutionAT
8609286093SubstitutionCGGC
8523585235SubstitutionTA
 Several sequence changes were made in the systematic sequence in the region encompassing overlapping features YCL019W and YCL020W. Note that coordinates listed are chromosomal coordinates.
Old:   85213 CACCACACACTTTAACATCAGATGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85272
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
New:   85600 CACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGGGTTAAATTTTACATCAGAT 85659
Old:   86053 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGACGTTCGCAAACGCTTGTCAGA 86112
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
New:   86440 AATGACGAACTACCTGATCACCTTCTTATTGATTCAGGAGCTTCGCAAACGCTTGTCAGA 86499
Old:   86293 GAGCTGGCTAATCAAAATATTACAGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86352
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   86680 GAGCTGGCTAATCAAAATATTACTGCCTGCTTTACCAGAAACACTTTAGAAAGATCGGAT 86739
1998-02-26
YCL022C, YCL024W
8152781527DeletionC
8174681746DeletionC
 Two separate single nucleotide deletions were made in the systematic sequence in the region encompassing overlapping ORFs YCL024W and YCL022C. A single C was deleted at chromosomal coordinate 81527, and another C was deleted at 81746. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   81470 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCCCTC 81529
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   81476 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCC-TC 81534
Old:   81710 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACACTAGAGGATGGGGCGGAAAAAGGG 81769
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   81715 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACA-TAGAGGATGGGGCGGAAAAAGGG 81773
2000-09-13YCL022C, YCL024W8186181861InsertionC
 One sequence change was made in the systematic sequence in the region encompassing overlapping features YCL024W and YCL022C. Note that coordinates listed are chromosomal coordinates.
Old:   81841 ATAACGACACAGTGAATGCCC-TACTACAGTAAAAAAGCCACCTAACAGCGTACTCTT 81897
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   81877 ATAACGACACAGTGAATGCCCCTACTACAGTAAAAAAGCCACCTAACAGCGTACTCTT 81934
1997-07-27
YCL022C, YCL024W
8153281532InsertionC
8175081750InsertionC
 Two single nucleotide insertions were made within the ORF YCL024W to correct the systematic reference sequence: A C was inserted after chromosomal coordinate 81532, and also after 81750. Note that the change at 81750 is also within overlapping ORF YCL022C.
New:   81476 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCCCTC 81535
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old:   81476 GGATGATAGTAAGGATGGTGATAATGTGAATAATGATAATATATTGAGCGACTTTCC-TC 81534

New:   81715 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACACTAGAGGATGGGGCGGAAAAAGGG 81774
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old:   81715 GCCTTACAAGTAATAACAGCAGCGTCGGAGAAAACA-TAGAGGATGGGGCGGAAAAAGGG 81773
2000-09-13
YCL023C, YCL025C
7840278402InsertionCC
7840078400SubstitutionCG
7802778027InsertionA
7803578035InsertionA
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCL025C and YCL023C. Note that coordinates listed are chromosomal coordinates.
Old:   78005 AACAAATGAGTATTACGAGGAAA-TAACAAAA-GAAACTAATCACGAAGGATATGAGTCT 78062
             ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||
New:   78037 AACAAATGAGTATTACGAGGAAAATAACAAAAAGAAACTAATCACGAAGGATATGAGTCT 78096
Old:   78363 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCACTG--GCTTAGACGGCACCCTCA 78420
             ||||||||||||||||||||||||||||||||||||| ||  ||||||||||||||||||
New:   78397 CATCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCAGTGCCGCTTAGACGGCACCCTCA 78456
2000-09-13
YCL025C
7616576165SubstitutionTA
7747277472SubstitutionGA
7732077320InsertionG
7729777297DeletionA
7694076940SubstitutionAG
 Five sequence changes were made in the systematic sequence in the region encompassing ORF YCL025C. Note that coordinates listed are chromosomal coordinates.
Old:   76146 AGACCTTGTAGCCGACATATAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76205
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   76178 AGACCTTGTAGCCGACATAAAGTGCAATCAAGATTGGCATAGCCAAGTAGTTTTCGAAAA 76237
Old:   76926 TCACTAATGTTGCAACAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 76985
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   76958 TCACTAATGTTGCAGCAACACCTTTAAATCTGTCAATGGCATGTTTACCATTGAAAGCGC 77017
Old:   77286 CAAACCCAAAAACCATCATCCACAAGGAAACTGGG-TATGCATTGTAGCCACCAGTCAAG 77344
             ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
New:   77318 CAAACCCAAAA-CCATCATCCACAAGGAAACTGGGGTATGCATTGTAGCCACCAGTCAAG 77376
Old:   77465 CCGACCAGTAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77524
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   77497 CCGACCAATAACCCAGTACCGATACCCGTACCCAACGCAATCATCAGAACATGTCTAGGC 77556
2006-01-12YCL025C7614776147InsertionG
 SGD confirmed the sequence error predicted by the work of Brachat et al and Schreve et al., and has updated the systematic sequence accordingly. As a consequence of this sequence change, AGP1/YCL025C was extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 595 to 633 amino acids
New: 76137 CGATCTTGTCTGCCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76180
           ||||||||||| ||||||||||||||||||||||||||||||||
Old: 76137 CGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCCAG 76179

Schreve JL, et al. (1998) The Saccharomyces cerevisiae YCC5 (YCL025c) gene encodes an amino acid permease, Agp1, which transports asparagine and glutamine. J Bacteriol 180(9):2556-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2000-09-13
YCL025C, YCL026C-A
7611476115SubstitutionGGT
7598675986InsertionT
7583175831SubstitutionTC
7551475514SubstitutionAG
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCL026C-A and YCL025C. Note that coordinates listed are chromosomal coordinates.
Old:   75487 AATTGAAAAATTATTCGGAAGAGCATTAACAAATATTGATTAATAATCAAGTAACACTCG 75546
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   75519 AATTGAAAAATTATTCGGAAGAGCATTGACAAATATTGATTAATAATCAAGTAACACTCG 75578
Old:   75787 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCATTTCCATCACGCAATC 75846
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
New:   75819 TTTTTCTCTCACTTCATATTATTTCACTTATATTTTCCTCTCCACTTCCATCACGCAATC 75878
Old:   75967 GAAGTAAATGCTTTTTTTTT-AACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76025
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   75999 GAAGTAAATGCTTTTTTTTTTAACACCAGAAGGCAACGACCCTTTTCCAATAAGGTCCGT 76058
Old:   76086 GTCTATGAGAATCTAGGTCGATCTTGTCGGCCCTGATGAACAGTTTCCAATCCTTGTGCC 76145
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
New:   76119 GTCTATGAGAATCTAGGTCGATCTTGTCT-CCCTGATGAACAGTTTCCAATCCTTGTGCC 76177
2000-09-13
YCL026C-A
7481374813InsertionC
7494374943InsertionT
7493574935InsertionT
 Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL026C-A. Note that coordinates listed are chromosomal coordinates.
Old:   74890 GAGCGGCGCATGTTGGGAAAGCGG-TGCCAAGGCTGGAAAATCTCTT-GCAGTTTT-CAG 74946
             |||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||
New:   74919 GAGCGGCGCATGTTGGGAAAGCGGCTGCCAAGGCTGGAAAATCTCTTTGCAGTTTTTCAG 74978
2000-09-13
YCL027W, YCL028W
7172971729InsertionT
7160871608SubstitutionAT
7140871408InsertionT
 Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL028W and YCL027W. Note that coordinates listed are chromosomal coordinates.
Old:   71368 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTT-ATT 71411
             ||||||||||||||||||||||||||||||||||||||||| |||
New:   71396 TTGTTTACGTATTTGTTTATATATATAACTTTATTTTTTTTTATT 71439
Old:   71592 ACAAACATGAAACGTCAGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71651
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   71620 ACAAACATGAAACGTCTGTAATTTGAAACAAATAACGTAATTCTCGGGATTGGTTTTATT 71679
Old:   71712 GACATCCTTTATCTTTTT-CCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71770
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   71740 GACATCCTTTATCTTTTTTCCTTTAAGAGCAGGATATAAGCCATCAAGTTTCTGAAAATC 71799
2000-09-13
YCL027W
7306673066SubstitutionAG
7320473204SubstitutionGA
7321873218SubstitutionGA
7322673226SubstitutionAT
7275772757SubstitutionCT
7216172161SubstitutionCT
 Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL027W. Note that coordinates listed are chromosomal coordinates.
Old:   72131 CGCCGCACTAATTGGTTCTCACGGTTATTTCGGCAGAGTAAGTGTGAGGATCAGAATTCA 72190
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   72160 CGCCGCACTAATTGGTTCTCACGGTTATTTTGGCAGAGTAAGTGTGAGGATCAGAATTCA 72219
Old:   72731 AACACGCCTCTGGATGCAAATGACAGCGTGAATAACTTGGGTAATACCACGCCAGATTCA 72790
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   72760 AACACGCCTCTGGATGCAAATGACAGTGTGAATAACTTGGGTAATACCACGCCAGATTCA 72819
Old:   73031 CCATTGCCGCTTACTCCAAACTCCAAATATAATGGAGAGGCTAGCGTCCAATTAGGGAAG 73090
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:   73060 CCATTGCCGCTTACTCCAAACTCCAAATATAATGGGGAGGCTAGCGTCCAATTAGGGAAG 73119
Old:   73151 GGTGAAAAAGTTAAAATTCTGGCCACTCATACCGATGGATGGTGTCTGGTAGAGAAGTGT 73210
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   73180 GGTGAAAAAGTTAAAATTCTGGCCACTCATACCGATGGATGGTGTCTGGTAGAAAAGTGT 73239	
Old:   73211 AATACACGAAAGGGTACTATTCACGTCAGTGTTGACGATAAAAGATACCTCAATGAAGAT 73270
             ||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   73240 AATACACAAAAGGGTTCTATTCACGTCAGTGTTGACGATAAAAGATACCTCAATGAAGAT 73299
2000-09-13
YCL028W
7120171201SubstitutionCG
7080870808SubstitutionTC
7121971219SubstitutionTC
7128271282SubstitutionTC
7136671366DeletionC
7121371213SubstitutionAG
7075770757SubstitutionTC
7074270742SubstitutionAG
7119571195SubstitutionAG
7105171051SubstitutionCT
 Several sequence changes were made in the systematic sequence in the region encompassing ORF YCL028W. Note that coordinates listed are chromosomal coordinates.
Old:   70693 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTAGCTTCTATGG 70752
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   70721 ATCAGCAAGGTCAAAATCAAAGCTCCGGTGGTTCCTCCTTTGGAGCACTGGCTTCTATGG 70780
Old:   70753 CAAGTTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGTTATA 70812
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   70781 CAAGCTCTTTTATGCATTCCAATAATAATCAGAACTCCAACAATAGTCAACAGGGCTATA 70840
Old:   70993 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCACC 71052
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   71021 ATCAACAAGGCCAAAACAACCAGCAGCAATACCAGCAACAAGGCCAAAACTATCAGCATC 71080
Old:   71173 AGGCTAATGAGTATGGTAGACCACAACACAATGGTCAACAACAATCTAATGAGTACGGAA 71232
             |||||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||
New:   71201 AGGCTAATGAGTATGGTAGACCGCAACAGAATGGTCAACAGCAATCCAATGAGTACGGAA 71260
Old:   71233 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTTAATTTTTCTG 71292
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   71261 GACCGCAATACGGCGGAAACCAGAACTCCAATGGACAGCACGAATCCTTCAATTTTTCTG 71320
Old:   71353 TCGCCTTCTATCCCTTTGTTTACGTATTTGTTTATATATATAACTTTAT 71401
             ||||||||||||| |||||||||||||||||||||||||||||||||||
New:   71381 TCGCCTTCTATCC-TTTGTTTACGTATTTGTTTATATATATAACTTTAT 71428
2000-09-13
YCL029C
6971769717SubstitutionTC
6969069690SubstitutionGA
6962469624SubstitutionCT
 Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL029C. Note that coordinates listed are chromosomal coordinates.
Old:   69613 AGCGGTTCCATCGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69672
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   69641 AGCGGTTCCATTGTCGTTCTTCTCGAGGTTTGCGATATCGATGCCTTCTCGATCAATGAT 69700
Old:   69673 GCGACTTTTTGCAACTGGATAAATAGTCCACTTTGAGGATACTCTGTTTGAAAATACTTC 69732
             ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||
New:   69701 GCGACTTTTTGCAACTGAATAAATAGTCCACTTTGAGGATACTCCGTTTGAAAATACTTC 69760
2000-09-13YCL030C6718167181SubstitutionCG
 One sequence change was made in the systematic sequence in the region encompassing ORF YCL030C, resulting in one amino acid substitution. Note that coordinates listed are chromosomal coordinates.
Old:   67153 TAATTTCAGAAGTCTTTTGGATTGGTCTCCTCAAAGCCTTCTGCACACCAACTTTGTCGG 67212
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   67181 TAATTTCAGAAGTCTTTTGGATTGGTCTGCTCAAAGCCTTCTGCACACCAACTTTGTCGG 67240
1997-07-27
YCL034W
6214162141DeletionG
6213862138DeletionG
 Two single nucleotide deletions were made within the ORF YCL034W to correct the systematic reference sequence: the G at chromosomal coordinate 62138 and the G at 62141 were removed.
New:   62096 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCG-CG-AGGCTCTGGCGGAC 62153
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
Old:   62096 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCGGCGGAGGCTCTGGCGGAC 62155
1998-02-26
YCL034W
6213362133InsertionG
6213562135InsertionG
 Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL034W. A single G nucleotide was inserted after the G at chromosomal coordinate 62133, and another G was inserted after the G at 62135. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   62092 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCG-CG-AGGCTCTGGCGGAC 62149
             |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
New:   62096 TCAAACAGAGGTACTCGAAGAGCAGCCGTTCCCGCCGTAGCGGCGGAGGCTCTGGCGGAC 62155
2000-09-13YCL034W6178961789InsertionG
 A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCL034W, extending the predicted protein sequence N-terminally by 89 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   61754 CACAACGATTATAACTATACCGTGAACCAAGAAGAA-CTGCGCGAGCACTTAGAAAGAAA 61812
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   61781 CACAACGATTATAACTATACCGTGAACCAAGAAGAAGCTGCGCGAGCACTTAGAAAGAAA 61840
2000-09-13
YCL037C, YCL038C
5661256612InsertionA
5704357043DeletionA
5721157211InsertionA
 Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL038C and YCL037C. Note that coordinates listed are chromosomal coordinates.
Old:   56596 ACACTACGCATCTTTCA-TAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56654
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   56622 ACACTACGCATCTTTCAATAGCTGAGGTATTTTCGTTTAGGAAAATACCGTTTTAAGGAA 56681
Old:   57015 TATTTTTATATCTTAAAAAAAAAAAAAAAACAAAAAAAAAAAAACATAAATATTTGTATC 57074
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   57042 TATTTTTATATCTTAAAAAAAAAAAAAAA-CAAAAAAAAAAAAACATAAATATTTGTATC 57100
Old:   57195 CAAAAAAAAAAAAAAAA-CAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57253
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   57221 CAAAAAAAAAAAAAAAAACAAAAAAAAAACAGCTTTGCTGGAGGATGATTAACTTTTAAT 57280
1997-07-27
YCL039W, YCL040W
5253752537SubstitutionCT
5256452566SubstitutionTGGCC
5256952569SubstitutionGC
5258352583SubstitutionAG
5258652587SubstitutionCTGC
5259752597DeletionG
 Several changes were made within the intergenic region between ORFs YCL040W and YCL039W to correct the systematic reference sequence:
New:   52494 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGTCTTGCTAGGTCTTCCTTT 52553
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old:   52496 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGCCTTGCTAGGTCTTCCTTT 52555
New:   52554 ATCATTTTCC-AACTCAAATATGAAAAGCAGCTCCAAGGGG-CGTACTACTTCAACTAAT 52611
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
Old:   52556 ATCATTTTTGGAAGTCAAATATGAAAAACACTTCCAAGGGGGCGTACTACTTCAACTAAT 52615
1998-02-26
YCL039W, YCL040W
5259352593InsertionG
5243552435SubstitutionTC
5256252563SubstitutionCCTGG
5256652566SubstitutionCG
5258052580SubstitutionGA
5258352584SubstitutionGCCT
 Five separate substitutions and one single nucleotide insertion were made in the systematic sequence in the intergenic region between ORFs YCL040W and YCL039W. The T at chromosomal coordinate 52435 was changed to C, the CC at 52562 was changed to TGG, the C at 52566 was changed to G, the G at 52580 was changed to A, the GC at 52583 was changed to CT, and a G was inserted after the G at 52593. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   52494 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGTCTTGCTAGGTCTTCCTTT 52553
             ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
New:   52496 CGGGCCTTTGGTTTTTAAGGGAAAATGAAGAACAATAAATGCCTTGCTAGGTCTTCCTTT 52555
Old:   52554 ATCATTTTCC-AACTCAAATATGAAAAGCAGCTCCAAGGGG-CGTACTACTTCAACTAAT 52611
             ||||||||   || ||||||||||||| ||  ||||||||| ||||||||||||||||||
New:   52556 ATCATTTTTGGAAGTCAAATATGAAAAACACTTCCAAGGGGGCGTACTACTTCAACTAAT 52615
2000-09-13
YCL042W
5063550635InsertionC
5070250702SubstitutionGC
5070050700SubstitutionGC
5065750657InsertionGG
 One single nucleotide insertion, one dinucleotide insertion, and two single nucleotide substitutions were made in the systematic sequence within ORF YCL042W, resulting in several amino acid changes in the predicted protein sequence, and increasing the size of the coding sequence from 357 nucleotides to 360 nt. Note that coordinates listed are chromosomal coordinates.
Old:   50610 GTGGTGTGCCGACGGACGGTCAACCC-TTTCAGGGGGCCCCCTATCTTG 50657
             |||||||||||||||||||||||||| ||||||||||||||||||||||
New:   50633 GTGGTGTGCCGACGGACGGTCAACCCCTTTCAGGGGGCCCCCTATCTTG 50681
Old:   50658 --CGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAAGGGGCCCATATAAATA 50715
               |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||
New:   50682 GGCGTGGTGTCACACCACGCTCAAACGGTGGGCACTAATGAAAACGCGCCCATATAAATA 50741
2000-09-13
YCL049C
4012140121SubstitutionTC
4008640086SubstitutionAC
4006640066SubstitutionAG
3998539985SubstitutionAG
4017440174SubstitutionAT
3994439944SubstitutionGA
 Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL049C, resulting in 4 amino acid substitutions in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
Old:   39930 GAACCTCATTTTCCGACATTTTGGTCATGTAAGAGGCGACAGGCTCATCGCAGGTAGGTG 39989
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||
New:   39953 GAACCTCATTTTCCAACATTTTGGTCATGTAAGAGGCGACAGGCTCATCGCAGGTGGGTG 40012
Old:   40050 TACAATATTGTCTTTGAACGTTTGCCCAAACCATATATTTTGAATACCAAAGCTGGACCA 40109
             |||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||
New:   40073 TACAATATTGTCTTTGGACGTTTGCCCAAACCATATCTTTTGAATACCAAAGCTGGACCA 40132
Old:   40110 CATTGTATGGCTTAATCATTGGTGCTACCATAATACTGGATTGGGAAACAGTCTGGTTAA 40169
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   40133 CATTGTATGGCCTAATCATTGGTGCTACCATAATACTGGATTGGGAAACAGTCTGGTTAA 40192
Old:   40170 TTTTATTCAACCAATTTTTCTTATCTAGCAATGATTTAATAAACCTGAAATCTAAATTGT 40229
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   40193 TTTTTTTCAACCAATTTTTCTTATCTAGCAATGATTTAATAAACCTGAAATCTAAATTGT 40252
2000-09-13
YCL050C
3799837998SubstitutionAG
3815438154SubstitutionGA
3829438294SubstitutionAG
3864038640SubstitutionGA
3879038790SubstitutionGT
3847938479SubstitutionCT
 Six separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL050C. Note that coordinates listed are chromosomal coordinates.
Old:   37950 ACCTGTGGAGTTGAAACCTATCTTCATTTCATCAGAAAAGGCCTTCGAACGTGGAACGAC 38009
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   37974 ACCTGTGGAGTTGAAACCTATCTTCATTTCATCAGAAAAGGCCTTCGAGCGTGGAACGAC 38033
Old:   38130 TAGGTCTTCATCAACAGTTTCTTCGGACTCCGGCATTGGCAAGACAAAATGAGCGAACGA 38189
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   38154 TAGGTCTTCATCAACAGTTTCTTCAGACTCCGGCATTGGCAAGACAAAATGAGCGAACGA 38213
Old:   38250 ACATAGTCTATCTTGGAAAGTGACGAACTTTTCAGGCATTTGCAAAATTTGCAAATGTTT 38309
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
New:   38274 ACATAGTCTATCTTGGAAAGTGACGAACTTTTCAGGCATTTGCAGAATTTGCAAATGTTT 38333
Old:   38430 CAAGGCATCAGTTTGATGTTGGTATTCGTTAGTTACCAATAAAGTGTGTCCAGGGATTAC 38489
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   38454 CAAGGCATCAGTTTGATGTTGGTATTCGTTAGTTACCAATAAAGTGTGTTCAGGGATTAC 38513
Old:   38610 CTCTGGCTTTTCGATCAGACTTGGCATGTGGCTAATCAAGTATGGCATGCTGGTTTTTGG 38669
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   38634 CTCTGGCTTTTCGATCAGACTTGGCATGTGACTAATCAAGTATGGCATGCTGGTTTTTGG 38693
Old:   38790 GTTTACTTTTCTGTTTGTTCTAAAATCTATCTAAACTGGCTTTCAAGATCAATCTATTGT 38849
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   38814 TTTTACTTTTCTGTTTGTTCTAAAATCTATCTAAACTGGCTTTCAAGATCAATCTATTGT 38873
2000-09-13
YCL050C, YCL051W
3770537705SubstitutionTC
3763837638SubstitutionGA
3777237773DeletionTA
 Three sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL051W and YCL050C. The G at 37638 was changed to A, the T at 37705 was changed to C, and the TA dinucleotide at 37772-3 was deleted. Note that coordinates listed are chromosomal coordinates.
Old:   37602 TAATAATAAGTAATAAAAAGGTGAATCGTAACCTTAGCGGCATTGATTGCATGTAGT 37658
             |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   37628 TAATAATAAGTAATAAAAAGGTGAATCGTAACCTTAACGGCATTGATTGCATGTAGT 37684
Old:   37659 TTTAATAATAAAGTGTAGAATAATAAATATAAAATTTCAAAGTCATTAGAAATAAAAA 37716
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   37685 TTTAATAATAAAGTGTAGAATAATAAATATAAAATTTCAAAGTCATCAGAAATAAAAA 37742
Old:   37770 TATACATACATGTATACGTGTATACTTGTACTTGTGAAGGACTCAATAGTTGTATTCGTT 37829
             ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   37796 TA--CATACATGTATACGTGTATACTTGTACTTGTGAAGGACTCAATAGTTGTATTCGTT 37853
2000-09-13
YCL051W, YCL052C
3556835568InsertionA
3557035570InsertionT
3557735577InsertionT
3550635506InsertionA
 Four single nucleotide insertions were made in the systematic sequence in the intergenic region between ORFs YCL052C and YCL051W. Note that coordinates listed are chromosomal coordinates.
Old:   35450 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAA-TA 35508
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   35467 TGATCTTTTTTATCAGGGGGATCTTCAAAGAAAGGAACTTTTTTTAGGAAAAAAAAAATA 35526
Old:   35569 -GT-CTGCTGT-AGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35625
              || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   35587 AGTTCTGCTGTTAGTGTGTCCTCCAATACTCTTGCACGACAAAGTTTTAGTTATCCCCTT 35646
2000-09-13
YCL051W
3757937579InsertionTT
3755337553InsertionC
3755137551InsertionA
3754737547InsertionA
3750437504SubstitutionGA
3746337463SubstitutionTC
3737437374SubstitutionAG
 Several sequence changes were made in the systematic sequence within ORF YCL051W, resulting in a number of amino acid changes in the predicted protein sequence. In addition, the stop site was moved upstream 9 nucleotides, shortening the coding sequence from 1761 nt to 1752 nt. Note that coordinates listed are chromosomal coordinates.
Old:   37366 TTGTCAACACGCAGAGAAAAGCCTCAAATGAAACTGGTGACTTAGTCTTTAGTTTATCCC 37425
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:   37387 TTGTCAACGCGCAGAGAAAAGCCTCAAATGAAACTGGTGACTTAGTCTTTAGTTTATCCC 37446
Old:   37426 AGGATGATGACGCACTGAAAACGTTCCATGCGAGCAATAGCGCAGCAACAAGCAATGAAA 37485
             ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
New:   37447 AGGATGATGACGCACTGAAAACGTTCCATGCGAGCAACAGCGCAGCAACAAGCAATGAAA 37506
Old:   37486 GCTGGTGTATTAGCGATGGTGCGTTAGGAAAGCAGGCGCAGGACAGTGAAGTTAGGAGGA 37545
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   37507 GCTGGTGTATTAGCGATGATGCGTTAGGAAAGCAGGCGCAGGACAGTGAAGTTAGGAGGA 37566
Old:   37546 AA-GAAA-TC-AAATTAGGACTCTTTAGACATATTTT--CAAGGAAGTAATACAACAATAT 37601
             || |||| || ||||||||||||||||||||||||||  ||||||||||||||||||||||
New:   37567 AAAGAAAATCCAAATTAGGACTCTTTAGACATATTTTTTCAAGGAAGTAATACAACAATAT 37627
1998-02-26
YCL054W
3366533665InsertionG
3360433604InsertionA
3368733687InsertionA
 Three separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL054W. A single A was inserted after the A at chromosomal coordinate 33604, a single G was inserted after the T at 33665, and an A was inserted after the A at 33687. Note that while some coordinates may appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   33597 AAGAAAAA-TAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:   33596 AAGAAAAAATAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
Old:   33656 GAAAGAGGAT-CGTGCCGTAGCTCGGTTAGAAA-GATCAAGAAGAAGGCGGGCTTGATTA 33713
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
New:   33656 GAAAGAGGATGCGTGCCGTAGCTCGGTTAGAAAAGATCAAGAAGAAGGCGGGCTTGATTA 33715
1997-07-27
YCL054W
3366633666DeletionG
3368933689DeletionA
3360433604DeletionA
 Three single nucleotide deletions were made within the ORF YCL054W to correct the systematic reference sequence: The A at chromosomal coordinate 33604 was removed, as was the G at 33666, and the A at 33689.
New:   33597 AAGAAAAA-TAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   33596 AAGAAAAAATAAAGGCAATGAACGCCCGTCCTATTAAGAAGGTTGCTGAAGCTAAGGCAA 33655
New:   33656 GAAAGAGGAT-CGTGCCGTAGCTCGGTTAGAAA-GATCAAGAAGAAGGCGGGCTTGATTA 33713
             |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||
Old:   33656 GAAAGAGGATGCGTGCCGTAGCTCGGTTAGAAAAGATCAAGAAGAAGGCGGGCTTGATTA 33715
1998-02-26
YCL061C
2156221562InsertionC
2032620326DeletionT
1950719507DeletionG
1950019500DeletionG
1949419494DeletionG
1944319443InsertionT
2042120421DeletionT
 Seven separate single nucleotide sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. A single T was inserted after the G at chromosomal coordinate 19443, single G nucleotides were deleted at 19494, 19500, and 19507, single T nucleotides were deleted at 20326 and 20421, and a C was inserted after the C at 21562. Note that while some coordinates appear to be slightly different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   19439 CTGAG-ATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAGGCCC 19497
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   19441 CTGAGTATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAG-CCC 19499
Old:   19498 CGGAAGGGGGTTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   19500 CG-AAGGGG-TTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557
Old:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAATTAATTTCATCAT 20337
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAAT-AATTTCATCAT 20336
Old:   20398 CGGCAATTTCATTACCACTCAATTGCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20457
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   20397 CGGCAATTTCATTACCACTCAAT-GCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20455
Old:   21538 CTGCTATCTATACGCTGTGTAGCCC-TGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21596
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:   21536 CTGCTATCTATACGCTGTGTAGCCCCTGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21595
2000-09-13
YCL061C
2191121911InsertionT
2192321923SubstitutionTG
2180121801DeletionC
 Three sequence changes were made in the systematic sequence in the region encompassing ORF YCL061C. The C at 21801 was deleted, a T was inserted after the T at 21911, and the T at 21923 was changed to G, resulting in the N-terminal extension of the predicted protein sequence by 243 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   21771 CGGATTTCTCCAGCTCTTCACCACCATCGTCAAAGATTAGAGATTAATTGAGTTGGTAAC 21830
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   21788 CGGATTTCTCCAGCTCTTCACCACCATCGT-AAAGATTAGAGATTAATTGAGTTGGTAAC 21846
Old:   21891 AATCTGTTCTTAACACGATT-AATGTGGCATTTGCAAATAAAAACCCGTTCCCAGTCAAC 21949
             |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||
New:   21907 AATCTGTTCTTAACACGATTTAATGTGGCATTGGCAAATAAAAACCCGTTCCCAGTCAAC 21966
1997-07-27
YCL061C
2156121561DeletionC
2041920419InsertionT
2032520325InsertionT
1950719507InsertionG
1950119501InsertionG
1949619496InsertionG
1944619446DeletionT
 Two single nucleotide deletions and five single nucleotide insertions were made within the ORF YCL061C to correct the systematic reference sequence: The T at chromosomal coordinate 19446 was removed, as was the C at 21561, single Gs were inserted after chromosomal coordinates 19496, 19501, and 19507, and single Ts were inserted after chromosomal coordinates 20325 and 20419.
New:   19439 CTGAG-ATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAGGCCC 19497
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||
Old:   19441 CTGAGTATCTAGGTCAGTAGCCGTACTTGTAATGTCTAGGTTATATTCCTCTTCAG-CCC 19499
New:   19498 CGGAAGGGGGTTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557
             || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   19500 CG-AAGGGG-TTTTTATATTCGATAATATCTTCCACCATACTTTCAAAAAATGCGCTCGA 19557

New:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAATTAATTTCATCAT 20337
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old:   20278 TTCGTTAATGATATGTTTCACGTGGTGGGATTTTTTTTGCTTTAGAAT-AATTTCATCAT 20336

New:   20398 CGGCAATTTCATTACCACTCAATTGCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20457
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old:   20397 CGGCAATTTCATTACCACTCAAT-GCAAATCCAGAAGACTCTGACCCTGAGTCAGAACCG 20455

New:   21538 CTGCTATCTATACGCTGTGTAGCCC-TGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21596
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old:   21536 CTGCTATCTATACGCTGTGTAGCCCCTGGCCGTCCTGTCGTGAGAGGTGTTTTCAGCGCT 21595
1997-07-27
YCL063W
1760717607DeletionC
1783317833DeletionC
 Two single nucleotide deletions were made within the ORF YCL063W to correct the systematic reference sequence: The C at chromosomal coordinate 17607 was removed, as was the C at 17833.
New:   17581 GAGGTTGAACGAGCTGGCCACCGTCC-AAATGAAGCGCCTAATGATTCTCCACAATCGCA 17639
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old:   17581 GAGGTTGAACGAGCTGGCCACCGTCCCAAATGAAGCGCCTAATGATTCTCCACAATCGCA 17640

New:   17820 TGCAAGAAATCG-ACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17878
             |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old:   17821 TGCAAGAAATCGCACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17880
1998-02-26
YCL063W
1760617606InsertionC
1783117831InsertionC
 Two separate single nucleotide insertions were made in the systematic sequence in the region encompassing ORF YCL063W. Note that these sequence changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old: 17581 GAGGTTGAACGAGCTGGCCACCGTCC-AAATGAAGCGCCTAATGATTCTCCACAATCGCA 17639
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 17581 GAGGTTGAACGAGCTGGCCACCGTCCCAAATGAAGCGCCTAATGATTCTCCACAATCGCA 17640
Old: 17820 TGCAAGAAATCG-ACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17878
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New: 17821 TGCAAGAAATCGCACTTTACGTGCAGCCAAATCACATGATACTGGCTTGAACAAAAGTAA 17880
2000-09-13
YCL063W, YCL064C
1697016970SubstitutionAT
1718517185InsertionT
1702617026InsertionT
1703517035InsertionTA
1704517045InsertionG
1706717067SubstitutionAG
1707917079InsertionC
1699216992SubstitutionAT
 Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL064C and YCL063W. Note that coordinates listed are chromosomal coordinates.
Old:   16917 GAGAAAACTGTATAAACATTTTCCTTTTATTTGGCGATATTTATATACCTGTGATCCTCC 16976
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   16928 GAGAAAACTGTATAAACATTTTCCTTTTATTTGGCGATATTTATATACCTGTGTTCCTCC 16987
Old:   16977 TCATATTGTCCCTTTAATCTTATCTCATCGCAAACAATTTGATAAAGCTT-GGCACTATT 17035
             ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||
New:   16988 TCATATTGTCCCTTTTATCTTATCTCATCGCAAACAATTTGATAAAGCTTTGGCACTATT 17047
Old:   17036 --ATGACACTCA-TGGAATTACATTTCCGCTGGGACTTAACAGGAGC-GCCCATGCGGAA 17091
               |||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||||
New:   17048 TAATGACACTCAGTGGAATTACATTTCCGCTGGGGCTTAACAGGAGCCGCCCATGCGGAA 17107
Old:   17152 GAGAAAAAGAAAAATAGTAGGAACATTTCGCAAT-GATCAAAATGTAAACAGTGCAGTAA 17210
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   17168 GAGAAAAAGAAAAATAGTAGGAACATTTCGCAATTGATCAAAATGTAAACAGTGCAGTAA 17227
2000-09-13
YCL064C
1592115921InsertionC
1606816068SubstitutionGT
1591815918DeletionT
 Three sequence changes were made in the systematic sequence within ORF YCL064C. The T at 15918 was deleted, a single C was inserted after the C at 15921, and the G at 16068 was changed to T. Note that coordinates listed are chromosomal coordinates.
Old:   15898 CTTTATAGTATTAGAGGAGCTCGC-ACAAGCAATAATTATCACAATGTCATCCGCAGCTA 15956
             |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||
New:   15909 CTTTATAGTATTAGAGGAGC-CGCCACAAGCAATAATTATCACAATGTCATCCGCAGCTA 15967
Old:   16017 CACATGCCGGTTCAATCACCATATTGAATTGATGTGTATATTTAAGACAGGGTTCAATAA 16076
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   16028 CACATGCCGGTTCAATCACCATATTGAATTGATGTGTATATTTAAGACAGGTTTCAATAA 16087
2000-09-13YCL065W1381113811SubstitutionCG
 A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCL065W. The C at 13811 was changed to G. This is coding nucleotide 72 (codon 24, TGC to TGG) resulting in one amino acid substitution in the predicted protein sequence (Cys to Trp). Note that coordinates listed below are chromosomal coordinates.
Old:   13798 GAGTGTGGTCGTGCCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTA 13857
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   13809 GAGTGTGGTCGTGGCGGAGGTTGTTTATCTTTCGAGTACTGAATGTTGTCAGTATAGCTA 13868
2000-09-13YCL067C, YCL068C1234012340InsertionAT
 A dinucleotide insertion was made in the systematic sequence in the intergenic region between ORFs YCL068C and YCL067C. An AT was inserted after the T at 12340. Note that coordinates listed are chromosomal coordinates.
Old:   12300 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATAT--TCTACACAGATATATAC 12357
             |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
New:   12309 TTGATTGTTTATGTATTTTTGCGAAATATATATATATATATATTCTACACAGATATATAC 12368
2000-09-13
YCL068C
1204912049SubstitutionGC
1226812268DeletionT
 Two sequence changes were made in the systematic sequence in the region encompassing ORF YCL068C. The G at 12049 was changed to C, and the T at 12268 was deleted. These changes resulted in the N-terminal elongation of the predicted protein sequence by 70 amino acids. Note that coordinates listed are chromosomal coordinates.
Old:   12000 GACGAGGGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCGGTACGGCCGT 12059
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   12010 GACGAGGGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCCGTACGGCCGT 12069
Old:   12240 AAGGTAGGCGAGGACATTATCTATCAGTTACAAACATCTTAGTAGTGTCTGAGGAGAGGG 12299
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   12250 AAGGTAGGCGAGGACATTATCTATCAGT-ACAAACATCTTAGTAGTGTCTGAGGAGAGGG 12308
2000-09-13
YCL069W, YCL073C
85858585InsertionAAA
86758675SubstitutionTC
86868686SubstitutionAG
87338733SubstitutionTC
85778577SubstitutionTA
85358535SubstitutionCT
87648764SubstitutionCT
83658366DeletionTT
83448344SubstitutionTC
85218521SubstitutionCT
 Several sequence changes were made in the systematic sequence in the intergenic region between ORFs YCL073C and YCL069W. Note that coordinates listed are chromosomal coordinates.
Old:    8298 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCTTTTTTTTTTTTTT 8357
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    8307 CCAACAACACTAGAACTCATCCGATAATTTATTTACTTGATTATTCCTTTTTTTTTTTTT 8366
Old:    8358 TTTCTCTTTCCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8418
             |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    8367 TCTCTTT--CCAGTCCATAAAACTATTTTACTTTTCTTATTTATGTAAATAGTATTTAAGA 8425
Old:    8476 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACCTTTTTTTTGGAAG 8534
             ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    8483 ATATATACTTTTACTGACACCTTTCGTCACTATTTTTTGTTTAACTTTTTTTTTGGAAG 8541
Old:    8535 CACTAAAATTATATGCTCGTAATTATTGAGCATCAAAAAAAATAAAAAAAA--- 8585
              ||||||||||||||||||||||||||||||||||||||||| ||||||||
New:    8542 TACTAAAATTATATGCTCGTAATTATTGAGTATCAAAAAAAAAAAAAAAAAAAA 8595
Old:    8640 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCTGAAAATCCACAACGAACCAGTTAT 8699
             ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||
New:    8650 ACTTTGACCTGTCGTCGTACAATCAACTTAGTTTCCGAAAATCCACGACGAACCAGTTAT 8709
Old:    8700 ACCGAAGACTTTTGTACGACAAGAATACTGTACTGTCGAAACTATCTCTTTTCAAACTGA 8759
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:    8710 ACCGAAGACTTTTGTACGACAAGAATACTGTACCGTCGAAACTATCTCTTTTCAAACTGA 8769
Old:    8760 TGAGCGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8819
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    8770 TGAGTGAAGCTTGTGTTTATGTCTGTTGAAACAAGGAAAAAAATGCGGTGCCTGTCGACA 8829
2000-09-13
YCL073C, YCLWomega2
62796279SubstitutionCT
62816281SubstitutionTG
63156315SubstitutionAC
63256325SubstitutionAG
63776377SubstitutionAG
63916391SubstitutionAG
63986398SubstitutionCT
64336433SubstitutionTA
64436443SubstitutionTG
64446446DeletionTTT
64666466SubstitutionAG
62616261SubstitutionTC
63896389SubstitutionAG
62486248InsertionTCTTTACCGACGCTGAG
62556256SubstitutionGTCC
62676267SubstitutionTC
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    6249 -----------------TCTTTAGTG 6257
                              ||||||  |
New:    6244 TCTTTACCGACGCTGAGTCTTTACCG 6269
Old:    6258 ACGTTGAGTTTTTACCGACGCCTTTGAAAATAAAAAGTACGACACAGCTATATGCGTAGC 6317
             ||| ||||| ||||||||||| | ||||||||||||||||||||||||||||||||| ||
New:    6270 ACGCTGAGTCTTTACCGACGCTTGTGAAAATAAAAAGTACGACACAGCTATATGCGTCGC 6329
Old:    6318 AAGTTCAAATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGA 6377
             ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:    6330 AAGTTCAGATGTGGGTCTATCGAGCATGTTTATCCTATCCTGTTATGTCATTTTTATCGG 6389
Old:    6378 AAGTAATAAAAATATAGAAACCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCTTTTT 6437
             ||||||||||| | |||||| |||||||||||||||||||||||||||||||||| ||||
New:    6390 AAGTAATAAAAGTGTAGAAATCACTTGTTTTTGCCTTTTTTGTGATTTTGCTTTCATTTT 6449
Old:    6438 TTTTTTTTTCCCTTTTTTCACCAGCTTGAGGATCAACATCCTGATTCCTTGTCACTTCGA 6497
             |||||    ||||||||||||||||||| ||||||||||||| ||| ||||| |||||||
New:    6450 TTTTTG---CCCTTTTTTCACCAGCTTGGGGATCAACATCCTAATTTCTTGTTACTTCGA 6506
2000-09-13
YCL073C, YCLWomega2
60986098SubstitutionCT
59805980SubstitutionGA
59905990SubstitutionGA
60066006SubstitutionCT
60146014SubstitutionTC
60556055SubstitutionCG
60906090SubstitutionTC
61646164SubstitutionTA
61956195SubstitutionTC
62266226SubstitutionAG
62316231SubstitutionTG
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    5949 ACGGAACACATCAACTTGTAACGACAACAATGCAAAATACCGGGAGACATATCACTTCTT 6008
             ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||
New:    5944 ACGGAACACATCAACTTGTAACGACAACAATACAAAATACCAGGAGACATATCACTTTTT 6003
Old:    6009 TTCGCTTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATCACATGACGCCCTT 6068
             ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:    6004 TTCGCCTAGAATGATTTACAATGGCATACACTTAGAAAAGTGCTATGACATGACGCCCTT 6063
Old:    6069 ACTAGAAGTTACATGATTCTCTTTTTTTTCCTTTCTTTCTTTCTTTTTCGGTACAACATA 6128
             ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
New:    6064 ACTAGAAGTTACATGATTCTCCTTTTTTTTCTTTCTTTCTTTCTTTTTCGGTACAACATA 6123
Old:    6129 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCTTTTATTGGATAGTAACTCCTCCCG 6188
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:    6124 ATTAATGCATTCATACAGAGCGCATTTCCAGCATCATTTATTGGATAGTAACTCCTCCCG 6183
Old:    6189 CACTTTTAATATCAATGACGCTGACTCTTTTACTGACACTGATTCTTTACCGACGCTGAG 6248
             |||||| |||||||||||||||||||||||||||||| |||| |||||||||||||||||
New:    6184 CACTTTCAATATCAATGACGCTGACTCTTTTACTGACGCTGAGTCTTTACCGACGCTGAG 6243
2000-09-13
YCL073C
64806480SubstitutionGA
64846484SubstitutionCT
64906490SubstitutionCT
65046504SubstitutionTC
65336533SubstitutionGA
69686968SubstitutionGA
74157415SubstitutionTC
74457445SubstitutionAG
74517451SubstitutionAG
77787778SubstitutionTC
79437943SubstitutionCT
79977997SubstitutionCT
 Twelve separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. These changes resulted in 4 amino acid differences in the predicted protein sequence. Note that coordinates listed are chromosomal coordinates.
Old:    6468 GATCAACATCCTGATTCCTTGTCACTTCGA 6497
             |||||||||||| ||| ||||| |||||||
New:    6477 GATCAACATCCTAATTTCTTGTTACTTCGA 6506
Old:    6498 TTATGTTTAAAAAGTGCCTTGATTTGAGAGAAAATGTTTTCCTCATCTGGCAAGACAACC 6557
             |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:    6507 TTATGTCTAAAAAGTGCCTTGATTTGAGAGAAAATATTTTCCTCATCTGGCAAGACAACC 6566
Old:    6918 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCGCTCAAACCC 6977
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:    6927 GTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATAGGAGACCACTCAAACCC 6986
Old:    7398 TTTGAATTGTGCCACTTTTGTGATGTCTCATTAGCCAACGTCAAAGGAACAAGAATACAC 7457
             ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||
New:    7407 TTTGAATTGTGCCACTTCTGTGATGTCTCATTAGCCAACGTCAAAGGGACAAGGATACAC 7466
Old:    7758 TACTGGTAAAACATTCTCCATTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7817
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:    7767 TACTGGTAAAACATTCTCCACTTCAAGGAGGAGAAATCAGAAAGTATTAATGTCAGGAGC 7826
Old:    7938 AGCCTCAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTC 7997
             ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    7947 AGCCTTAGTCTTCCGAAGTGGTCAGAGAGTCTGGAGTAGACAACTTGGGATCCGACACTT 8006
2000-09-13
YCL073C, YCLWomega2
53945394SubstitutionAG
53985398DeletionA
54015401DeletionC
54035406DeletionAGGA
54085408DeletionT
54325435DeletionCATC
54375437DeletionC
54435443SubstitutionCT
54685468SubstitutionTG
54755475SubstitutionAG
54785478SubstitutionTC
54865486SubstitutionTC
54925492SubstitutionAT
55245524SubstitutionCA
56155615DeletionG
56315631SubstitutionTC
56345634SubstitutionCT
56385638SubstitutionTC
56835683SubstitutionCT
58335833SubstitutionCT
59095909SubstitutionTC
 Several sequence changes were made in the systematic sequence in the intergenic region between features YCLWomega2 and YCL073C. Note that coordinates listed are chromosomal coordinates.
Old:    5393 CAACAATCCTAGGAGTTCCAGCTCAATCGGGTATGATATCATCTCTGATACCCCCAAAATACATGGCTGTACCATT 5468
             | ||| || |    | |||||||||||||||||||||||    | ||||| ||||||||||||||||||||||||
New:    5401 CGACA-TC-T----G-TCCAGCTCAATCGGGTATGATAT----T-TGATATCCCCAAAATACATGGCTGTACCATG 5464
Old:    5469 TAAAATAAGTGGTATATTGAAGAACAGTATATTTCAGCCTATACAGGATCCTACTCTTTC 5528
             |||||| || ||||||| ||||| ||||||||||||||||||||||||||||||| ||||
New:    5465 TAAAATGAGCGGTATATCGAAGATCAGTATATTTCAGCCTATACAGGATCCTACTATTTC 5524
Old:    5589 GTTAGTAACATCAATATATCGCGGAGGTAGCTATCATTGTGGTAGCTAATTTAAAGGATA 5648
             |||||||||||||||||||||||||| ||||||||||||||| || ||| ||||||||||
New:    5585 GTTAGTAACATCAATATATCGCGGAG-TAGCTATCATTGTGGCAGTTAACTTAAAGGATA 5643
Old:    5649 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTCTTTTGGGCACGCTGAACACGCTCAA 5708
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:    5644 TACAGTTAATTCAACAAGATTTTCAAGTCCATTTTTTTTGGGCACGCTGAACACGCTCAA 5703
Old:    5829 AGACCGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5888
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:    5824 AGACTGTTGCCGACTCCAAGAAAACTATGATCTCAATACAGGCATAAAGAATTGTTGTAT 5883
Old:    5889 CTGTGCCCATGTGATCTGTATCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5948
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:    5884 CTGTGCCCATGTGATCTGTACCTTTTTTGCGGTACCAAAATCGCATGTTGCACTCACACT 5943
1997-07-27
YCL073C
66086608SubstitutionGA
67186718SubstitutionGA
67386738SubstitutionCT
68726872SubstitutionTC
68846884SubstitutionCT
69216921SubstitutionGA
70167016SubstitutionAG
71007100SubstitutionTC
 The following nucleotide substitutions were made within the ORF YCL073C to correct the systematic reference sequence: G to A at chromosomal coordinate 6608, G to A at 6718, C to T at 6738, T to C at 6872, C to T at 6884, G to A at 6921, A to G at 7016, T to C at 7100.
New:    6601 GTTCCGGATCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:    6601 GTTCCGGGTCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
New:    6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGATG 6720
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old:    6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGGTG 6720
New:    6721 AGCCCCAAGGATAATCATTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old:    6721 AGCCCCAAGGATAATCACTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780

New:    6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTCGAAAAGGTATATTGGATGCCGGTTATTA 6900
             ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
Old:    6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTTGAAAAGGTATACTGGATGCCGGTTATTA 6900
New:    6901 CAGCCATCCTACTATGCGTAATCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old:    6901 CAGCCATCCTACTATGCGTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
New:    6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCGGATC 7020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Old:    6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCAGATC 7020

New:    7081 CAGAAAGTTTCAGTTTCCTCGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old:    7081 CAGAAAGTTTCAGTTTCCTTGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
1998-02-26
YCL073C
66086608SubstitutionAG
67186718SubstitutionAG
67386738SubstitutionTC
68726872SubstitutionCT
68846884SubstitutionTC
69216921SubstitutionAG
70167016SubstitutionGA
71007100SubstitutionCT
 Eight separate single nucleotide substitutions were made in the systematic sequence in the region encompassing ORF YCL073C. Note that these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:  6601 GTTCCGGATCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:  6601 GTTCCGGGTCTCTCATGAACATTGTAAACGCAAAGAACGGTACCGTACATGCCAAGCCAA 6660
Old:  6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGATG 6720
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:  6661 CCGTCATTATTATTCGTTGAACATATCTGTAAGATTCAACCACAGCATCTCTTTCGGGTG 6720
Old:  6721 AGCCCCAAGGATAATCATTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:  6721 AGCCCCAAGGATAATCACTAATGAATGTATAAGGTGATGCATATGCTATTTCTGCCAATG 6780
Old:  6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTCGAAAAGGTATATTGGATGCCGGTTATTA 6900
           ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||
New:  6841 AAACGGAGGCACCGATAGCAGCGCCTAGCTTTGAAAAGGTATACTGGATGCCGGTTATTA 6900
Old:  6901 CAGCCATCCTACTATGCGTAATCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:  6901 CAGCCATCCTACTATGCGTAGTCATGGCTTGCAGTATGACGATCACTGAATTGCTGCATA 6960
Old:  6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCGGATC 7020
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:  6961 GGAGACCGCTCAAACCCATGATAACAGATGCAGCGATAACACCTTCATGAGACCCAGATC 7020
Old:  7081 CAGAAAGTTTCAGTTTCCTCGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:  7081 CAGAAAGTTTCAGTTTCCTTGTCTTTGCCACCAACAAACTGTAGAATGGAGATGCAGTAG 7140
2000-09-13YCL074W, YCLWomega238583858SubstitutionCA
 A single nucleotide substitution was made in the systematic sequence in the intergenic region between features YCL074W and YCLWomega2. The C at 3858 was changed to A. Note that coordinates listed are chromosomal coordinates.
Old:    3833 CATCCTGTATTTCACACGAGAGCAACACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3892
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:    3841 CATCCTGTATTTCACACGAGAGCAAAACACATTGCTTTGAGATACCACAAGCTAAGAAAT 3900
2000-09-13
YCL074W
30693069SubstitutionGC
36013601SubstitutionCA
35383538SubstitutionCT
35513551SubstitutionGT
32093209SubstitutionAT
 Five single nucleotide substitutions were made in the systematic sequence in the region encompassing pseudogene YCL074W. Note that coordinates listed are chromosomal coordinates.
Old:    3053 GGTCCCATCTACATTGGCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3112
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:    3061 GGTCCCATCTACATTGCCGTATACGTAGACGACTTACTTGTTGCTGCTCCCTCTCCTAAA 3120
Old:    3173 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGACAAACGGAGACATCACTCTCTCC 3232
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:    3181 GTTGACAAATTCCTCGGTCTTAACATTCATCAATCGTCAAACGGAGACATCACTCTCTCC 3240
Old:    3533 TATCGCTCTGGATCTCAGGTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3592
             ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:    3541 TATCGTTCTGGATCTCAGTTGGCATTAACTGTATATTGTGATGCATCTCATGGAGCTATT 3600
Old:    3593 CACGATCTCCCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3652
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:    3601 CACGATCTACCACACTCTACTGGGGGGTACGTGACTCTACTTGCTGGTGCTCCCGTTACG 3660
2000-09-13
YCLCdelta1
8332383323InsertionA
8333383333InsertionT
8327083271SubstitutionGAAG
8333783337InsertionT
8334183341InsertionT
8334883348SubstitutionTAA
8395583955DeletionC
8336183361InsertionGC
8335483354InsertionC
8335283352SubstitutionTA
 Several sequence changes were made in the systematic sequence in the region downstream of YCLCdelta1. Note that coordinates listed are chromosomal coordinates.
Old:   83242 GGTTCTAACCGATGCCGAAGAACTGCGCGATCCGGTTATAACGTCTGACATGTCCTTTTT 83301
             ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||
New:   83621 GGTTCTAACCGATGCCGAAGAACTGCGCAGTCCGGTTATAACGTCTGACATGTCCTTTTT 83680
Old:   83302 TGATTTGGAATCCAACCACTCA-GTGACTCTGT-CATT-ACTT-GCGAAAT-TATTCC-A 83355
             |||||||||||||||||||||| |||||||||| |||| |||| ||||||  ||| || |
New:   83681 TGATTTGGAATCCAACCACTCAAGTGACTCTGTTCATTTACTTTGCGAAAAATATACCCA 83740
Old:   83356 CAAATT--CCATCGAAAGTGAATCGCAAACCACCTTCAGACTGGCACCGACAAAGCAAAG 83413
             ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   83741 CAAATTGCCCATCGAAAGTGAATCGCAAACCACCTTCAGACTGGCACCGACAAAGCAAAG 83800
Old:   83954 CCTAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCT 84013
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   84341 C-TAGTATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGTCATCT 84399
2000-09-13YCLCdelta1, tE(UUC)C8266282662InsertionGTTGGAATAGAAATCAACTATCATC TACTAACTAGTATTTACATTACTAG TATATTATCATATACGGTGTTAGAA GATGACGCAAATGATGAGAAATAGT CATCTAAATTAGTGGAAGCTGAAAC GCAAGGATTGATAATGTAATAGGAT CAATGAATATAAACATATAAAACGG AATGAGGAATAATCGTAATATTAGT ATGTAGAAATATAGATTCCATTTTG AGGATTCCTATATCCTCGAGGAGAA CTTCTAGTATATTCTGTATACCTAA TATTATAGCCTTTATCAACAATGGA ATCCCAACAATTATCTCAACATTCA CCCATTTCTCAAGTACT
 A large insertion was made in the systematic sequence in the intergenic region between tRNA-Glu and YCLCdelta1. The following sequence was inserted after the TAAAATATTTCCTCTTTAGTACT ending at 82662:
GTTGGAATAGAAATCAACTATCATCTACTAACTAGTATTTACATTACTAG
TATATTATCATATACGGTGTTAGAAGATGACGCAAATGATGAGAAATAGT
CATCTAAATTAGTGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGAT
CAATGAATATAAACATATAAAACGGAATGAGGAATAATCGTAATATTAGT
ATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAGGAGAA
CTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATGGA
ATCCCAACAATTATCTCAACATTCACCCATTTCTCAAGTACT
2000-09-13YCLWdelta2a8410884108SubstitutionGA
 One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta2a. Note that coordinates listed are chromosomal coordinates.
Old:   84074 TATAAAATGATGATAATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGG 84133
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   84460 TATAAAATGATGATAATAATATTTATAGAATTGTATAGAATTGCAGATTCCCTTTTATGG 84519
2000-09-13YCLWdelta38433784337InsertionT
 One sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta3. Note that coordinates listed are chromosomal coordinates.
Old:   84314 GGAATTCTAACAATTATCAAATTG-CCGCCAGTTCCTCAAAAAGATCCATGTATAATCTT 84372
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   84700 GGAATTCTAACAATTATCAAATTGTCCGCCAGTTCCTCAAAAAGATCCATGTATAATCTT 84759
2000-09-13YCLWdelta59074090741SubstitutionCGGC
 A sequence change was made in the systematic sequence in the region encompassing feature YCLWdelta5. Note that coordinates listed are chromosomal coordinates.
Old:   90732 GTGAGAGCCGCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTT 90791
             ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   91116 GTGAGAGCGCCGGAACCGGCTTTTCATATAGAATAGAGAAGCGTTCATGACTAAATGCTT 91175
2000-09-13YCR005C120772120772SubstitutionAG
 The systematic sequence was updated within ORF YCR005C. The T at coding coordinate 1158 was changed to a C, resulting in a silent substitution within codon 386, which codes for threonine. Note that coordinates listed below are chromosomal coordinates, and the Watson strand is shown (YCR005C is a Crick strand ORF).
Old:   120733 GACACCAGAGTGAGCATCTACATTTGGCCATGGATTTTTAGTTTTACCATGTTCAGTCAA 120792
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   121126 GACACCAGAGTGAGCATCTACATTTGGCCATGGATTTTTGGTTTTACCATGTTCAGTCAA 121185
2000-09-13YCR010C132954132954InsertionG
 The systematic sequence was updated in the region upstream of ORF YCR010C. Note that coordinates listed are chromosomal coordinates.
Old:   132912 ATACAGCTTGGTGTCTCTGACAGGTTGGAGTACAGAGGAGAAG-CGCCATAGCCGCCCAA 132970
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   133306 ATACAGCTTGGTGTCTCTGACAGGTTGGAGTACAGAGGAGAAGGCGCCATAGCCGCCCAA 133365
2000-09-13YCR011C, YCR012W136620136620SubstitutionCT
 The systematic sequence was updated in the intergenic region between features YCR011C and YCR012W. Note that coordinates listed are chromosomal coordinates.
Old:   136571 TTAGATTCCTGACTTCAACTCAAGACGCACAGATATTATAACATCTGCACAATAGGCATT 136630
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   136966 TTAGATTCCTGACTTCAACTCAAGACGCACAGATATTATAACATCTGCATAATAGGCATT 137025
2000-09-13
YCR011C
136317136317SubstitutionCT
136388136388SubstitutionCT
 The systematic sequence was updated within ORF YCR011C. Note that coordinates listed are chromosomal coordinates.
Old:   136271 GTTTGCATTCAAAAATAGGTAGCATACAATTAAAACATGGCGGGCACGTATCATTGCCCT 136330
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   136666 GTTTGCATTCAAAAATAGGTAGCATACAATTAAAACATGGCGGGCATGTATCATTGCCCT 136725
Old:   136331 TATCTTGTGCAGTTAGACGCGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTCAT 136390
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   136726 TATCTTGTGCAGTTAGACGCGAATTTTTCGAAGAAGTACCTTCAAAGAATGGGGTCTTAT 136785
2000-09-13YCR012W137641137642SubstitutionGCCG
 The systematic sequence was updated within ORF YCR012W. Note that coordinates listed are chromosomal coordinates.
Old:   137591 GAATTGCAATCATTGTTGGGTAAGGATGTCACCTTCTTGAACGACTGTGTGCGTCCAGAA 137650
              ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||
New:   137986 GAATTGCAATCATTGTTGGGTAAGGATGTCACCTTCTTGAACGACTGTGTCGGTCCAGAA 138045
2000-09-13
YCR014C, YCR015C
140692140692SubstitutionCT
140577140577SubstitutionCT
 The systematic sequence was updated in the intergenic region between features YCR014C and YCR015C. Note that coordinates listed are chromosomal coordinates.
Old:   140531 ATGTGCGATTTGTCTAACAGGTCGCATGTTTATCCTTTACTTATTACCACTGTGACATAT 140590
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   140926 ATGTGCGATTTGTCTAACAGGTCGCATGTTTATCCTTTACTTATTATCACTGTGACATAT 140985
Old:   140651 TTAGACCGAGACCGATTACGGAGATAGAAGAATAGTGCAAGCGAAATACTATTTTATCTT 140710
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
New:   141046 TTAGACCGAGACCGATTACGGAGATAGAAGAATAGTGCAAGTGAAATACTATTTTATCTT 141105
2000-09-13
YCR014C
139180139180SubstitutionGC
139087139087SubstitutionGT
139624139624SubstitutionAG
139720139720SubstitutionTC
140388140389SubstitutionTACC
140065140065SubstitutionCT
140029140029SubstitutionAG
140021140021SubstitutionTC
 The systematic sequence was updated in the region encompassing feature YCR014C. Note that coordinates listed are chromosomal coordinates.
Old:   139031 AATCTTCTGCAATAATTTCCATCCTTGGCATTCAGAGACATATATTGGTCAATCGGGTTT 139090
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   139426 AATCTTCTGCAATAATTTCCATCCTTGGCATTCAGAGACATATATTGGTCAATCGGTTTT 139485
Old:   139151 TCTTTCAGTTCTTCTAATTCTCTTGGAGAGAATTTGACTCCCATGAAAAATTTCTTGATT 139210
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   139546 TCTTTCAGTTCTTCTAATTCTCTTGGAGACAATTTGACTCCCATGAAAAATTTCTTGATT 139605
Old:   139571 TCGTAATATGACCAACCAAATAAAATTGTCCAATCTGATACAAACTCCTCTGGATCCTTC 139630
              ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   139966 TCGTAATATGACCAACCAAATAAAATTGTCCAATCTGATACAAACTCCTCTGGGTCCTTC 140025
Old:   139691 CCAATGCCGTAACAATTTTTGAAGTATTTTAACTTGTCTTCTAATCCCACTGAATCATTT 139750
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   140086 CCAATGCCGTAACAATTTTTGAAGTATTTCAACTTGTCTTCTAATCCCACTGAATCATTT 140145
Old:   139991 TCAGTAACAAGGGAAGCTCTTCCTTTATCCTCCTGTAAAAGTCGCTTAAGAGGTTTTGAA 140050
              |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||
New:   140386 TCAGTAACAAGGGAAGCTCTTCCTTTATCCCCCTGTAAGAGTCGCTTAAGAGGTTTTGAA 140445
Old:   140051 GCTTGTATCATATCCTTATTGTTGCTGTCATCATTCCTTTCACTTTCTACGTCAGTTGAA 140110
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   140446 GCTTGTATCATATCTTTATTGTTGCTGTCATCATTCCTTTCACTTTCTACGTCAGTTGAA 140505
Old:   140351 ATATCAGAATCAACAAAGGAGTCCTCAATCAAAATGATAACTTCCTTACGGCTAGATTGA 140410
              |||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||
New:   140746 ATATCAGAATCAACAAAGGAGTCCTCAATCAAAATGACCACTTCCTTACGGCTAGATTGA 140805
2000-09-13
YCR015C
141089141089SubstitutionGA
141398141398SubstitutionAT
 The systematic sequence was updated in the region encompassing feature YCR015C. Note that coordinates listed are chromosomal coordinates.
Old:   141071 ACTATCCCCTATATACCAGTAGCTGCAAGAATTTCCTTCTTTATTGCAACCTGAGTCGAT 141130
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   141466 ACTATCCCCTATATACCAATAGCTGCAAGAATTTCCTTCTTTATTGCAACCTGAGTCGAT 141525
Old:   141371 TTTGAAACCATCTCTTAGTAAACAATCATCGTGATTCTGATCTCTGGCGAACGTTTTCAT 141430
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   141766 TTTGAAACCATCTCTTAGTAAACAATCTTCGTGATTCTGATCTCTGGCGAACGTTTTCAT 141825
2000-09-13
YCR016W, tG(GCC)C
143330143330SubstitutionTC
143280143281SubstitutionGGCA
143021143021SubstitutionAG
 The systematic sequence was updated in the intergenic region between features tG(GCC)C and YCR016W. Note that coordinates listed are chromosomal coordinates.
Old:   143002 GCAAACGCTTTTGTTATTGAGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143061
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   143291 GCAAACGCTTTTGTTATTGGGAACAGGAATACCAACCGTTCTCATGGAAAATAGCAAAGT 143350
Old:   143242 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTGGTAAGTGCTTTCTTTATCGAC 143301
              ||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||
New:   143531 GAAAAGAGATGAGCTAAATTCAAATATCAAAGTACTGTCATAAGTGCTTTCTTTATCGAC 143590
Old:   143302 AAATTACAAGCAGAAGAAACATTCACTTTACAATTAAATGTCCGAAAATCACGTTCCTGC 143361
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   143591 AAATTACAAGCAGAAGAAACATTCACTTCACAATTAAATGTCCGAAAATCACGTTCCTGC 143650
2000-09-13
YCR016W
144137144137SubstitutionTC
143973143973SubstitutionGA
143830143830SubstitutionTC
143548143548SubstitutionAG
 The systematic sequence was updated within ORF YCR016W. Note that coordinates listed are chromosomal coordinates.
Old:   143542 AAAAGGAAAGCGTGTGTCGAAACCAGGGACGAAGAAGAAGGAAAAATTGTCAAAGGATGA 143601
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   143831 AAAAGGGAAGCGTGTGTCGAAACCAGGGACGAAGAAGAAGGAAAAATTGTCAAAGGATGA 143890
Old:   143782 GAAATTTTCCAAGCAAAAGCAAAATTGGCTTATTAAGCATTTTTTCAATTTGGACGAAAT 143841
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   144071 GAAATTTTCCAAGCAAAAGCAAAATTGGCTTATTAAGCATTTTTTCAACTTGGACGAAAT 144130
Old:   143962 TCAAGAAACAAGAATAAAAGCGTTAATTGCAGAGGATAAGGCTAGCGAACCAATTAATGG 144021
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   144251 TCAAGAAACAAAAATAAAAGCGTTAATTGCAGAGGATAAGGCTAGCGAACCAATTAATGG 144310
Old:   144082 ACAAGACGAGCAAGAGGAAGTACAAATGCCGAATAAAGAGCTTGTTCAAAGAAGTTTGAA 144141
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New:   144371 ACAAGACGAGCAAGAGGAAGTACAAATGCCGAATAAAGAGCTTGTTCAAAGAAGTCTGAA 144430
2000-09-13
YCR016W, YCR017C
144420144420SubstitutionGA
144253144253SubstitutionGA
 The systematic sequence was updated in the intergenic region between features YCR016W and YCR017C. Note that coordinates listed are chromosomal coordinates.
Old:   144202 TGATGTTTAACATAGAGTTCAACAACGTTGTTCAGTTGTAGTATATATTTTGCTGTGAAA 144261
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   144491 TGATGTTTAACATAGAGTTCAACAACGTTGTTCAGTTGTAGTATATATTTTACTGTGAAA 144550
Old:   144382 AAAAAATCAGGTGGATACATAACTTACCTTAAGTTATCGAGATTTTCAGTACACACAATG 144441
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   144671 AAAAAATCAGGTGGATACATAACTTACCTTAAGTTATCAAGATTTTCAGTACACACAATG 144730
2000-09-13
YCR017C
146654146654SubstitutionTC
146125146125SubstitutionGA
146175146175SubstitutionGA
146354146354SubstitutionAG
146473146473SubstitutionAC
147292147292SubstitutionGA
 The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
Old:   146122 TGGGTTGTTGGTATAGAACCCCATTTTCAAGATCACAGATGCAACAAGACCTAGCAGCCA 146181
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
New:   146411 TGGATTGTTGGTATAGAACCCCATTTTCAAGATCACAGATGCAACAAGACCTAACAGCCA 146470
Old:   146302 AACAATATAGGCACCAATGGCAATAATACCTCCTAAAAGTACACCATATTGCATGAAGGC 146361
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   146591 AACAATATAGGCACCAATGGCAATAATACCTCCTAAAAGTACACCATATTGCGTGAAGGC 146650
Old:   146422 ATAACCTGAGATTCCCATATACCATAGCGGGAAATGCCAAATACTACATAAAAGGGACGT 146481
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   146711 ATAACCTGAGATTCCCATATACCATAGCGGGAAATGCCAAATACTACATAACAGGGACGT 146770
Old:   146602 TTCACCACTTTTCTGCAATTCTGAACTTTTTTCTTCTCCATAATTTATGGGATTAGAGTC 146661
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   146891 TTCACCACTTTTCTGCAATTCTGAACTTTTTTCTTCTCCATAATTTATGGGACTAGAGTC 146950
Old:   147262 GACCAAAGCTGCAAAGAAGGCGGAGAATGCGCAAATAGTATGAGCTATAGGGATGATCTT 147321
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   147551 GACCAAAGCTGCAAAGAAGGCGGAGAATGCACAAATAGTATGAGCTATAGGGATGATCTT 147610
2000-09-13
YCR017C
144722144722SubstitutionTC
144760144760SubstitutionGA
145378145378SubstitutionTC
145440145440SubstitutionCT
145693145693SubstitutionAG
145975145975SubstitutionGA
 The systematic sequence was updated within ORF YCR017C. Note that coordinates listed are chromosomal coordinates.
Old:   144682 TCCTCTTGCAACTCTAGCATATCCTGTTCTTCTCAAGCCCTTATACAAGATATACTCACA 144741
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   144971 TCCTCTTGCAACTCTAGCATATCCTGTTCTTCTCAAGCCCCTATACAAGATATACTCACA 145030
Old:   144742 CCATCTATCATCGTCAGAGGGATCAATGTCGTGCATTCCGGATGTTTCACTAACGTACGT 144801
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   145031 CCATCTATCATCGTCAGAAGGATCAATGTCGTGCATTCCGGATGTTTCACTAACGTACGT 145090
Old:   145342 TCTAATATCATACACGAACCTAGCTGTTAGTGATAGTAGGGCCACGGCAAAGAAGAAAAC 145401
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   145631 TCTAATATCATACACGAACCTAGCTGTTAGTGATAGCAGGGCCACGGCAAAGAAGAAAAC 145690
Old:   145402 ATAAATGAAGAATTTTTTGCCCATAGTCACCAGTTGAACGTTAAGGTTTTTGCATGTTAA 145461
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   145691 ATAAATGAAGAATTTTTTGCCCATAGTCACCAGTTGAATGTTAAGGTTTTTGCATGTTAA 145750
Old:   145642 AAAATACGAAGGAACTAACCAAAGCATAGCGATAGCGTACAATAAACCACCAAAAATATA 145701
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   145931 AAAATACGAAGGAACTAACCAAAGCATAGCGATAGCGTACAATAAACCACCGAAAATATA 145990
Old:   145942 CGAGCCAAAACCAACAGCCAAAAATAATTTGCCGATCAACGAAGCAGATTTTGCTTGAGC 146001
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   146231 CGAGCCAAAACCAACAGCCAAAAATAATTTGCCAATCAACGAAGCAGATTTTGCTTGAGC 146290
2000-09-13
YCR017C, YCR018C
147587147587SubstitutionTC
147746147746SubstitutionCT
147840147840SubstitutionAC
 The systematic sequence was updated in the intergenic region between features YCR017C and YCR018C. Note that coordinates listed are chromosomal coordinates.
Old:   147562 ACTTCTGTATATACCGATGAGCATATTTTGATTGTAAAAAACAACATTAAAAAGAACTGC 147621
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:   147851 ACTTCTGTATATACCGATGAGCATACTTTGATTGTAAAAAACAACATTAAAAAGAACTGC 147910
Old:   147742 GTCACATAGTAATACTAGCAGGAAGCCATTAATCAAAAAGAAACTCCATATAAAACGTAA 147801
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   148031 GTCATATAGTAATACTAGCAGGAAGCCATTAATCAAAAAGAAACTCCATATAAAACGTAA 148090
Old:   147802 TAAATATTATGAATAATAGTACAATATAAGAACAAAGAAGAAGAAAATACATTATAACTG 147861
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   148091 TAAATATTATGAATAATAGTACAATATAAGAACAAAGACGAAGAAAATACATTATAACTG 148150
2000-09-13
YCR018C
147977147977SubstitutionCT
148293148293SubstitutionAG
147959147959DeletionA
148295148295SubstitutionAT
 The systematic sequence was updated within ORF YCR018C. Note that coordinates listed are chromosomal coordinates.
Old:   147922 GGTGAAAGAATTAAATAGATACTATGGATTGTTTCGAATCTATCCTTTTATCTGCCGCTT 147981
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
New:   148211 GGTGAAAGAATTAAATAGATACTATGGATTGTTTCGA-TCTATCCTTTTATCTGCTGCTT 148269
Old:   148282 TGCATGCACTAATAACACGATTCTTTGAGGGTGTAATTTCGTTCAAAGAGCTGGTTTTGT 148341
              ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
New:   148570 TGCATGCACTAGTTACACGATTCTTTGAGGGTGTAATTTCGTTCAAAGAGCTGGTTTTGT 148629
2000-09-13
YCR018C-A, YCR019W
151794151794InsertionA
151974151974SubstitutionCT
152172152172SubstitutionAG
152251152251SubstitutionGA
 The systematic sequence was updated in the intergenic region between features YCR018C-A and YCR019W. Note that coordinates listed are chromosomal coordinates.
Old:   151762 GTCTTGTTCCCAAGTATAACTTAAGAAAAAAAA-TTACAATCCAAGAAAGGTAATACAGA 151820
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   152050 GTCTTGTTCCCAAGTATAACTTAAGAAAAAAAAATTACAATCCAAGAAAGGTAATACAGA 152109
Old:   151941 GAATATGAAAAGTACAAATCTGTCAAAAGCACACCGTATATTGTCTTGGTTCCGCTTTTA 152000
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   152230 GAATATGAAAAGTACAAATCTGTCAAAAGCACATCGTATATTGTCTTGGTTCCGCTTTTA 152289
Old:   152121 ACTTGACGATGCACGCTACGATTTTTGTGTGTTTAAACTTTTGTTGGTTGGAACTCAAGA 152180
              ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New:   152410 ACTTGACGATGCACGCTACGATTTTTGTGTGTTTAAACTTTTGTTGGTTGGGACTCAAGA 152469
Old:   152241 CTCTGCAAAAGCTTAATAATGTATTTTAAAACTTGCATGTTGCTCTGTGAATCTGAATGT 152300
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   152530 CTCTGCAAAAACTTAATAATGTATTTTAAAACTTGCATGTTGCTCTGTGAATCTGAATGT 152589
2011-02-03YCR019W152641152641SubstitutionGA
 A single nucleotide substitution was made in the intergenic region upstream of ORF YCR019W/MAK32.
New  152641  AAATTTCCGAGATCCTCAGCTGACAAATAAATGTCATATCAAGACAATAAACGGTAGTGC  152700
             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old  152639  AAGTTTCCGAGATCCTCAGCTGACAAATAAATGTCATATCAAGACAATAAACGGTAGTGC  152698

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-09-13
YCR020W-B, YCR021C
155666155668DeletionTGA
155664155664SubstitutionAG
155675155676DeletionGT
 The systematic sequence was updated in the intergenic region between features YCR020W-B and YCR021C. Note that coordinates listed are chromosomal coordinates.
Old:   155661 ATTATTGAGTTTGTGTATATAATTTATTTTGCATATTTCATAAAGAAATTAAAATTAGAT 155720
              ||| |   ||||||  ||||||||||||||||||||||||||||||||||||||||||||
New:   155950 ATTGT---GTTTGT--ATATAATTTATTTTGCATATTTCATAAAGAAATTAAAATTAGAT 156004
2011-02-03YCR020W-B, YCR021C155961155961Insertion TG
 A dinucleotide insertion was made in the intergenic region between ORFs YCR020W-B and YCR021C.
New  155941  ATTAGATTATTAATTATTGTGTTTGTGTATATAATTTATTTTGCATATTTCATAAAGAAA  156000
             |||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||
Old  155939  ATTAGATTATTAATTATTGTGTT--TGTATATAATTTATTTTGCATATTTCATAAAGAAA  155996

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-09-13
YCR023C, YCR024C
160291160291SubstitutionAG
160135160135SubstitutionTC
160129160129SubstitutionGT
 The systematic sequence was updated in the intergenic region between ORFs YCR023C and YCR024C. Note that coordinates listed are chromosomal coordinates.
Old:   160101 TCATATGCTTACCACTTCCTAGTTCCTTGGCTAGTATTCCTTTAGGTGATCTAAATTCAA 160160
              |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||
New:   160385 TCATATGCTTACCACTTCCTAGTTCCTTTGCTAGCATTCCTTTAGGTGATCTAAATTCAA 160444
Old:   160281 ATTAACATAGATCAGGCCGAATGCCAAATGGAGTTTAGTACCTTCATATTGAAGAAAAAT 160340
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   160565 ATTAACATAGGTCAGGCCGAATGCCAAATGGAGTTTAGTACCTTCATATTGAAGAAAAAT 160624
2000-09-13
YCR023C
159827159827SubstitutionTC
159753159753SubstitutionTC
159397159397SubstitutionTC
159255159255SubstitutionTA
 The systematic sequence was updated within ORF YCR023C. Note that coordinates listed are chromosomal coordinates.
Old:   159201 TTGGTAGTATTCACTAGGGGACTATTTTCATCCTCTTCACTATCTTGTCCTCGATTGCTG 159260
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New:   159485 TTGGTAGTATTCACTAGGGGACTATTTTCATCCTCTTCACTATCTTGTCCTCGAATGCTG 159544
Old:   159381 CCGTAATCTCTTCTATTTTTAAAAGCAGGATGTGTTTCTTCCAAAAACAATGTTGCATTA 159440
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   159665 CCGTAATCTCTTCTATCTTTAAAAGCAGGATGTGTTTCTTCCAAAAACAATGTTGCATTA 159724
Old:   159741 TGATAGAAATTGTGTGAAAATCCCAGTATTAACAATGATACAGATGTTCCTATAAGCCCG 159800
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   160025 TGATAGAAATTGCGTGAAAATCCCAGTATTAACAATGATACAGATGTTCCTATAAGCCCG 160084
Old:   159801 CAAGTCAATGTTATTTTTCTGCCATGTTTTTCAGAGAATCTACCCCAGTGGTACGCAGAT 159860
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   160085 CAAGTCAATGTTATTTTTCTGCCATGCTTTTCAGAGAATCTACCCCAGTGGTACGCAGAT 160144
2011-02-03
YCR024C, YCR024C-B
162275162275SubstitutionAG
162392162392SubstitutionCG
 Two single nucleotide substitutions were made in the intergenic region between ORFs YCR024C and YCR024C-B.
New  162241  TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAGCTCTACTTAAATTGTGGTACG  162300
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Old  162237  TGTTCTCTTTCTTTCTCTCTTAGTAAGCGATAAGTCGAACTCTACTTAAATTGTGGTACG  162296

New  162361  TAACTATAAGTTGTGCATACTCATACTCCACACTCGACGGCCTAATCTCTGTAAGGATTG  162420
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old  162357  TAACTATAAGTTGTGCATACTCATACTCCACACTCCACGGCCTAATCTCTGTAAGGATTG  162416

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-09-13YCR024C161457161457SubstitutionTG
 The systematic sequence was updated in the region encompassing feature YCR024C. Note that coordinates listed are chromosomal coordinates.
Old:   161421 TTTCTGGAAATATAGCATGAACTGGAATTCTACAAATGATCTTAACCGTAAAATTGCACT 161480
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   161705 TTTCTGGAAATATAGCATGAACTGGAATTCTACAAAGGATCTTAACCGTAAAATTGCACT 161764
1997-07-27YCR024C-A, YCR025C163256163256SubstitutionAG
 A single nucleotide substitution was made in Chromosome III within the intergenic region between ORFs YCR024C-A and YCR025C to correct the systematic reference sequence: The A at chromosomal coordinate 163256 was changed to G.
New:   163234 TTTTACTCTGTTGGAAATGCGAGAATTGTTTTGATTTTACCCGATTGCGACCTATTCCCG 163293
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old:   163234 TTTTACTCTGTTGGAAATGCGAAAATTGTTTTGATTTTACCCGATTGCGACCTATTCCCG 163293
1997-07-27YCR024C-A163027163027SubstitutionGA
 A single nucleotide substitution was made in Chromosome III within the ORF YCR024C-A to correct the systematic reference sequence: The G at chromosomal coordinate 163027 was changed to A.
New:   162994 AAAGGAAGATAAGACGCAATAAGAGAAAAAAAGAGAAGTTAAGATTACAAGAGAAACAAT 163053
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old:   162994 AAAGGAAGATAAGACGCAATAAGAGAAAAAAAGGGAAGTTAAGATTACAAGAGAAACAAT 163053
1998-02-26YCR024C-A, YCR025C163259163259SubstitutionGA
 A single nucleotide substitution was made in the systematic sequence in the intergenic region between ORFs YCR024C-A and YCR025C. The G at chromosomal coordinate 163259 was changed to A. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   163236 ATTTTACTCTGTTGGAAATGCGAGAATTGTTTTGATTTTACCCGATTGCGACCTATTCCC 163295
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   163233 ATTTTACTCTGTTGGAAATGCGAAAATTGTTTTGATTTTACCCGATTGCGACCTATTCCC 163292
1998-02-26YCR024C-A163030163030SubstitutionAG
 A single nucleotide substitution was made in the systematic sequence in the region encompassing ORF YCR024C-A. The A at chromosomal coordinate 163030 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   162996 TAAAGGAAGATAAGACGCAATAAGAGAAAAAAAGAGAAGTTAAGATTACAAGAGAAACAA 163055
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   162993 TAAAGGAAGATAAGACGCAATAAGAGAAAAAAAGGGAAGTTAAGATTACAAGAGAAACAA 163052
2000-09-13
YCR025C
163465163465SubstitutionGT
163524163524SubstitutionAG
163407163407SubstitutionGT
 The systematic sequence was updated within ORF YCR025C. Note that coordinates listed are chromosomal coordinates.
Old:   163401 TGGGATGCTAGGGGAAGTGCGCGCGGATACCGAATCGGCCATCGAACCGGCCACCCGGAT 163460
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163685 TGGGATTCTAGGGGAAGTGCGCGCGGATACCGAATCGGCCATCGAACCGGCCACCCGGAT 163744
Old:   163461 TGAGGTTGGTATGTTGCCTCTTTGCGCAATTTTATTGAATGCAAAGTTTCTCCTTCTAGT 163520
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163745 TGAGTTTGGTATGTTGCCTCTTTGCGCAATTTTATTGAATGCAAAGTTTCTCCTTCTAGT 163804
Old:   163521 AAAAGACAACAGCTGAAAAATGCTCGATGTCCAAATGACGACATAAACCTCCTCGTTTAG 163580
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   163805 AAAGGACAACAGCTGAAAAATGCTCGATGTCCAAATGACGACATAAACCTCCTCGTTTAG 163864
2000-09-13YCR025C, YCR026C163801163801SubstitutionAG
 The systematic sequence was updated in the intergenic region between features YCR025C and YCR026C. Note that coordinates listed are chromosomal coordinates.
Old:   163761 GCGCGGGACTCACAAGGATGCGTCTTTTATTTCATAACGCAGTTGTCCCACCTTAAGCTT 163820
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   164045 GCGCGGGACTCACAAGGATGCGTCTTTTATTTCATAACGCGGTTGTCCCACCTTAAGCTT 164104
2000-09-13
YCR026C
163957163957SubstitutionTG
163985163985SubstitutionGA
164308164308SubstitutionGA
164991164991SubstitutionAG
165115165115SubstitutionCA
165146165148DeletionGTC
 The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
Old:   163941 TGCTGCTGCTGCTGCTTCTTCTTGATGATGGTGATGTTTCGCCCGGTAGAGTCTCAGTTG 164000
              |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||
New:   164225 TGCTGCTGCTGCTGCTGCTTCTTGATGATGGTGATGTTTCGCCCAGTAGAGTCTCAGTTG 164284
Old:   164301 AAATATCGCACAAAAGGTTGTAAATTTCGGTATTTTGGAACGGCTCAATGTATCCCTGTG 164360
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   164585 AAATATCACACAAAAGGTTGTAAATTTCGGTATTTTGGAACGGCTCAATGTATCCCTGTG 164644
Old:   164961 CATCTACGTTCGGTACATAACCGAGAATTAACTGTGGTCTTTCGTTCAGTGTACTCATAT 165020
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   165245 CATCTACGTTCGGTACATAACCGAGAATTAGCTGTGGTCTTTCGTTCAGTGTACTCATAT 165304
Old:   165081 CGAAGTAAAATGGAGTTCTCTCTCTAGCAATAGGCTTTTTATGTTCAGGTTGTAGTTTCT 165140
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   165365 CGAAGTAAAATGGAGTTCTCTCTCTAGCAATAGGATTTTTATGTTCAGGTTGTAGTTTCT 165424
Old:   165141 CTTCAGTCTTATACTTGGTATAATTCACATCGCTACCTGGCCACATATGGGTAGCAGCTT 165200
              |||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   165425 CTTCA---TTATACTTGGTATAATTCACATCGCTACCTGGCCACATATGGGTAGCAGCTT 165481
2000-09-13
YCR026C
165731165731SubstitutionCT
165693165693SubstitutionGA
165417165417SubstitutionTC
165304165304SubstitutionTC
165958165958SubstitutionGA
 The systematic sequence was updated within ORF YCR026C. Note that coordinates listed are chromosomal coordinates.
Old:   165261 TATTGTTCCATATTCGAGGGTCCAATACACCTGGATGGAATTCTTCATTAAGATCAGGAT 165320
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   165542 TATTGTTCCATATTCGAGGGTCCAATACACCTGGATGGAATTCCTCATTAAGATCAGGAT 165601
Old:   165381 AATGGTTGGGAAAGGTCTCCGTAGGGAAGCTGGGTATCATAAAAGGTGTGGACGTGATAT 165440
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   165662 AATGGTTGGGAAAGGTCTCCGTAGGGAAGCTGGGTACCATAAAAGGTGTGGACGTGATAT 165721
Old:   165681 CCAGCGAGCCAAGCAATGTGCGAAATATTATTTTAAAAGGCACTTTGGAACGAAATCCCG 165740
              |||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||
New:   165962 CCAGCGAGCCAAACAATGTGCGAAATATTATTTTAAAAGGCACTTTGGAATGAAATCCCG 166021
Old:   165921 TCCTGGTCCACGCAGATCGCCACCCCGATCTTACAGCGTCTTCATCCGTTATGAAATCAT 165980
              ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
New:   166202 TCCTGGTCCACGCAGATCGCCACCCCGATCTTACAGCATCTTCATCCGTTATGAAATCAT 166261
2000-09-13
YCR026C, YCR027C
166449166449SubstitutionCT
166424166424SubstitutionGA
166359166359SubstitutionGA
166292166292SubstitutionGA
166125166125SubstitutionAG
 The systematic sequence was updated in the intergenic region between features YCR026C and YCR027C. Note that coordinates listed are chromosomal coordinates.
Old:   166101 GCCTCACTTATTTTGCTTATTTGTAGTTTGTTAGGCAGTTTGCATATCGTACCAATGTTT 166160
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   166382 GCCTCACTTATTTTGCTTATTTGTGGTTTGTTAGGCAGTTTGCATATCGTACCAATGTTT 166441
Old:   166281 GTTCACAATTCGCCTGATTGTTTGACTAGTCCAACCCCTGGTATAATTGTCACTTAATAT 166340
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   166562 GTTCACAATTCACCTGATTGTTTGACTAGTCCAACCCCTGGTATAATTGTCACTTAATAT 166621
Old:   166341 ATTCTTAGCTTCCAGGTGGTGTTTTATTCCATTATTTATGTTATGTATATATAATCGTAA 166400
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   166622 ATTCTTAGCTTCCAGGTGATGTTTTATTCCATTATTTATGTTATGTATATATAATCGTAA 166681
Old:   166401 CTCTTAGAGCAAAAAGTAAAAAAGAAGGTGGTACTTACCGAGGGAGAACATATACAAATT 166460
              ||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||
New:   166682 CTCTTAGAGCAAAAAGTAAAAAAAAAGGTGGTACTTACCGAGGGAGAATATATACAAATT 166741
2000-09-13YCR027C167438167438SubstitutionCT
 The systematic sequence was updated within ORF YCR027C. Note that coordinates listed are chromosomal coordinates.
Old:   167421 ATTATACTATAGCACAGCATTATGCCTCGTACGCCCGTCAACGATTTAATGTTTAATAGA 167480
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   167699 ATTATACTATAGCACAGTATTATGCCTCGTACGCCCGTCAACGATTTAATGTTTAATAGA 167758
2000-09-13
YCR027C
168120168120SubstitutionAG
168108168108SubstitutionGA
168105168105SubstitutionAT
168100168100SubstitutionGATATTTTGTATCTCAAAATGAGGTA TGTCAGTATGACAATACGTCATCCT AAACGTTCATAAAACACATATGAAA CAACCTTATAACAAAACGAACAACA TGAGATAAAACCCGGCCTTCCCTAG CTGAACTACCCAAAAGTATAAATGC CTGAACAATTAGTTTAGATCCGAGA TTCCGCGCTTCCACCACTTAGTATG ATTCATATTTTATATGAGAAATGGG TGAATGTTGAGATAATTGTTGGGAT TCCATTGTTGATAAAGGCTATAATA TTAGGTATACAGAATATACTAGAAG TTCTCCTCGAGGATTTAGGAATCCA TAAAAGGGAATCTGCAATTCTACAC AATTCTATAAATATTATTATCATCG TTTTATATGTTAATATTCATTGATC CTATTACATTATCAATCCTTGCGTT TCAGCTTCCACTAATTTAGATGACT ATTTCTCATCATTTGCGTCATCTTC TAACACCGTATATGATAATATACTA GTAACGTAAATACTAGTTAGTAGAT GATAGTTGATTTTTATTCCAACATT ATATAATATATAAGATAAGTAACAT TCCGTGAATTAATCTGATAAACTGT TTTGACAACTGGTTACTTCCCTAAG ACTGTTTATATTAGGATTGTCAAGA CACTCCGGTATTACTCGAGCCCGTA ATACAACATAA
 The systematic sequence was updated in the region between features YCR027C and YCR028CC. Note that coordinates listed are chromosomal coordinates.
Old:   168081 AGGACCAGGACTTCTTGTAG--------------------------------------- 168100
              |||||||||||||||||||
New:   168359 AGGACCAGGACTTCTTGTAATATTTTGTATCTCAAAATGAGGTATGTCAGTATGACAAT 168417
New:   168418 ACGTCATCCTAAACGTTCATAAAACACATATGAAACAACCTTATAACAAAACGAACAACATGA 168480
New:   168481 GATAAAACCCGGCCTTCCCTAGCTGAACTACCCAAAAGTATAAATGCCTGAACAATTAGTTTAGATCCGA 168550
New:   168551 GATTCCGCGCTTCCACCACTTAGTATGATTCATATTTTATATGAGAAATGGGTGAATGTTGAGATAATTG 168620
New:   168621 TTGGGATTCCATTGTTGATAAAGGCTATAATATTAGGTATACAGAATATACTAGAAGTTCTCCTCGAGGA 168690
New:   168691 TTTAGGAATCCATAAAAGGGAATCTGCAATTCTACACAATTCTATAAATATTATTATCATCGTTTTATAT 168760
New:   168761 GTTAATATTCATTGATCCTATTACATTATCAATCCTTGCGTTTCAGCTTCCACTAATTTAGATGACTATT 168830
New:   168831 TCTCATCATTTGCGTCATCTTCTAACACCGTATATGATAATATACTAGTAACGTAAATACTAGTTAGTAG 168900
New:   168901 ATGATAGTTGATTTTTATTCCAACATTATATAATATATAAGATAAGTAACATTCCGTGAATTAATCTGAT 168970
New:   168971 AAACTGTTTTGACAACTGGTTACTTCCCTAAGACTGTTTATATTAGGATTGTCAAGACACTCCGGTATTA 169040
Old:   168101 -----------------------TATCAACGTTCTAGATACCAACATATCAATATAAAAAT 168138
                                     |||| || ||||||||||| ||||||||||||||||||
New:   169041 CTCGAGCCCGTAATACAACATAATATCTACATTCTAGATACCGACATATCAATATAAAAAT 169099
2000-09-13
YCR027C
168256168256SubstitutionCT
168230168230InsertionCTATTTGTTGGAATAAAAATCCACT ATCGTCTATCAACTAATAGTTATAT TATCAATATATTATCATATACGGTG TTAAGATGATGACATAAGTTATGAG AAGCTGTCATCGATGTTAGAGGAAG CTGAAACGCAAGGATTGATAATGTA ATAGGATCAATGAATATAAACATAT AAAACGGAATGAGGAATAATCGTAA TATTAGTATGTAGAAATATAGATTC CATTTTGAGGATTCCTATATCCTCG AGGAGAACTTCTAGTATATTCTGTA TACCTAATATTATAGCCTTTATCAA CAATGGAATCCCAACAATTATCTAA TTACCCACACATTTCTCA
168225168225SubstitutionGA
168191168191SubstitutionGA
168152168152SubstitutionTA
 The systematic sequence was updated in the region between features YCR027C and YCR028C. Note that coordinates listed are chromosomal coordinates.
Old:   168139 ACTGAATATTGAGTCATCTTTTAGATTACGTTTTGGTTGCCGCAAACCAAAAGTGCAATTTA 168200
              ||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||
New:   169100 ACTGAATATTGAGACATCTTTTAGATTACGTTTTGGTTGCCGCAAACCAAAAATGCAATTTA 169163
Old:   168201 AATGGGTGAATAATTTGAATGGTTGGAAAT------------------------------------- 168230
              |||||||||||||||||||||||| |||||
New:   169164 AATGGGTGAATAATTTGAATGGTTAGAAATCTATTTGTTGGAATAAAAATCCACTATCGTCTATCAA 169230
New:   169231 CTAATAGTTATATTATCAATATATTATCATATACGGTGTTAAGATGATGACATAAGTTATGAGAAGCTGT 169300
New:   169301 CATCGATGTTAGAGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATAAACATATAA 169370
New:   169371 AACGGAATGAGGAATAATCGTAATATTAGTATGTAGAAATATAGATTCCATTTTGAGGATTC 169432
New:   169433 CTATATCCTCGAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTAT 169490
Old:   168231 ----------------------------------------------CTATTCTCGGTA 168242
                                                            ||||||||||||
New:   169491 CAACAATGGAATCCCAACAATTATCTAATTACCCACACATTTCTCACTATTCTCGGTA 169548
Old:   168243 AAGGTTATAATATCAGTGTTGGAATAAAACTCTAAAATACCATCCATTCAGAAGTATTCA 168302
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   169549 AAGGTTATAATATTAGTGTTGGAATAAAACTCTAAAATACCATCCATTCAGAAGTATTCA 169608
2000-09-13
YCR027C
167958167958SubstitutionAG
167813167813SubstitutionGA
 The systematic sequence was updated in the region upstream of feature YCR027C. Note that coordinates listed are chromosomal coordinates.
Old:   167781 ACCAGCCCAAAAGAATGAATATGAAAATATCAGTATGCGTCAATGAAAATGGAGGCAAGT 167840
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   168059 ACCAGCCCAAAAGAATGAATATGAAAATATCAATATGCGTCAATGAAAATGGAGGCAAGT 168118
Old:   167901 AGATATTAAACCTGGCAGAAGCGTCTTGTTAATACTTATAGAGAAACCACCAGTAGCATT 167960
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   168179 AGATATTAAACCTGGCAGAAGCGTCTTGTTAATACTTATAGAGAAACCACCAGTAGCGTT 168238
2000-09-13
YCR028C
171315171315SubstitutionTC
171364171364SubstitutionCG
171661171696DeletionTTCTTGGCCCTCAGCATTTTCTTGG CCCTCAGCATT
171513171513DeletionT
 The systematic sequence was updated in the region between features YCR028C and YCR028C-A. Note that coordinates listed are chromosomal coordinates.
Old:   171301 CCTTTCAAGATCGATTACTCAAAATCTACAATAATCGGACTGCATGGATCAATGGAGGTG 171360
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   172604 CCTTTCAAGATCGACTACTCAAAATCTACAATAATCGGACTGCATGGATCAATGGAGGTG 172663
Old:   171361 TAGCCAATTTTGTAACAATGAAGGATATGTTAAATTCGCTAAAGCTTCCTCCTCTTTTGC 171420
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   172664 TAGGCAATTTTGTAACAATGAAGGATATGTTAAATTCGCTAAAGCTTCCTCCTCTTTTGC 172723
Old:   171481 TATACATTCTATTTGAGAATAAGCATAGTTTTTACATAACTAGTTCGTTATTCCAAATGT 171540
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   172784 TATACATTCTATTTGAGAATAAGCATAGTTTT-ACATAACTAGTTCGTTATTCCAAATGT 172842
Old:   171661 TTCTTGGCCCTCAGCATTTTCTTGGCCCTCAGCATT 171696

New:   172962 ------------------------------------ 172962
2000-09-13
YCR028C
171051171051SubstitutionTC
170931170931SubstitutionCG
170814170814SubstitutionTC
170811170811SubstitutionAG
170781170781SubstitutionGA
170309170309SubstitutionGA
170253170253SubstitutionAG
169896169896SubstitutionTG
 The systematic sequence was updated within ORF YCR028C. Note that coordinates listed are chromosomal coordinates.
Old:   169861 CACCATGCGTTAACGGCCCCTGAAAACATATTCATTGAAGCAAGAACGATAGCACGTTCT 169920
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New:   171164 CACCATGCGTTAACGGCCCCTGAAAACATATTCATGGAAGCAAGAACGATAGCACGTTCT 171223
Old:   170221 AATGCAAATGTAGAATTAGATGCGAAACCCAAATTCTCACCTCCCAGAACCCAAACAAGA 170280
              |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New:   171524 AATGCAAATGTAGAATTAGATGCGAAACCCAAGTTCTCACCTCCCAGAACCCAAACAAGA 171583
Old:   170281 GAGAACATCCACCAGTGCCACCTTTTTAGGACTCTAGGAATAGTCGACCAGTCTAACCGG 170340
              |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New:   171584 GAGAACATCCACCAGTGCCACCTTTTTAAGACTCTAGGAATAGTCGACCAGTCTAACCGG 171643
Old:   170761 CCCAAGGTCAATAAACCCCAGGCAAACGTACAAAAACTTAGCCATATCCTAGGTGGAACA 170820
              |||||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||
New:   172064 CCCAAGGTCAATAAACCCCAAGCAAACGTACAAAAACTTAGCCATATCCTGGGCGGAACA 172123
Old:   170881 TTAGACACGGTCAAATCGTTTCCGACCATCTTAAGATCTTCCTTCATACCCGATATATAT 170940
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   172184 TTAGACACGGTCAAATCGTTTCCGACCATCTTAAGATCTTCCTTCATACCGGATATATAT 172243
Old:   171001 AGCACAAACAAGTCTATTTTAAACAGAAGTAATCTCTTTTTAATGGCACGTTTGGAAGAA 171060
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   172304 AGCACAAACAAGTCTATTTTAAACAGAAGTAATCTCTTTTTAATGGCACGCTTGGAAGAA 172363
2000-09-13
YCR028C-A
172671172671InsertionG
172674172674DeletionG
172693172693SubstitutionGA
172366172366SubstitutionAT
172290172290SubstitutionCT
172287172287InsertionT
172172172172SubstitutionAT
172578172578SubstitutionAG
 The systematic sequence was updated in the region upstream of feature YCR028C-A. Note that coordinates listed are chromosomal coordinates.
Old:   172170 AAAGGATTAGTGGATTTTTGTTTGTTTTGTATTTGTCAAGGACACACAATTAGCAAATGA 172229
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   173436 AATGGATTAGTGGATTTTTGTTTGTTTTGTATTTGTCAAGGACACACAATTAGCAAATGA 173495
Old:   172230 CTTGTTATCAAATTCGTGGTATTTGTCTTTCTCAACTACTGTGTTAGCTTTTTTTTTT-C 172288
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   173496 CTTGTTATCAAATTCGTGGTATTTGTCTTTCTCAACTACTGTGTTAGCTTTTTTTTTTTC 173555
Old:   172289 GCCTGGGCGCAAACGCCTTTTAAGCACTCCTCCACAAATAATAAGTATTAGATGAAAAGT 172348
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   173556 GTCTGGGCGCAAACGCCTTTTAAGCACTCCTCCACAAATAATAAGTATTAGATGAAAAGT 173615
Old:   172349 CCTAAAAGTCCGAAAAAAGGAATAGAAAAGAACGAAAATACAGAATCTTTACAGAACATT 172408
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   173616 CCTAAAAGTCCGAAAAATGGAATAGAAAAGAACGAAAATACAGAATCTTTACAGAACATT 173675
Old:   172529 AAATAGAAGCATAGCAGAAATATCAAGCGAGACCATGGTAGTTACCAGTAGTCAAAGTTC 172588
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   173796 AAATAGAAGCATAGCAGAAATATCAAGCGAGACCATGGTAGTTACCAGTGGTCAAAGTTC 173855
Old:   172649 AAGTCAAGGTGATTCCACTGCCG-CTGCCGCTATGGGGTAGAGCCGCGTTATCCGTCTCA 172707
              ||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||
New:   173916 AAGTCAAGGTGATTCCACTGCCGGCT-CCGCTATGGGGTAGAGCCACGTTATCCGTCTCA 173974
2000-09-13YCR028C-A171856171856SubstitutionTG
 The systematic sequence was updated within ORF YCR028C-A. Note that coordinates listed are chromosomal coordinates.
Old:   171810 TAGCAGCATCTGCTTCAACATATACCAAAGCGCTGAATAAATTATGTAAAGGAAATGTTA 171869
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   173076 TAGCAGCATCTGCTTCAACATATACCAAAGCGCTGAATAAATTATGGAAAGGAAATGTTA 173135
1997-07-27YCR028C-A173207173207DeletionG
 A single nucleotide deletion was made in Chromosome III within the ORF YCR028C-A to correct the systematic reference sequence: The G at chromosomal coordinate 173207 was removed.
New:   173194 TTAATACCGATAG-TAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAATT 173252
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old:   173194 TTAATACCGATAGGTAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAATT 173253
1998-02-26YCR028C-A173209173209InsertionG
 A single nucleotide insertion was made in the systematic sequence in the region encompassing ORF YCR028C-A. A single G was inserted after the G at chromosomal coordinate 173209. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   173196 ATTAATACCGATAG-TAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAAT 173254
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   173193 ATTAATACCGATAGGTAAAGGCGAATTCATGACAGAATTGGGTAAATAGTTGAGGGCAAT 173252
2000-09-13
YCR030C, YCR031C
175724175724InsertionA
175572175573SubstitutionCGGC
176123176123SubstitutionAG
176049176049SubstitutionGA
176015176015SubstitutionCT
 The systematic sequence was updated in the region between features YCR030C and YCR031C. Coordinates listed are chromosomal coordinates.
Old:   175528 CGCTGGTATTCATGTAGAGCACCAACCTGACTGTGAATGCGTAACGTGAAACATGATAGC 175587
              ||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||
New:   176795 CGCTGGTATTCATGTAGAGCACCAACCTGACTGTGAATGCGTAAGCTGAAACATGATAGC 176854
Old:   175708 GCCTCCTTCAAAAAAAA-TTTACATATATAACATAGGTGGAAAAACTTCCCTCCGATGTC 175766
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   176975 GCCTCCTTCAAAAAAAAATTTACATATATAACATAGGTGGAAAAACTTCCCTCCGATGTC 177034
Old:   176007 CGATTTTGCAACTCTTGGTAATTGTGTCCTTACATTTCCGTAGTGACGTTAATCAAATCG 176066
              |||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   177275 CGATTTTGTAACTCTTGGTAATTGTGTCCTTACATTTCCGTAATGACGTTAATCAAATCG 177334
Old:   176067 CAATCTTGAATCTTCTTAACTAAAAGGTTATAAGGGCTTTTTTTTATTACTAAATTAACG 176126
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   177335 CAATCTTGAATCTTCTTAACTAAAAGGTTATAAGGGCTTTTTTTTATTACTAAATTGACG 177394
2000-09-13
YCR030C
174294174294SubstitutionCT
174084174084SubstitutionCT
 The systematic sequence was updated within ORF YCR030C. Note that coordinates listed are chromosomal coordinates.
Old:   174028 GAATTATTCGGAGTCTCAGTGATGGATGCCTGAATATGAGAGTTTGATGATGATTGCTGT 174087
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   175295 GAATTATTCGGAGTCTCAGTGATGGATGCCTGAATATGAGAGTTTGATGATGATTGTTGT 175354
Old:   174268 AATGCACTCTTACGCTTATCCTTTTGCGGGGATTTCTTTTCTCTTTCCGTATTAGCGGCA 174327
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   175535 AATGCACTCTTACGCTTATCCTTTTGTGGGGATTTCTTTTCTCTTTCCGTATTAGCGGCA 175594
2000-09-13
YCR031C, snR189
177003177004DeletionAA
177093177093SubstitutionAG
177166177166SubstitutionTG
177189177190DeletionAA
 The systematic sequence was updated in the region between features RPS14A/YCR031C and snR189. Note that coordinates listed are chromosomal coordinates.
Old:   176967 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAAAAGTGCTTTCTGTAATATATAGTG 177026	
              ||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||
New:   178235 CTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAA--GTGCTTTCTGTAATATATAGTG 178292

Old:   177087 CCAGGAAGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 177146
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   178353 CCAGGAGGCGGGATGGTCTGCCGCAAGCAGACAAATTTGCCAAAATGCAGTAGAGAATGG 178412

Old:   177147 CAATGCTCGTGCTGAAGGTTAAAAAAAGAACGCAAAAAAAAAAAGAGTAGTAAAATGTAC 177206
              ||||||||||||||||||| ||||||||||||||||||||||  ||||||||||||||||
New:   178413 CAATGCTCGTGCTGAAGGTGAAAAAAAGAACGCAAAAAAAAA--GAGTAGTAAAATGTAC 178470
2000-09-13
YCR031C
176452176452SubstitutionTC
176423176423SubstitutionCT
176781176781SubstitutionTA
 The systematic sequence was updated within ORF YCR031C. Note that coordinates listed are chromosomal coordinates.
Old:   176367 TTCTAGTACCACCGGTAGCTCTGATCTTAACGTGAACGGCAGTGATACCGACTTCCCTAC 176426
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   177635 TTCTAGTACCACCGGTAGCTCTGATCTTAACGTGAACGGCAGTGATACCGACTTCCTTAC 177694
Old:   176427 ACTTAGCGGCAACATCTTGGGCAGCTAACATAGCAGCGTATGGAGAAGATTCATCTCTGT 176486
              ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
New:   177695 ACTTAGCGGCAACATCTTGGGCAGCCAACATAGCAGCGTATGGAGAAGATTCATCTCTGT 177754
Old:   176727 TTTTCCATCGAAAAAAAAGTTGACAAAATATACTGCCATTGACACAATAGGCTCTACTAA 176786	
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New:   177995 TTTTCCATCGAAAAAAAAGTTGACAAAATATACTGCCATTGACACAATAGGCTCAACTAA 178054
2000-09-13
YCR032W
179446179446SubstitutionGA
179509179509SubstitutionAG
179802179802SubstitutionCT
180194180194SubstitutionAG
178856178856SubstitutionAG
179030179030SubstitutionAG
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   178827 TCTCCATAAGGAGTTGAAATTCTGTAACGATATCTTGAATTCATTAACACTCCAAGTTTC 178886
              ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New:   180090 TCTCCATAAGGAGTTGAAATTCTGTAACGGTATCTTGAATTCATTAACACTCCAAGTTTC 180149
Old:   179007 AAATAGGATAATGACCATAGAAAAACACATTTATTTGGAAATTAAGGAAGGCCAGTTTTG 179066
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   180270 AAATAGGATAATGACCATAGAAAGACACATTTATTTGGAAATTAAGGAAGGCCAGTTTTG 180329
Old:   179427 TCATTTAATGGCCAGGCCTGCAACAGAAATATCTTCCACAAAATACATCGATGAGATTGA 179486
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   180690 TCATTTAATGGCCAGGCCTACAACAGAAATATCTTCCACAAAATACATCGATGAGATTGA 180749
Old:   179547 CACCGAATCGTCTAATTTTACGGTAAAATTTGAGGAAAGCACAAACTCGAAAAATATTCC 179606
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   180810 CACCGAATCGTCTAATTTTACGGTAAAATTTGAGGAAAGCACGAACTCGAAAAATATTCC 180869
Old:   179787 AAAAGACTTTGGCTTCCCTTTATTTGCTTATACTTTAAAACAAAAAATAACACAAGATTT 179846
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   181050 AAAAGACTTTGGCTTTCCTTTATTTGCTTATACTTTAAAACAAAAAATAACACAAGATTT 181109
Old:   180147 TGTCACAAAAAGAGAAAATCAGAACAGTAAATTTAATGAGCTATCAAATGATTTAATTTC 180206
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   181410 TGTCACAAAAAGAGAAAATCAGAACAGTAAATTTAATGAGCTATCAAGTGATTTAATTTC 181469
2000-09-13
YCR032W, snR189
177800177801SubstitutionCAAC
178236178236DeletionA
 The systematic sequence was updated in the region between features snR189 and BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   177747 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTCATGCTC 177806
              |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||
New:   179011 CGTTGCAAAGCTTTGTTTGCGGTATGTTAATAAAGTTACCATGAAGCTTTTTTACTGCTC 179070

Old:   178227 AAAAAAAAAACACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 178286
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
New:   179491 AAAAAAAAA-CACAATACGGATATGAATTCAATTATTAATGCTGCTTCGAAAGTCTTAAG 179549
2000-09-13
YCR032W
184757184757SubstitutionGC
184835184835SubstitutionCT
184926184926SubstitutionAG
184966184966SubstitutionAT
 The systematic sequence was updated in the region between ORFs YCR032W and YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   184707 AGTGATTGCGGGAACATTAGATGGCAGATTAGCTATTTGGTACTAGGCATGACATCGTAA 184766
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   185970 AGTGATTGCGGGAACATTAGATGGCAGATTAGCTATTTGGTACTAGGCATCACATCGTAA 186029
Old:   184827 TCATCCCACCTAGTATTGTAATTGCGTACGTATCCAATATCATTACCAACGCCGGGTATT 184886
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
New:   186090 TCATCCCATCTAGTATTGTAATTGCGTACGTATCCAATATCATTACCAACGCCGGGTATT 186149
Old:   184887 TTTTTCTAGTATTTCTTCTCCATTTCGCCTATGGAAAACAGCAAAAGGGTAAAAGAAAAA 184946
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   186150 TTTTTCTAGTATTTCTTCTCCATTTCGCCTATGGAAAACGGCAAAAGGGTAAAAGAAAAA 186209
Old:   184947 AACAAACGATTAATTCTTCATTGAATTATGTAAAAATCAAAACGCAACCGCAGATTTAAT 185006
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
New:   186210 AACAAACGATTAATTCTTCTTTGAATTATGTAAAAATCAAAACGCAACCGCAGATTTAAT 186269
2000-09-13YCR032W178761178761SubstitutionCT
 The systematic sequence was updated within ORF BPH1/YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   178707 CGAAATACTATCAAATAAAAACGATAGTTGGAAATCTACATTACTACAGAAAAACCTTAT 178766
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New:   179970 CGAAATACTATCAAATAAAAACGATAGTTGGAAATCTACATTACTACAGAAAAATCTTAT 180029
2000-09-13
YCR032W
183870183870SubstitutionTC
184086184086SubstitutionTC
184197184197SubstitutionAG
184287184287SubstitutionGA
184290184290SubstitutionAG
184565184565SubstitutionCA
184599184599SubstitutionAG
184616184616SubstitutionGA
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   183867 GTCTGTCGATTATGTTATACACGATCCTAGTTACTTCGATTCATTATACTGGAGGGGCTT 183926
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   185130 GTCCGTCGATTATGTTATACACGATCCTAGTTACTTCGATTCATTATACTGGAGGGGCTT 185189
Old:   184047 ATCGTTTGCGTACTGGAAGTTGGGCGAATTCATAACTGGTGATAAAAATGGGCTGATAAA 184106
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   185310 ATCGTTTGCGTACTGGAAGTTGGGCGAATTCATAACTGGCGATAAAAATGGGCTGATAAA 185369
Old:   184167 AATGTTTGGGCACCTATGCGAGCTAAAGGAAATGCGCTGTTATCACGACTACAATACGCT 184226
              |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   185430 AATGTTTGGGCACCTATGCGAGCTAAAGGAGATGCGCTGTTATCACGACTACAATACGCT 185489
Old:   184287 GAGACAAATAACAAATGATGCGCAAAAGGTCGCAATATCTCAACATGCAGGGAGCATTAT 184346
               || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   185550 AAGGCAAATAACAAATGATGCGCAAAAGGTCGCAATATCTCAACATGCAGGGAGCATTAT 185609
Old:   184527 TGAAGATGGAACTATAGAAATTTACGAGCTCTTTTTGACTTTTCATAATGAATGGGCGAT 184586
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   185790 TGAAGATGGAACTATAGAAATTTACGAGCTCTTTTTGAATTTTCATAATGAATGGGCGAT 185849
Old:   184587 AAAGCTACTGAAACAGCTCTGTACCGAAAGAGGGAAAGCCATAACTAGCATTAAGGGACA 184646
              |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||
New:   185850 AAAGCTACTGAAGCAGCTCTGTACCGAAAAAGGGAAAGCCATAACTAGCATTAAGGGACA 185909
2000-09-13
YCR032W
182114182114SubstitutionTC
182364182364SubstitutionTC
182862182862SubstitutionCT
183603183603SubstitutionAC
183669183669SubstitutionTC
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   182067 TACACTGGAGATACAATCAAATCCAAATTCGTCCTGCAAGTGGTCATTGGACTTTGCAGA 182126
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   183330 TACACTGGAGATACAATCAAATCCAAATTCGTCCTGCAAGTGGTCATCGGACTTTGCAGA 183389
Old:   182307 AGTTGGAGATTTGAATGAGAATAGAAAAATTCTTAGACTTTTGAAGGATAACGATTCTAT 182366
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   183570 AGTTGGAGATTTGAATGAGAATAGAAAAATTCTTAGACTTTTGAAGGATAACGATTCCAT 183629
Old:   182847 GGCAAGCATTGCTTCCAAATTCACTAGCGTCTTCTCAGCGAACAACAGCCTAATAGATGG 182906
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   184110 GGCAAGCATTGCTTCTAAATTCACTAGCGTCTTCTCAGCGAACAACAGCCTAATAGATGG 184169
Old:   183567 GATTGATTTGATATTTGGTTACAAACAAAAGGGGGAAATTGCTGTGAAATCTGTTAACGT 183626
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   184830 GATTGATTTGATATTTGGTTACAAACAAAAGGGGGACATTGCTGTGAAATCTGTTAACGT 184889
Old:   183627 ATTCAACAGATTGAGTTACCCAGGCGCTGTAAATCTAGATAATATTGACGATGAAAATGA 183686
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   184890 ATTCAACAGATTGAGTTACCCAGGCGCTGTAAATCTAGATAACATTGACGATGAAAATGA 184949
2000-09-13
YCR032W
180249180249SubstitutionCT
180312180312SubstitutionAG
180366180366SubstitutionCT
180414180414SubstitutionGA
181159181159SubstitutionAG
181383181383SubstitutionAC
181660181660SubstitutionGC
 The systematic sequence was updated within ORF YCR032W. Note that coordinates listed are chromosomal coordinates.
Old:   180207 TGTATTTGTTACTTTATTGAAAAGCAATACTGATAAACGACACCTGCAGTGGTTTTTACA 180266
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   181470 TGTATTTGTTACTTTATTGAAAAGCAATACTGATAAACGACATCTGCAGTGGTTTTTACA 181529
Old:   180267 TCTCTCATATTACTTTATTAAGAGAAAAGATGTACGTTCTACAGAAATTATACTTCAAGC 180326
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
New:   181530 TCTCTCATATTACTTTATTAAGAGAAAAGATGTACGTTCTACAGAGATTATACTTCAAGC 181589
Old:   180327 GGTAGATCAACTTTTTTCGTTTTACTTAGATCAAGGTAGCGACGAAAATGCGAAGATACT 180386
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   181590 GGTAGATCAACTTTTTTCGTTTTACTTAGATCAAGGTAGTGACGAAAATGCGAAGATACT 181649
Old:   180387 TTCAGAGATTATACCACTTAAGCTAATGCTGATGATTATGGATCAAATAGTGGAAAATAA 180446
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   181650 TTCAGAGATTATACCACTTAAGCTAATACTGATGATTATGGATCAAATAGTGGAAAATAA 181709
Old:   181107 CTTAGAGCTATCATTTATAGTGACACTCCTACCCGAAATACTTAATGACCTGATAGATAG 181166
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   182370 CTTAGAGCTATCATTTATAGTGACACTCCTACCCGAAATACTTAATGACCTGGTAGATAG 182429
Old:   181347 TTTCAAAAACGTTTCTAAGTCGCAACTGTTACAGGAATTCAAAATCTGCATAATGAACTT 181406
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   182610 TTTCAAAAACGTTTCTAAGTCGCAACTGTTACAGGACTTCAAAATCTGCATAATGAACTT 182669
Old:   181647 GTGTTTTTTTGACGCAGCGAATAAAAGTGAAGTACTCGAAGGTTTAAGTAATATCCTCTC 181706
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   182910 GTGTTTTTTTGACCCAGCGAATAAAAGTGAAGTACTCGAAGGTTTAAGTAATATCCTCTC 182969
2000-09-13
YCR033W
186521186521SubstitutionCT
186541186541SubstitutionGA
186582186582SubstitutionAG
186661186661SubstitutionAG
186792186792SubstitutionGA
186931186931SubstitutionTC
186975186975SubstitutionAG
187147187147SubstitutionTC
187293187293SubstitutionCT
 The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   186507 CCTGAAAACAGACGCAACAAAGTTGACAGTAGACGATGATAATAAAAGTTACGAAGAACC 186566
              |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
New:   187770 CCTGAAAACAGACGTAACAAAGTTGACAGTAGACAATGATAATAAAAGTTACGAAGAACC 187829
Old:   186567 TCTTGAAAAAGTGGAAGGGTGTATTTTCCCATTACCAAAAGCAGAAACGAGATTATGGGA 186626
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   187830 TCTTGAAAAAGTGGAGGGGTGTATTTTCCCATTACCAAAAGCAGAAACGAGATTATGGGA 187889
Old:   186627 ATTGAAAAACCAGAAAAGAAACAAAATAATAAGTAAACAAAAGTACTTACTGAAAAAGGC 186686
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   187890 ATTGAAAAACCAGAAAAGAAACAAAATAATAAGTGAACAAAAGTACTTACTGAAAAAGGC 187949
Old:   186747 TACCGGACTTATCTTGACGAAAATTATATCAAAGATAAAAAAGGAGGAACATTTGAAAAA 186806
              ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
New:   188010 TACCGGACTTATCTTGACGAAAATTATATCAAAGATAAAAAAGGAAGAACATTTGAAAAA 188069
Old:   186927 CGAATTAATGGAGCAGAAAAGACGTGAAGAAGGTATCGAAACAGAAAAAGAAAAAAGCTT 186986
              |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   188190 CGAACTAATGGAGCAGAAAAGACGTGAAGAAGGTATCGAAACAGAAAAGGAAAAAAGCTT 188249
Old:   187107 TGCAACAATTCCTCCGCTAATTTTAGATCCAATCCGCAAATACTCTTACAAATTCTGTGA 187166
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New:   188370 TGCAACAATTCCTCCGCTAATTTTAGATCCAATCCGCAAACACTCTTACAAATTCTGTGA 188429
Old:   187287 AAAATTCGGTAAAATTTCTCACTACATGGGCGGCTTAAGAAGTCCTGAAGAGTGTGTCCT 187346
              |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   188550 AAAATTTGGTAAAATTTCTCACTACATGGGCGGCTTAAGAAGTCCTGAAGAGTGTGTCCT 188609
2000-09-13
YCR033W
186130186130SubstitutionAG
186341186341SubstitutionAG
186384186384SubstitutionAG
186429186429SubstitutionTA
186465186465SubstitutionTC
 The systematic sequence was updated within ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   186087 GGCTTCAGTTAAAGTTGAAACACCCAGTAAAGATGAGACAAAAACCATATCGTACCATGA 186146
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   187350 GGCTTCAGTTAAAGTTGAAACACCCAGTAAAGATGAGACAAAAGCCATATCGTACCATGA 187409
Old:   186327 CGCTAAAAAAGTAAATAAAATCAATATTGATGGAAAGCAGGACGAAATTTGGACGACAGC 186386
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||
New:   187590 CGCTAAAAAAGTAAGTAAAATCAATATTGATGGAAAGCAGGACGAAATTTGGACGACGGC 187649
Old:   186387 AAAAACAGTGGCCAGTGCAGTCGAAGTTTCCAAAGAAAGTCATAAGGAACTAACACGCTC 186446
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   187650 AAAAACAGTGGCCAGTGCAGTCGAAGTTTCCAAAGAAAGTCAAAAGGAACTAACACGCTC 187709
Old:   186447 TGTTGAAAGGAAGGAAAGTCCAGAAATTAGAGATTATGAAAGAGCATACGATCCGAAAGC 186506
              |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
New:   187710 TGTTGAAAGGAAGGAAAGCCCAGAAATTAGAGATTATGAAAGAGCATACGATCCGAAAGC 187769
2000-09-13
YCR033W
187431187431SubstitutionGC
187515187515SubstitutionTG
187633187633SubstitutionAC
187683187683SubstitutionTC
187708187708SubstitutionAG
187754187754SubstitutionAG
187769187769SubstitutionCA
187781187781SubstitutionGC
187787187787SubstitutionGA
 The systematic sequence was updated in the region encompassing ORF YCR033W. Note that coordinates listed are chromosomal coordinates.
Old:   187407 GAAAAGAAAAATGTCAGCCGCTGCGAAGCGCCGCAAGAGGAAGGAAAGAAGTAATGACGA 187466
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   188670 GAAAAGAAAAATGTCAGCCGCTGCCAAGCGCCGCAAGAGGAAGGAAAGAAGTAATGACGA 188729
Old:   187467 GGAAGTCGAAGTTGATGAGAGTAAAGAAGAGTCAACGAACACGATAGATAAGGAAGAAAA 187526
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   188730 GGAAGTCGAAGTTGATGAGAGTAAAGAAGAGTCAACGAACACGATAGAGAAGGAAGAAAA 188789
Old:   187587 AGGTGATCCATTAGGTACACCGGAAAAAGTTGAAAATATGATTGAAAAGAGAGGCGAAGA 187646
              |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New:   188850 AGGTGATCCATTAGGTACACCGGAAAAAGTTGAAAATATGATTGAACAGAGAGGCGAAGA 188909
Old:   187647 GTTTGCAGGTGAATTGGAAAATGCTGAGAGGGTAAATGACTTAAAAAGGGCGCATGATGA 187706
              |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
New:   188910 GTTTGCAGGTGAATTGGAAAATGCTGAGAGGGTAAACGACTTAAAAAGGGCGCATGATGA 188969
Old:   187707 AATTGGAGAAGAGAGCAATAAGTCCAGTGTAATAGAAACCAACAATGAGGTACAAATAAT 187766
              | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
New:   188970 AGTTGGAGAAGAGAGCAATAAGTCCAGTGTAATAGAAACCAACAATGGGGTACAAATAAT 189029
Old:   187767 GGCTCCAAAAGGAGGTGTTCGGAATGGTTATTATCCAGAGGAGACCAAAGAACTTGACTT 187826
              || ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||
New:   189030 GGATCCAAAAGGAGCTGTTCAGAATGGTTATTATCCAGAGGAGACCAAAGAACTTGACTT 189089
2000-09-13
YCR035C
191444191444SubstitutionAC
190661190661SubstitutionTC
 The systematic sequence was updated within ORF YCR035C. Note that coordinates listed are chromosomal coordinates.
Old:   190647 AGCGCCTCCTCCCATTAATGTTAATTGCTTATAGTTACCTGAAGGAGCAGCGAGGATGGA 190706
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   191910 AGCGCCTCCTCCCACTAATGTTAATTGCTTATAGTTACCTGAAGGAGCAGCGAGGATGGA 191969
Old:   191427 ATCCAAATCTTTAATCGAGGCGCTAGTTTCTTCTATTATTCCACCCGTAATAGAAGTTAT 191486
              ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
New:   192690 ATCCAAATCTTTAATCGCGGCGCTAGTTTCTTCTATTATTCCACCCGTAATAGAAGTTAT 192749
2000-09-13
YCR035C, YCR036W
191836191836SubstitutionAC
191795191795SubstitutionGA
 The systematic sequence was updated in the region between ORFs YCR035C and YCR036W. Note that coordinates listed are chromosomal coordinates.
Old:   191787 TTTGTGTAGCAATACTCATCGTCTAATTTGTCCATTATTGTTATATACTATGTCATAAAA 191846
              |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   193050 TTTGTGTAACAATACTCATCGTCTAATTTGTCCATTATTGTTATATACTCTGTCATAAAA 193109
2000-09-13
YCR036W
192557192557SubstitutionAG
192329192329SubstitutionTC
192927192927SubstitutionTC
 The systematic sequence was updated within ORF YCR036W. Coordinates listed are chromosomal coordinates.
Old:   192327 TATTAATTGAAGAGAAAGCTGGTGGCCAAAATAGGATATTGATTGTAGAAGGTGCTAACA 192386
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   193590 TACTAATTGAAGAGAAAGCTGGTGGCCAAAATAGGATATTGATTGTAGAAGGTGCTAACA 193649
Old:   192507 ATGCGAACAGGCCGAATTTTCAGATCGTATATAACCCCTCACCTTTCAAGACCATGCCTA 192566
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   193770 ATGCGAACAGGCCGAATTTTCAGATCGTATATAACCCCTCACCTTTCAAGGCCATGCCTA 193829
Old:   192927 TGGCTATAAAGTTCTCTACATTAGCTAGTTCATTGACCATTCAAAGAAAAGGTGCTGCTG 192986
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   194190 CGGCTATAAAGTTCTCTACATTAGCTAGTTCATTGACCATTCAAAGAAAAGGTGCTGCTG 194249
2000-09-13
YCR037C, YCR038C
196035196035SubstitutionCT
196266196266SubstitutionCT
 The systematic sequence was updated in the region between ORFs YCR037C and YCR038C. Coordinates listed are chromosomal coordinates.
Old:   195987 GTGTGAAACACTGTTTTCTGGTAATAATTTTTCAATGCATCGGATTACCTTTCCCACGTG 196046
              |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
New:   197250 GTGTGAAACACTGTTTTCTGGTAATAATTTTTCAATGCATCGGATTACTTTTCCCACGTG 197309
Old:   196227 AAAAAATATTATCTACTGTAGTTATGCAAGTATTCTTAACTTTCAGTACTAAACATGAAT 196286
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   197490 AAAAAATATTATCTACTGTAGTTATGCAAGTATTCTTAATTTTCAGTACTAAACATGAAT 197549
2000-09-13
YCR037C
195701195701SubstitutionGA
195060195060SubstitutionTC
 The systematic sequence was updated within ORF YCR037C. Note that coordinates listed are chromosomal coordinates.
Old:   195027 GTAAAGATTTATTATTGTCTGTTTTAATAATGATTTTTTCTGAGATTTAATGTTAAATTG 195086
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
New:   196290 GTAAAGATTTATTATTGTCTGTTTTAATAATGACTTTTTCTGAGATTTAATGTTAAATTG 196349
Old:   195687 TCTTCTTTTCGATGGAGATGGTTCTCCTGCAGCTATGTTGCTTTCTATATCAGCGATTGG 195746
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   196950 TCTTCTTTTCGATGAAGATGGTTCTCCTGCAGCTATGTTGCTTTCTATATCAGCGATTGG 197009
2000-09-13
YCR038C
196838196839SubstitutionCAAC
197077197077SubstitutionGA
197810197810SubstitutionAG
198169198169DeletionT
197950197950SubstitutionGC
 The systematic sequence was updated within ORF YCR038C. In addition, the start codon has been shifted forward 312 nt, leading to an N-terminal extension of the protein by 104 aa. Note that coordinates listed below are chromosomal coordinates.
Old:   196827 GTATAGACAAGCAAGTGCAACTTGTAACCAGTAGGAAATGGTGTGCGTTTGCTGCAAAGT 196886
              |||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||
New:   198090 GTATAGACAAGACAGTGCAACTTGTAACCAGTAGGAAATGGTGTGCGTTTGCTGCAAAGT 198149
Old:   197067 GACTTCTAGAGGTTCACCCTGTTTCCATTGGAAAAGTAAATCACTGAGGTCAGTTGCACC 197126
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   198330 GACTTCTAGAAGTTCACCCTGTTTCCATTGGAAAAGTAAATCACTGAGGTCAGTTGCACC 198389
Old:   197787 CCTCCAGGCGGAGTTAACAACTAATAATACGGCATCCATGTTTGCATCAGCGCCGAGCCT 197846
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   199050 CCTCCAGGCGGAGTTAACAACTAGTAATACGGCATCCATGTTTGCATCAGCGCCGAGCCT 199109
Old:   197907 GGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCGGTACGGCCGTTCTCAT 197966
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   199170 GGGGCATTCTCTAGAGACACAGGCAGTTGCTTCCAGCAACTGCCGTACGGCCGTTCTCAT 199229
Old:   198147 GGCGAGGACATTATCTATCAGTTACAAACATCTTAGTAGTGTCTGAGGAGAGGGTTGATT 198206
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
New:   199410 GGCGAGGACATTATCTATCAGT-ACAAACATCTTAGTAGTGTCTGAGGAGAGGGTTGATT 199468
2000-09-13YCR042C, YCR043C204348204348DeletionT
 The systematic sequence was updated in the region between ORFs YCR042C and YCR043C. Note that coordinates listed below are chromosomal coordinates.
Old:   204327 TTTATTGAATTAAATAAGACTTGATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 204386
              ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
New:   205589 TTTATTGAATTAAATAAGACT-GATTTTGTAGCACGATATCCGCAAGAATGATTCACAAC 205647
2000-09-13YCR048W, YCR051W212559212559InsertionC
 The systematic sequence was updated in the intergenic region between ORFs YCR048W and YCR051W. Note that coordinates listed below are chromosomal coordinates.
Old:   212547 GAATGGGCGTCCG-TCCACCGTGGTCAAAGACAGGGGCAAAGAGCTCCTAGGTCTATATA 212605
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   213808 GAATGGGCGTCCGCTCCACCGTGGTCAAAGACAGGGGCAAAGAGCTCCTAGGTCTATATA 213867
2000-09-13YCR054C, YCR057C219173219173SubstitutionGA
 The systematic sequence was updated in the region betweeen ORFs YCR054C and YCR057C. Note that coordinates listed below are chromosomal coordinates. Note also that this same change was made on 1997-07-27, but changed back to its original state on 1998-02-26, so that this current change restores one originally made on 1997-07-27.
Old:   219146 CATGATGTGAATGTGCATAAATAGAGGGCAGTGAATATTTTTCAAGGAAGCTCTTTCTCA 219205
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   220408 CATGATGTGAATGTGCATAAATAGAGGACAGTGAATATTTTTCAAGGAAGCTCTTTCTCA 220467
1997-07-27YCR054C, YCR055C219173219173SubstitutionGA
 A single nucleotide substitution was made in Chromosome III between ORFs YCR054C and YCR055C to correct the systematic reference sequence: The G at chromosomal coordinate 219173 was changed to A.
New:   219154 GAATGTGCATAAATAGAGGACAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTTC 219213
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old:   219154 GAATGTGCATAAATAGAGGGCAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTTC 219213
1998-02-26YCR054C, YCR055C219175219175SubstitutionAG
 A single nucleotide substitution was made in the systematic sequence in the region between ORFs YCR054C and YCR055C. The A at chromosomal coordinate 219175 was changed to G. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   219155 TGAATGTGCATAAATAGAGGACAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTT 219214
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
New:   219153 TGAATGTGCATAAATAGAGGGCAGTGAATATTTTTCAAGGAAGCTCTTTCTCATTTTCTT 219212
2000-09-13YCR057C, YCR059C222085222085InsertionT
 The systematic sequence was updated in the region between features YCR057C and YCR059C. Note that coordinates listed are chromosomal coordinates.
Old:   222026 TATTGATATTATACTAGTTATTGTACATACCTAGAACTATACTCGAAACTTTTTTTTTTT 222085
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   223288 TATTGATATTATACTAGTTATTGTACATACCTAGAACTATACTCGAAACTTTTTTTTTTT 223347
Old:   222086 -CATCTTTCAGCTCATCGCAAAATTTTTCCAAAAAATTTCAAAAAGAACTCCCGTCGCAT 222144
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   223348 TCATCTTTCAGCTCATCGCAAAATTTTTCCAAAAAATTTCAAAAAGAACTCCCGTCGCAT 223407
1997-07-27
YCR057C
220245220245DeletionT
221416221416DeletionG
 The systematic reference sequence of Chromosome III was updated within ORF YCR057C: The T at chromosomal coordinate 220245 was removed, and the G at chromosomal coordinate 221416 was removed.
New:   220234 TTCAGAATTTT-GGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTCT 220292
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:   220234 TTCAGAATTTTTGGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTCT 220293
New:   221373 CATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAG-TTCTTTTCCTCTGAATC 221431
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old:   221374 CATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAGGTTCTTTTCCTCTGAATC 221433
1998-02-26YCR057C221662221662InsertionC
 The systematic reference sequence of Chromosome III was updated in the region upstream of ORF YCR057C: A single C was inserted after the G at 221662. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   221613 CTGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAG-ATTTTTCTT 221671
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   221613 CTGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAGCATTTTTCTT 221672
1998-02-26
YCR057C
220246220246InsertionT
221416221416InsertionG
 The systematic reference sequence of Chromosome III was updated within ORF YCR057C: A single T was inserted after the T at chromosomal coordinate 220246, and a single G was inserted after the G at chromosomal coordinate 221416. Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   220235 GTTCAGAATTTT-GGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTC 220293
              |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
New:   220233 GTTCAGAATTTTTGGCAGTGAACCTATCTTGATTAAACCTACCAGATATTATATCCTTTC 220292
Old:   221374 CCATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAG-TTCTTTTCCTCTGAAT 221432
              ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New:   221373 CCATAACGTAGTCTCTGTGCCCATTAAATGTTGTCGCCGCAAGGTTCTTTTCCTCTGAAT 221432
1997-07-27YCR057C221663221663DeletionC
 The systematic reference sequence of Chromosome III was updated upstream of ORF YCR057C: The C at chromosomal coordinate 221663 was removed.
New:   221612 TGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAG-ATTTTTCTTT 221670
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old:   221614 TGAGGCTAATGCAAAGAGTCTCCCATCAGGGCTGAACTTCACAGCGGAGCATTTTTCTTT 221673
2000-09-13YCR060W223942223942SubstitutionCT
 The systematic sequence was updated downstream of ORF YCR060W. Note that coordinates listed below are chromosomal coordinates.
Old:   223885 TGTATTGGCAACTAACGGAACTAAGGCAACATATCTTGCATATTGCAATGTTCACTACAT 223944
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   225148 TGTATTGGCAACTAACGGAACTAAGGCAACATATCTTGCATATTGCAATGTTCACTATAT 225207
2000-09-13YCR061W225653225673SubstitutionAAATTCTCACCGGCCCCAAGGCGCGTTTATGTTCATAGGAACCGGA T
 The systematic sequence was updated in the region encompassing ORF YCR061W. Note that coordinates listed below are chromosomal coordinates.
Old:   225625 CTGCCAAGGATTTACAGCATGTGTCGATAAA-TTC-T---CACCGGCCCCAAGGTGTGTG 225679
              ||||||||||||||||||||||||||||    ||  |   ||  ||  ||    ||||||
New:   226888 CTGCCAAGGATTTACAGCATGTGTCGATCGCGTTTATGTTCATAGGAACCGGATTGTGTG 226947
2000-09-13YCR063W, YCR065W227805227805InsertionC
 The systematic sequence was updated in the region between ORFs YCR063W and YCR065W. Note that coordinates listed are chromosomal coordinates.
Old:   227780 AATCAAAAAATTACTTCTTCTCCTCC-TTACGGTGCCCTTTGATCCTTCTCAAACTTTAA 227838
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   229048 AATCAAAAAATTACTTCTTCTCCTCCCTTACGGTGCCCTTTGATCCTTCTCAAACTTTAA 229107
2000-09-13YCR065W229501229501DeletionA
 The systematic sequence was updated within ORF YCR065W. Note that coordinates listed below are chromosomal coordinates. As a result, the annotated stop site of YCR065W has been moved downstream, increasing the size of the coding region from 1599 nt to 1695 nt.
Old:   229459 CTATAGAGACTCCAATCAGGTATATCACGACGCCGGGGGGCAACTTTGGAAACCCAAATT 229518
              |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
New:   230728 CTATAGAGACTCCAATCAGGTATATCACGACGCCGGGGGGCA-CTTTGGAAACCCAAATT 230786
2000-09-13
YCR065W
229749229749DeletionT
230014230014DeletionT
 The systematic reference sequence of Chromosome III was updated in the region downstream of ORF YCR065W.
Old:   229699 TCCAACGATAGCGGTAATGAAAAGAATTGACTTTTTTTTTTTTTTTTTTTTCATTTTCTT 229758
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
New:   230967 TCCAACGATAGCGGTAATGAAAAGAATTGACTTTTTTTTTTTTTTTTTTT-CATTTTCTT 231025
Old:   229999 CATATCTTTATTTTTTGATCCTTACGGATTTTTAATACAGTATTTAGCTGAAGTTTCCAT 230058
              ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New:   231266 CATATCTTTATTTTT-GATCCTTACGGATTTTTAATACAGTATTTAGCTGAAGTTTCCAT 231324
2000-09-13
YCR067C, YCR068W
235421235421InsertionC
235515235515DeletionT
 The systematic sequence was updated in the region between ORFs YCR067C and YCR068W. Note that coordinates listed below are chromosomal coordinates.
Old:   235399 AATCGTAAATACATAGGCTGGGC-ATATACACTAACATGTGTCGTGACCAATGTGCAGCA 235457
              ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
New:   236665 AATCGTAAATACATAGGCTGGGCCATATACACTAACATGTGTCGTGACCAATGTGCAGCA 236724
Old:   235458 GATAGACTTGCTCATTAAATATATTCCAGGTAGGATTCTCTAAGGGTTTTTTTTTTTTCT 235517
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   236725 GATAGACTTGCTCATTAAATATATTCCAGGTAGGATTCTCTAAGGGTTTTTTTTTTT-CT 236783
2000-09-13YCR068W236904236904InsertionC
 The systematic sequence was updated within ORF YCR068W. Due to the single nucleotide insertion and resulting frameshift, the annotated stop site of YCR068W was moved downstream, increasing the length of the coding region from 1290 nt to 1563 nt. This annotation change incorporates the area that some had originally referred to as YCR068W-A into YCR068W. ORF YCR068W-A was originally included in the annotation data collected by MIPS on behalf of the European Yeast Chromosome III Sequencing project (see GenBank accession X59720). However, YCR068W-A was never included in SGD as an independent ORF. Note that coordinates listed are chromosomal coordinates.
Old:   236898 AATACCC-GATGCGGCCATATGGGTCACAGGCCACTCACTGGGAGGCGCATTGGCCAGTT 236956
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   238164 AATACCCCGATGCGGCCATATGGGTCACAGGCCACTCACTGGGAGGCGCATTGGCCAGTT 238223
1998-02-26YCR068W237282237282DeletionC
 One single nucleotide deletion was made in the systematic sequence in the region downstream of ORF YCR068W. The C at chromosomal coordinate 237282 was removed. Note that while the coordinate may appear to be different, this change is the exact reciprocal of one made on 1997-07-27, returning the systematic sequence to its original state in this region.
Old:   237272 CCTTGGATACCGAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACA 237331
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New:   237273 CCTTGGATAC-GAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACA 237331
1997-07-27YCR068W237282237282InsertionC
 One single nucleotide insertion was made in Chromosome III downstream of ORF YCR068W to correct the systematic reference sequence: A single C was inserted after the G at chromosomal coordinate 237282.
New:   237274 CTTGGATACCGAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACAA 237333
              ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   237274 CTTGGATAC-GAGCAGGCTGCCAAGTGCGTTGAACCAGAGCCCTGCGTAGATTGCTACAA 237332
2000-09-13
YCR071C, YCR072C
239394239394InsertionC
239746239746SubstitutionTC
 The systematic sequence was updated in the region between ORFs YCR071C and YCR072C. Note that coordinates listed below are chromosomal coordinates.
Old:   239356 TGCTTATAGTACCATATTTTAAATTCATACCAAGCCATT-GTACGCGATGACCATTATAG 239414
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   240624 TGCTTATAGTACCATATTTTAAATTCATACCAAGCCATTCGTACGCGATGACCATTATAG 240683
The systematic sequence was updated within ORF YCR072C. Note that coordinates listed below are chromosomal coordinates.
Old:   239715 GATGACCACGCAACCTGGTATACGCTGGCTATATGCCCTCTAAATGTGGAGATAAACTTA 239774
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   240984 GATGACCACGCAACCTGGTATACGCTGGCTACATGCCCTCTAAATGTGGAGATAAACTTA 241043
2000-09-13YCR071C238910238910InsertionA
 The systematic sequence was updated within ORF YCR071C. One nucleotide was inserted causing a frameshift, leading to a C-terminally altered and elongated protein from amino acid 120 onward. The annotated coding region has been increased in length from 366 nt to 441 nt. Note that coordinates listed are chromosomal coordinates.
Old:   238877 TTGATAATAATTTTTTTCGATTGCATCACCACAG-CCATGATTTTTTGGGTATGAAAGGC 238935
              |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
New:   240144 TTGATAATAATTTTTTTCGATTGCATCACCACAGACCATGATTTTTTGGGTATGAAAGGC 240203
2011-02-03YCR072C, YCR073C242444242444DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs YCR072C and YCR073C.
New  242401  CTTGTGATATATGTCTTTTAAAGATACTCTTTTTGAAGCTCATCGCA-TTTTTTTTTTTT  242459
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old  242397  CTTGTGATATATGTCTTTTAAAGATACTCTTTTTGAAGCTCATCGCATTTTTTTTTTTTT  242456

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-09-13YCR073C241455241455DeletionG
 The systematic sequence was updated within ORF YCR073C. As a result, YCR073C was extended at the 3' end, so that the coding region increased in length from 3945 nt to 3996 nt. Note that coordinates listed below are chromosomal coordinates.
Old:   241395 GTAGTTCCACAGCAGTAGCCCTCATAGTGGGGTCTTGAACCAAACACCTTTCCAAGAAGG 241454
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   242664 GTAGTTCCACAGCAGTAGCCCTCATAGTGGGGTCTTGAACCAAACACCTTTCCAAGAAGG 242723
Old:   241455 GCTCTTCCCGCTGCAGTCATTTCGTCTCTATTGGGTAGTTGCGGTATTCGACCTGCAGCA 241514
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   242724 -CTCTTCCCGCTGCAGTCATTTCGTCTCTATTGGGTAGTTGCGGTATTCGACCTGCAGCA 242782
2000-09-13YCR073W-A, YCR075C246726246726InsertionAT
 The systematic sequence was updated in the region between ORFs YCR073W-A and YCR075C. Note that coordinates listed are chromosomal coordinates.
Old:   246675 ACATACATACATATATTTATGTATATTTATGTATATATATATATATATATAT--GCGTAA 246732
              ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
New:   247943 ACATACATACATATATTTATGTATATTTATGTATATATATATATATATATATATGCGTAA 248002
2000-09-13YCR073W-A246199246199SubstitutionTC
 The systematic sequence was updated in the region encompassing ORF YCR073W-A. Note that coordinates listed below are chromosomal coordinates.
Old:   246195 TGCGTTGATAACTATGAAAAGGTGCTAATCCGCGGGTTTGCCGGTAGAGATTCCGTCAAA 246254
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   247463 TGCGCTGATAACTATGAAAAGGTGCTAATCCGCGGGTTTGCCGGTAGAGATTCCGTCAAA 247522
2011-02-03YCR077C250563250563SubstitutionAT
 A single nucleotide substitution in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine.
New    250560  ATGTGGTCGTTATATTCCCTTGGAGGGAAAATCAGCTGAATCTTACTTTCCAATGAAGTG  250619
               |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    250557  ATGTGGACGTTATATTCCCTTGGAGGGAAAATCAGCTGAATCTTACTTTCCAATGAAGTG  250616

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-09-13
YCR077C
249237249237DeletionG
249242249242InsertionT
250109250111DeletionAAG
 The systematic sequence was updated within ORF YCR077C. As a result, the annotated stop site was moved 1 codon upstream, reducing the length of the coding region from 2394 nt to 2391 nt. Note that coordinates listed are chromosomal coordinates.
Old:   249193 TGGTGGTTTAGCTTTCCACTTAGTGCTAAACTAGCTAGGAACTGGCCAAA-GTATGCTTC 249251
              |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
New:   250463 TGGTGGTTTAGCTTTCCACTTAGTGCTAAACTAGCTAGGAACTG-CCAAATGTATGCTTC 250521
Old:   250092 CGCATCGGGGTCAGAAGAAGGCTGTTGTCTGGGGATCTGCAGTTGTCTTCTTGGATTCTT 250151
              |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||
New:   251362 CGCATCGGGGTCAGAAG---GCTGTTGTCTGGGGATCTGCAGTTGTCTTCTTGGATTCTT 251418
2000-09-13
YCR079W
252813252813InsertionG
252844252844InsertionC
252912252912InsertionG
 The systematic sequence was updated within ORF YCR079W, causing frameshifts leading to a C-terminally altered and extended protein from amino acid 415 onward. The annotated coding region has been extended from 1308 nt to 1329 nt. Note that coordinates listed below are chromosomal coordinates.
Old:   252792 GTGGTTAGGCTTTCCAATTGGG-CAACTGGCCCAATGTTGACAGAACTGGCCCC-AAAGA 252849
              |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||
New:   254059 GTGGTTAGGCTTTCCAATTGGGGCAACTGGCCCAATGTTGACAGAACTGGCCCCCAAAGA 254118
A single nucleotide insertion has also been made immediately downstream of the newly-extended YCR079W coding region.
Old:   252910 GTG-AAACAAGTCCTAGATAATCATCTTTTGTATTTTTTTTCTTCCTTTTATTAGTATGT 252968
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   254179 GTGGAAACAAGTCCTAGATAATCATCTTTTGTATTTTTTTTCTTCCTTTTATTAGTATGT 254238
1997-07-27
YCR080W, YCR081W
253651253651SubstitutionCG
253510253510InsertionA
253494253494InsertionA
 Two single nucleotide insertions were made in Chromosome III within the ORF YCR080W to correct the systematic reference sequence: An A was inserted after the G at chromosomal coordinate 253494, and another A was inserted after the G at 253510.
New:   253473 AAACGTGGTTGCATGAATTGAGATTCGTCTCACACTTCGACTGGTCAAAATTGGCAAGTT 253532
              |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||
Old:   253473 AAACGTGGTTGCATGAATTGAG-TTCGTCTCACACTTCG-CTGGTCAAAATTGGCAAGTT 253530
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: the C at 253651 was changed to G.
New:   253653 GAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAAA 253712
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old:   253651 CAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAAA 253710
1998-02-26
YCR080W, YCR081W
253495253495DeletionA
253512253512DeletionA
253653253653SubstitutionGC
 Two single nucleotide deletions were made in the systematic sequence within ORF YCR080W: The A at chromosomal coordinate 253495 was removed, as was the A at 253512.
Old:   253472 GAAACGTGGTTGCATGAATTGAGATTCGTCTCACACTTCGACTGGTCAAAATTGGCAAGT 253531
              ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||
New:   253472 GAAACGTGGTTGCATGAATTGAG-TTCGTCTCACACTTCG-CTGGTCAAAATTGGCAAGT 253529
One single nucleotide substitution was made in the region between ORFs YCR080W and YCR081W: The G at 253653 was changed to C.
Old:   253652 AGAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAA 253711
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   253650 ACAAAAAGAAGAGGTCAAATGCTGCTGGGGCAGATGATGCCATTTCCATGCACCTGCTAA 253709
Note that while the coordinates may appear to be different, these changes are the exact reciprocals of those made on 1997-07-27, returning the systematic sequence to its original state in this region.
2000-09-13YCR088W, YCR089W265773265773SubstitutionAG
 The systematic sequence was updated in the region between ORFs YCR088W and YCR089W. Note that coordinates listed below are chromosomal coordinates.
Old:   265749 CAACAGACGGTGTGCCCGTACGGCATTGTCAAAACCTCGAACATAAAACAACACTGAAAC 265808
              |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New:   267019 CAACAGACGGTGTGCCCGTACGGCGTTGTCAAAACCTCGAACATAAAACAACACTGAAAC 267078
2000-09-13
YCR089W
268390268390SubstitutionAT
269261269262SubstitutionTTAA
 The systematic sequence was updated within ORF YCR089W. Note that coordinates listed below are chromosomal coordinates.
Old:   268389 AAGCAAACGCTTGTGCTTTCTACTGTCACAACAACGGTGAACGGTGCTGCTACGGAATAC 268448
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   269659 ATGCAAACGCTTGTGCTTTCTACTGTCACAACAACGGTGAACGGTGCTGCTACGGAATAC 269718
Old:   269229 GTCAGTACGCAAAGTTTGCCTTTGGCATTCACTTGTTCAGAAAAACGCTCCACCACATCT 269288
              ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
New:   270499 GTCAGTACGCAAAGTTTGCCTTTGGCATTCACAAGTTCAGAAAAACGCTCCACCACATCT 270558
2011-02-03YCR091W275421275421SubstitutionAG
 A single nucleotide substitution in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
New    275400  GGTGACGTAGGTAAAGTGTATTTAGTGAGGGAACGCGATACCAACCAGATATTCGCCCTG  275459
               |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    275397  GGTGACGTAGGTAAAGTGTATTTAATGAGGGAACGCGATACCAACCAGATATTCGCCCTG  275456

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-09-13
YCR091W
274147274147SubstitutionGA
275195275195InsertionC
 The systematic sequence was updated in the region encompassing ORF YCR091W, causing a frameshift leading to a C-terminally altered and shortened protein from aa 690 onward. The coding region of YCR091W had been annotated as 2181 nt long, but is now 2163 nt. Note that coordinates listed below are chromosomal coordinates.
Old:   274089 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAGT 274148
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   275359 TCAATCCTTCGAAAAAATTAGACTACTTGGCCAAGGTGACGTAGGTAAAGTGTATTTAAT 275418
Old:   275169 TATCTTAACCTACTCTGAAAATTATAC-TACGGAAAAATTCTATACAAAGCAACTTGTAC 275227
              ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   276439 TATCTTAACCTACTCTGAAAATTATACCTACGGAAAAATTCTATACAAAGCAACTTGTAC 276498
2000-09-13YCR093W282731282731SubstitutionCT
 The systematic sequence was updated within ORF YCR093W. Note that coordinates listed below are chromosomal coordinates.
Old:   282728 GTTCAACTCAGCCTCAGCAACAACAAGCGCAAATGCCTACCCAAATCCTAACCTCCGAAC 282787
              ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   283999 GTTTAACTCAGCCTCAGCAACAACAAGCGCAAATGCCTACCCAAATCCTAACCTCCGAAC 284058
2000-09-13
YCR102C, YCR102W-A
304543304543InsertionA
304740304740InsertionA
 The systematic sequence was updated in the region between ORFs YCR102C and YCR102W-A. Note that coordinates listed below are chromosomal coordinates.
Old:   304505 CGGGCGGATCCGAGACATCTTAGTCAGCTGAGACAAGAA-GGCACAGCTCTCGGACAGGA 304563
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
New:   305776 CGGGCGGATCCGAGACATCTTAGTCAGCTGAGACAAGAAAGGCACAGCTCTCGGACAGGA 305835
Old:   304684 TGAACTATTGTTAATTGTATGGCGTGTGGCCTTGCTATTTCAGCAAATTTAGAGTAA-GT 304742
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
New:   305956 TGAACTATTGTTAATTGTATGGCGTGTGGCCTTGCTATTTCAGCAAATTTAGAGTAAAGT 306015
2000-09-13
YCR102W-A, YCR104W
305908305908InsertionC
305943305943InsertionG
306173306173SubstitutionGT
 The systematic sequence was updated in the region between ORFs YCR102W-A and YCR104W. Note that coordinates listed are chromosomal coordinates.
Old:   305883 GAACATCAACTTCTCTCAATACCATC-GCCTTCAGCGGCTACAATTACGTAATTGCACCA 305941
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New:   307156 GAACATCAACTTCTCTCAATACCATCCGCCTTCAGCGGCTACAATTACGTAATTGCACCA 307215
Old:   305942 AG-CATTCGCCGAGAGTTTACATATTTGCAGACCCTAACAGTATACGACTCCCAACACAC 306000
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   307216 AGGCATTCGCCGAGAGTTTACATATTTGCAGACCCTAACAGTATACGACTCCCAACACAC 307275
Old:   306121 TATTCTTTTTGACCGAAAGCGGAAACTTCACAGGCGCGCGTAAAAGGGTTTTGCAAGGCA 306180
              |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
New:   307396 TATTCTTTTTGACCGAAAGCGGAAACTTCACAGGCGCGCGTAAAAGGGTTTTTCAAGGCA 307455
2000-09-13YCR104W, YCR105W307323307323DeletionT
 The systematic sequence was updated in the region between ORFs YCR104W and YCR105W. Note that coordinates listed are chromosomal coordinates.
Old:   307321 TTTCGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 307380
              || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   308596 TT-CGTCTCCTGTTATACGAATATTTGCATTTCTGTGCCTACTTATGTGTGTATATGTTT 308654
2000-09-13YCR105W, YCR106W309312309312SubstitutionGA
 The systematic sequence was updated in the region between ORFs YCR105W and YCR106W. Note that coordinates listed below are chromosomal coordinates.
Old:   309301 ATCATGCTTTTGCTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 309360
              ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New:   310575 ATCATGCTTTTACTTCGAAATCTAGAGTCCGAGCATGTCTGATGAGGTCCTCTTAAAGCA 310634
2000-09-13YCR107W312725312725SubstitutionTA
 The systematic sequence was updated within ORF YCR107W. Note that coordinates listed below are chromosomal coordinates.
Old:   312721 GAGCTCGTTCGGATTTTCTCAAATCAATGAACAAGAATCGAGCTTTTGAATTGCTTGATA 312780
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   313995 GAGCACGTTCGGATTTTCTCAAATCAATGAACAAGAATCGAGCTTTTGAATTGCTTGATA 314054
2000-09-13
YCRWdelta11, tQ(UUG)C
168933168933InsertionA
169071169071SubstitutionGA
169110169110InsertionA
169250169250SubstitutionGA
169259169259SubstitutionTC
169337169337SubstitutionGC
169454169454SubstitutionGA
168967168967SubstitutionCT
 The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   168903 AGGTAAATAAATCGAGCTAAGAGAAAAAAAA-GTATAGGCAAAATTCCGACCGGAGCTAG 168961
              ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New:   170204 AGGTAAATAAATCGAGCTAAGAGAAAAAAAAAGTATAGGCAAAATTCCGACCGGAGCTAG 170263
Old:   168962 CTTTACCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 169021
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170264 CTTTATCTTGCTCCTCCACCTAAGTCACCTGCTCAGGTCACTCAAGTTCACAATCTTCTG 170323
Old:   169022 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAGTTGTCTGTGG 169081
              ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New:   170324 AGAGGATAGATAAAGGAAAAATTGGAACAGATCTTTTCATGGCCTGGCAATTGTCTGTGG 170383
Old:   169082 ATTGGTAAAGCTCTGTCAGTGAAAAAAAA-GTTCTCGCTCCTTCTTGGTCTCTTCTATTT 169140
              ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New:   170384 ATTGGTAAAGCTCTGTCAGTGAAAAAAAAAGTTCTCGCTCCTTCTTGGTCTCTTCTATTG 170443
Old:   169201 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAGTTAGTTGATT 169260
              ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
New:   170504 ATAATCTTGAAATTTGAAGTTTCTAAAATGCATCAGACATGGTGTCGTAATTAGTTGACT 170563
Old:   169321 AAAATACTTACTAAACGTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 169380
              |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
New:   170624 AAAATACTTACTAAACCTTTTCGAATAAGTTAGCAAGAAGCTTTTAAAAACATAGACTTA 170683
Old:   169441 TGCATGATGAAAAGCTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 169500
              ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
New:   170744 TGCATGATGAAAAACTAAGTAGACCTCTTTAGAAGTGTCTTAGCGGCTATTGTTCATGAT 170803
2000-09-13
YCRWdelta11
169686169686SubstitutionCT
169575169575SubstitutionTC
 The systematic sequence was updated in the region encompassing feature YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   169561 AGAATCGAATGTATTTATCGGAAAGGATTTGAAATTTCGGCCATTTCCTCATTATGAAGT 169620
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
New:   170864 AGAATCGAATGTATCTATCGGAAAGGATTTGAAATTTCGGCCATTTCCTCATTATGAAGT 170923
Old:   169681 TCTTCCCCGGGCATGTCATTAGCATCTATATAAGGAACCTGTTTCTTAGACAAATTCTCT 169740
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170984 TCTTCTCCGGGCATGTCATTAGCATCTATATAAGGAACCTGTTTCTTAGACAAATTCTCT 171043
2000-09-13
YCRWdelta11, tQ(UUG)C
168368168368SubstitutionCA
168442168442SubstitutionTG
168465168465SubstitutionCG
168541168541SubstitutionCG
168682168682SubstitutionTC
168685168685SubstitutionTC
168787168787SubstitutionAG
168881168881SubstitutionCT
 The systematic sequence was updated in the region encompassing features tQ(UUG)C and YCRWdelta11. Note that coordinates listed are chromosomal coordinates.
Old:   168363 CAGTCCTCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 168422
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   169664 CAGTCATCAAACCTAATGGAAGCGAAATGCAGGGATTGATAATGTAATAAGATAATGAAA 169723
Old:   168423 CATAAGAAACAGAAGGTAGTAGTATTATTATGTAGAAATACCCATTCCATTTTAAGGATT 168482
              ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||
New:   169724 CATAAGAAACAGAAGGTAGGAGTATTATTATGTAGAAATACCGATTCCATTTTAAGGATT 169783
Old:   168483 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACACT 168542
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   169784 CCTATGTCCTCGAGTAGAACGTCTAGTATATACGAAATATTATACCCTTTAAAAAACAGT 169843
Old:   168663 CTGATCTCCCAATGAAGAATTGTGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 168722
              ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||
New:   169964 CTGATCTCCCAATGAAGAACTGCGTCAGGTCATCTCGTCCTCAATTTCTAACCAAAATTG 170023
Old:   168783 CACAACACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 168842
              |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   170084 CACAGCACGGTAAACCAACTTGTGTCATATTTAAGAGAAATATTAAAACGCTAAGAAGAT 170143
Old:   168843 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGCCCAACTGCAGAAGTTAAATAA 168902
              |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New:   170144 AGCTCCCATAATAGAAGTACAAGTTATATTTATCGTTGTCCAACTGCAGAAGTTAAATAA 170203
2000-09-13snR189177328177328SubstitutionTG
 The systematic sequence was updated within feature snR189. Note that coordinates listed are chromosomal coordinates.
Old:   177327 ATGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 177386
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   178591 AAGAATAGAGATGTCAGGCCCGTGTGAAGTACTTGAAAGTAATAAGTGAGTATATAGAAT 178650
2000-09-13
snR33
142388142388SubstitutionGA
142397142498DeletionAAGAAAAGCAAAAAACATATTAGCC GATAATTTCTATTTTATAAGTAAAA ACATTGGTGAGATAGTGGTAAAGAG TTAGATAATTATTGGGATTCCATTG TT
142301142301DeletionA
142279142281DeletionAAC
142202142202SubstitutionTC
142186142186SubstitutionCT
142178142178SubstitutionGA
142173142173InsertionA
142154142154DeletionT
142382142382SubstitutionAC
 The systematic sequence was updated in the region upstream of feature snR33. Note that coordinates listed are chromosomal coordinates.
Old:   142151 TTTTAATTCTTATGAAAAAAAAA-TGTGGAAGAGAGCAGAAAATTTTCATAATGAATCTC 142209
              ||| ||||||||||||||||||| |||| ||||||| ||||||||||||||| |||||||
New:   142546 TTT-AATTCTTATGAAAAAAAAAATGTGAAAGAGAGTAGAAAATTTTCATAACGAATCTC 142604
Old:   142270 AAAAAAAAAAACTAGTATATAAAGTAAAAAAAGATGCGCAAGCCCGGAATCGAACCGGGG 142329
              |||||||||   ||||||||||||||||||| ||||||||||||||||||||||||||||
New:   142665 AAAAAAAAA---TAGTATATAAAGTAAAAAA-GATGCGCAAGCCCGGAATCGAACCGGGG 142720
Old:   142330 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATATTGATGC 142389
              |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
New:   142721 GCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTAGTAATCTTGATAC 142780
Old:   142390 ATTATTCAAGAAAAGCAAAAAACATATTAGCCGATAATTTCTATTTTATAAGTAAAAA 142447
              |||||||
New:   142781 ATGATTC--------------------------------------------------- 142787
Old:   142448 CATTGGTGAGATAGTGGTAAAGAGTTAGATAATTATTGGGATTCCATTGTTGAGAAAAGCAATAATATTATGTA 142521
                                                                 |||||||||||||||||||||||
New:   142787 ---------------------------------------------------GAGAAAAGCAACAATATTATGTA 142810
2000-09-13snR33142098142098SubstitutionCG
 The systematic sequence was updated within feature snR33. Note that coordinates listed are chromosomal coordinates.
Old:   142091 AAATTACCTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142150
              ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
New:   142486 AAATTACGTAAATAATTTTAGAGTGACACCATCGTACAAAGAGGGCATTAAGCTTATTTT 142545
2000-09-13
snR43
107595107595DeletionT
107522107522InsertionA
107612107612InsertionG
 The systematic sequence was updated in the region encompassing feature snR43. Note that coordinates listed are chromosomal coordinates.
Old:   107467 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAA-TAA 107525
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
New:   107852 TTTAAAGTAATTTCTTCTTTTTTTATAGTGAGAAATCTCAAAAGAAAAAAAAAAAAATAA 107911
Old:   107586 TCAGCAACTTGTAGGAGGAGAAAGCAG-TATATAACTAGCCGCAATATGTTTGTGGTGGA 107644
              ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
New:   107972 TCAGCAACT-GTAGGAGGAGAAAGCAGGTATATAACTAGCCGCAATATGTTTGTGGTGGA 108030
2000-09-13tN(GUU)C127750127750InsertionC
 The systematic sequence was updated in the region encompassing feature tN(GUU)C. Note that coordinates listed are chromosomal coordinates.
Old:   127693 CTTTACTTGGAGTTTCGATTTTAAGAATTTTTTATCATTTTTTTTTTTTGACGATTTC-T 127751
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
New:   128086 CTTTACTTGGAGTTTCGATTTTAAGAATTTTTTATCATTTTTTTTTTTTGACGATTTCCT 128145
2000-09-13tQ(UUG)C168331168335DeletionAGGTG
 The systematic sequence was updated in the region encompassing feature tQ(UUG)C. Note that coordinates listed are chromosomal coordinates.
Old:   168303 TGCTACTAGCATTTTATCACATGAGGTGAGGTGTAAGAAGATGACATAAAGATTGAGATA 168362
              ||||||||||||||||||||||||||||     |||||||||||||||||||||||||||
New:   169609 TGCTACTAGCATTTTATCACATGAGGTG-----TAAGAAGATGACATAAAGATTGAGATA 169663

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2014-11-18ARS314, ARS315, ARS316
 New ARS consensus sequences were annotated within the following ARS elements on Chromosome III based on Liachko et al. 2013: ARS314, ARS315, ARS316.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-18ARS300, ARS305, ARS307, ARS309, ARS313, ARS314, ARS317, ARS318, ARS319
 The chromosomal coordinates of the following ARS elements on Chromosome III were updated based on Liachko et al. 2013: ARS300, ARS305, ARS307, ARS309, ARS313, ARS314, ARS317, ARS318, ARS319.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-18YCL054W-A
 RDT1/YCL054W-A was added to the genome annotation based on Wilson and Masel 2011.

Wilson BA and Masel J (2011) Putatively noncoding transcripts show extensive association with ribosomes. Genome Biol Evol 3():1245-52
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2009-02-19ARS318
 The position of the annotated ACS within ARS318 was updated based on Chang et al. 2008.

Chang F, et al. (2008) Analysis of chromosome III replicators reveals an unusual structure for the ARS318 silencer origin and a conserved WTW sequence within the origin recognition complex binding site. Mol Cell Biol 28(16):5071-81
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2008-06-04YCLWdelta15
 Carol Newlon identified an additional delta element on Chromosome III. This delta element is present in the current Chromosome III sequence, but was not in Newlon's clone A5C, which was used to generate the original Chromosome III sequence. The new delta element is being named YCLWdelta15, and is between tE(UUC)C and YCLCdelta1.

Newlon C (2008)
SGD Papers Entry  

2008-03-05YCRCtau1
 YCRCtau1 was erroneously annotated on the Watson strand instead of the Crick strand. This error has been corrected. Thank you to Douda Bensasson from bringing this mistake to our attention.

Bensasson D (2008)
SGD Papers Entry  

2007-12-14HML, HMR, MATALPHA
 The W, X, Y, Z1 and Z2 regions of the mating-type loci (HML, MAT, and HMR cassettes) were annotated based on Abraham et al. 1984, Astell et al. 1981, Tatchell et al. 1981, and Wang et al. 2001.

Astell CR, et al. (1981) The sequence of the DNAs coding for the mating-type loci of Saccharomyces cerevisiae. Cell 27(1 Pt 2):15-23
SGD Papers Entry  Pubmed Entry  DOI full text  
Abraham J, et al. (1984) Regulation of mating-type information in yeast. Negative control requiring sequences both 5' and 3' to the regulated region. J Mol Biol 176(3):307-31
SGD Papers Entry  Pubmed Entry  DOI full text  
Tatchell K, et al. (1981) In vitro mutation analysis of the mating-type locus in yeast. Cell 27(1 Pt 2):25-35
SGD Papers Entry  Pubmed Entry  DOI full text  
Wang Y, et al. (2001) DNA replication forks pause at silent origins near the HML locus in budding yeast. Mol Cell Biol 21(15):4938-48
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2007-09-06YCR092C
 Based on experimental evidence published by Harrington and Kolodner, the start site for MSH3/YCR092C was moved 84 nt (28 codons) downstream. This change is consistent with that predicted by Kellis et al.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Harrington JM and Kolodner RD (2007) Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs. Mol Cell Biol 27(18):6546-54
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2007-04-02YCLCdelta1, YCRCdelta14, YCRCdelta6, YCRCdelta7
 The following LTRs on Chromosome III were mistakenly annotated in the wrong direction (i.e., on the Watson strand instead of Crick), and the error has now been corrected: YCLCdelta1, YCRCdelta6, YCRCdelta7, YCRCdelta14. Thanks go to Marc Gartenberg for bringing this annotation error to our attention.
2007-03-06ARS317
 The ACS annotation was added based on Xu et al. 2006 and Brand et al. 1987.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Brand AH, et al. (1987) A yeast silencer contains sequences that can promote autonomous plasmid replication and transcriptional activation. Cell 51(5):709-19
SGD Papers Entry  Pubmed Entry  DOI full text  

2006-09-06ARS313, ARS314, ARS315, ARS316
 The coordinates of the following ARS elements on Chromosome III were updated based on Nieduszynski et al. 2006: ARS313, ARS314, ARS315, ARS316.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-01-11YCL058W-A
 YCL058W-A was originally added per Brachat et al., based on conservation with Ashbya gossypii. Kellis et al. also predicted a protein in the same frame, but with a 19 amino acid N-terminal deletion relative to the ORF predicted by Brachat et al. SGD has changed the annotation to that predicted by Kellis et al., based on conservation of that start site in sensu stricto strains of Saccharomyces.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2005-11-14YCL048W-A
 Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that a new ORF, YCL048W-A, be added to the S. cerevisiae genome annotation. This suggestion was later confirmed by Zhang and Dietrich 2005 using high-throughput identification of transcription start sites.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2004-10-12CEN3
 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-08-27YCR095W-A
 The ORF YCR095W-A was added per Oshiro et al. 2002.

Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2003-09-27YCL002C
 Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for YCL002C. The resulting ORF is in the same frame, but has a 99-residue extension at the N-terminus.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YCL037C
 Based on the automated comparison of closely-related Saccharomyces species in Kellis et al. 2003, the start site for SRO9/YCL037C was moved 96 nt (32 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL03L, TEL03R
 The chromosomal locations for the following telomeric features were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL03L, TEL03L-XC, TEL03L-XR, TEL03L-TR, TEL03R, TEL03R-XC, TEL03R-XR, TEL03R-TR.
2003-07-29YCR108C
 Thanks to Kessler et al. for providing the coordinates of ORF YCR108C.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YCL005W-A, YCL058W-A, YCR075W-A
 Thanks to Brachat et al. 2003 for providing the coordinates of the following ORFs on Chromosome III: YCL005W-A, YCL058W-A, YCR075W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YCR045W-A, YCR047W-A, YCR081C-A
 Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome III: YCR045W-A, YCR047W-A, YCR081C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

2000-12-01YCL024W
 The stop site of ORF YCL024W was moved 366 nt downstream, changing the relative coding coordinates from 1-2748 to 1-3114. Chromosomal coordinates change from 79125-81872 to 79161-82274.
2000-12-01YCL008C
 The start site of YCL008C was moved 252 nt upstream, and the stop site was moved 179 nt downstream, increasing the size of the coding region from 360 nt to 891 nt. The chromosomal coordinates have changed from 106208-105849 to 106849-105959.
2000-12-01YCL010C
 The stop site of YCL010C was moved 339 nt upstream, increasing the size of the coding region from 441 nt to 780 nt. The chromosomal coordinates have changed from 103995-103515 to 104345-103566.
2000-10-13YCR103C
 YCR103C was originally annotated as an ORF, but upon further review was removed from the genome annotation.
2000-09-14YCL021W-A, YCL026C-B, YCL057C-A
 The following ORFs were added after the MIPS ChrIII sequence update: YCL021W-A, YCL026C-B, YCL057C-A.
2000-09-14YCR061W, YCR062W
 After resequencing and annotation of Chromosome III, ORF YCR062W has been merged into neighboring ORF YCR061W. The coding region of YCR061W had been 1752 nt long, but is now 1896 nt in length.
2000-09-13YCRCdelta7
 YCRCdelta7 was shortened from 380 bp to 323 bp, a net decrease of 57 bp.
2000-09-13YCL025C
 The stop site of ORF YCL025C was moved 114 nt upstream, changing the relative coding coordinates from 1-1902 to 1-1788. Chromosomal coordinates change from 77886-75985 to 77918-76131.
2000-08-16YCL006C
 YCL006C was deleted as a result of a sequence change that created a stop codon after residue 23.
2000-08-11YCR069W
 Old name: YCR070W; new name: YCR069W; date: 2/15/2000; old coord: ChrIII; SGDID: Unknown; YCR070W incorporated into YCR069W
2000-02-10YCL003W, YCL004W
 YCL003W was originally annotated as an independent ORF, but as a result of a sequence change, it was merged with an adjacent ORF into a single reading frame, designated YCL004W. YCL004W + YCL003W = YCL004W from MIPS.
1999-07-17YCL012W
 The stop site of ORF YCL012W was moved 137 nt downstream, lengthening the coding region from 459 nt to 696 nt. Chromosomal coordinates change from 100110-100568 to 100113-100808.
1999-07-17YCL054W
 The stop site of ORF YCL054W was moved 351 nucleotides downstream, increasing the length of the coding sequence from 2175 nt to 2526 nt.
1999-07-17YCL053C
 ORF YCL053C has been deleted due to a sequence correction.
1999-07-17YCL039W
 The start site of ORF YCL039W was moved 42 nucleotides downstream, reducing the length of the coding sequence from 2280 nt to 2238 nt.
1999-07-17YCL024W
 The stop site of ORF YCL024W was moved 297 nt downstream, changing the relative coding coordinates from 1-2451 to 1-2748. Chromosomal coordinates change from 79119-81569 to 79125-81872.
1999-07-17YCL021W
 ORF YCL021W was deleted as a result of corrections to the systematic sequence.
1999-07-17YCL013W
 The ORF YCL013W has been deleted as a result of updates to the systematic sequence.
1998-12-21YCL026C
 ORF YCL026C was deleted due to a sequence correction.
1998-07-24YCL060C, YCL061C
 Due to several sequence changes in the region encompassing ORFs YCL060C and YCL061C, YCL060C has been merged into adjacent ORF YCL061C.
1998-07-24YCL062W, YCL063W
 Due to several sequence changes in the region encompassing ORFs YCL062W and YCL063W, YCL062W has been merged into adjacent ORF YCL063W. The coding region of YCL063W had been 387 nt long, and is now 1272 nt in length.
1998-07-24YCR029C-A, YCR030C
 ORF YCR029C-A has been merged into neighboring ORF YCR030C. The coding region YCR030C had been annotated as 1974 nt long, but is now 2613 nt in length.
1998-07-24YCR029C
 ORF YCR029C has been deleted from the genome annotation due to sequence correction.
1998-07-24YCR080W, YCR081W
 YCR080W was originally annotated as an independent ORF, but upon further review was merged with neighboring ORF YCR081W. As a result, the annotated start site of YCR081W was moved 603 nt upstream, increasing the coding region of YCR081W in length from 3681 nt to 4284 nt.
1998-07-24YCR070W
 ORF YCR070W has been deleted from the genome annotation.
1998-07-24YCR055C, YCR057C, YCR058C
 ORFs YCR055C and YCR058C were merged with existing ORF YCR057C. The coding region of YCR057C had been 1320 nt long, but is now 2772 nt in length.
1998-07-24YCR056W
 ORF YCR056W was deleted from the genome annotation due to sequence correction.
1998-07-24YCR074C
 YCR074C was originally annotated as an ORF, but upon further review was removed from the genome annotation.
1998-05-30YCLX01W, YCLX02C, YCLX03C, YCLX04W, YCLX05C, YCLX06C, YCLX07W, YCLX09W, YCLX10C, YCLX11W, YCLX12W, YCRX01W, YCRX02C, YCRX03C, YCRX04W, YCRX05W, YCRX06W, YCRX07W, YCRX08W, YCRX09C, YCRX10W, YCRX11W, YCRX12W, YCRX14W, YCRX15W, YCRX16C, YCRX17W, YCRX18C, YCRX19W, YCRX20C, YCRX21C
 The following putative ORFs were originally included in the annotation of Chromosome III, but were later withdrawn: YCLX01W, YCLX02C, YCLX03C, YCLX04W, YCLX05C, YCLX06C, YCLX07W, YCLX09W, YCLX10C, YCLX11W, YCLX12W, YCRX01W, YCRX02C, YCRX03C, YCRX04W, YCRX05W, YCRX06W, YCRX07W, YCRX08W, YCRX09C, YCRX10W, YCRX11W, YCRX12W, YCRX14W, YCRX15W, YCRX16C, YCRX17W, YCRX18C, YCRX19W, YCRX20C, and YCRX21C.

SGD (1998) Putative ORF Annotations on Chromosome III
SGD Papers Entry  

1998-05-21YCR018C-A, YCR102W-A
 The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  

1998-05-21YCL001W
 The start site of ORF YCL001W was moved 159 nt downstream.
1997-07-26YCR097W-A, YCR097WA
 The original YCR097W-A ORF (SGDID: S0000693) was deleted because: HMRA1/YCR097W contains two introns and the 3'' intron is spliced less efficiently but probably does NOT create an alternative form of the protein. Because there is no evidence for a functional protein at the original YCR097W-A coordinates, this ORF was deleted.

Note that a new ORF with the same name (YCR097W-A, SGDID: S0007632) has been added because of homology to a hemiascomycetous yeast protein, but that these two ORFs (the original vs the new YCR097W-A) are completely different, except that they have the same name.

Jump to: Sequence Changes | Annotation Changes without Sequence Changes