Chromosome IV History Help


This page lists all sequence and annotation changes that have been made to the Chromosome IV systematic reference sequence since its intial release on 1996-07-31.

SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

Date Affected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of ChangeOld SequenceNew Sequence
 The first 45 nucleotides of YDL048C (from chromosomal coordinates 368211-368255) were deleted, leaving translation unaffected. This chunk was tandemly-duplicated in error.
Old: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210
New: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210

Old: 368211 cattactgagtcaatgcttgatgcaaaagatgatgataccagcataggggaagccaaaga 368270
New: 368211 ---------------------------------------------aggggaagccaaaga 368225
 The T at coordinate 1400863 within YDR470C was replaced with a C (tgtCcaa). This results in a replacement of a Glu (GAA) with a Gly (GGA) on the Crick strand where the gene is located. This change was sent to SGD by Hartmut Wohlrab (

             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||

Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18
SGD Papers Entry  Pubmed Entry  DOI full text  

 Due to the deletion of 16 nt between 1437732-1437747, which had been tandemly duplicated in error, the coordinates of RSM28/YDR494W have been changed. The 16 nucleotides that were removed were near the 3' end of YDR494W, shifting the stop 235 nt downstream, for a net increase in length of 219 nt (from 867 nt to 1086 nt). See GenBank accession number AF459095. Thanks to Tom Fox for reporting this sequence error to SGD.
Old: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731
New: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731

Old: 1437732 gatcctccttgatttttgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437791
New: 1437732 ----------------tgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437775
 Due to the deletion of G at 1117105, the start for YDR325W has been moved 48 nt downstream from 1117069 to 1117116. The stop has not been changed. Thanks to Denise Bertsch for reporting this sequence error to SGD.
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||

Lavoie BD, et al. (2002) In vivo dissection of the chromosome condensation machinery: reversibility of condensation distinguishes contributions of condensin and cohesin. J Cell Biol 156(5):805-15
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

YDR474C, YDR475C
 Due to insertion of G at position 1409511 and a C at position 1409657, YDR474C and JIP4/YDR475C have been merged. After merging YDR474C (1409119 - 1407452 (1-1668)) and JIP4/YDR475C (1410080 - 1409613 (1-468)), the coordinates of the merged ORF, JIP4/YDR475C, are 1410082 - 1407452 (1-2631). YDR474C is now an alias of JIP4/YDR475C. This sequence change was verified in strain S288C by SGD.
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
SGD Papers Entry  Pubmed Entry  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggested that the stop site for YDR359C be moved 67 nt downstream. Jacques Cote and colleagues resequenced S288C, W303, and BY4741 and confirmed the deletion of a single A nt (see GenBank accession AY464182). As a consequence of this sequence change, the stop of YDR359C was moved 70 nt downstream, increasing the size of the predicted protein from 959 to 982 amino acids.
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

 Although the systematic sequence for TRP1/YDR007W originally contained a nonsense (ochre) mutation at codon 67, systematic reference strain S288C does not actually contain this mutation in TRP1, which was introduced during the creation of strain AB972. AB972 is an ethidium bromide-induced derivative of the strain X2180-1B-trp1, which was supplied by E. Jones [M.V. Olson]. The lineage of AB972 traces directly to the strain S288C with no intervening outcrosses. The strain AB972 was the origin of the clone used for sequencing this segment of chromosome IV. In order to more accurately present this region of within the S288C reference strain, SGD has sequenced the S288C TRP1 locus and did not find the internal STOP codon. Thus, SGD has updated the TRP1 sequence by changing the previously annotated internal STOP (TAA) to serine (TCA).
            ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
 Kellis et al. 2003 predicted and confirmed the insertion of a single A nt. As a consequence of this sequence change, PCL2/YDL127W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 279 to 308 amino acids.
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

 The work of Brachat et al. 2003 predicted insertion of a single nucleotide upstream of YDR179W-A; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR179W-A was extended at the 5' end, altering the N-terminus without changing the translation frame and increasing the size of the predicted protein from 268 to 463 amino acids.
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The work of Kellis et al. 2003 predicted insertion of a single nucleotide within the coding region of YDR031W; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR031W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 117 to 121 amino acids.
            ||||||||||||||||||||||||||||||||||||| |||||||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

 SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, RRP8/YDR083W has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 383 to 392 amino acids.
Insert a G after the G at 613206

            |||||||||||||||||||| |||||||||||||||||

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

 A sequence error in the SGD sequence has been corrected: a single C was inserted in between the G at chromosomal coordinate 478023 and the C at 478024 on chromosome IV (what was three Cs is now 4 Cs). This makes the ORF of YDR015C shorter (79 amino acids) than what was originally annotated (129 aa).
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||

Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  SGD Curated Comments & Errata

2008-06-05YDL038C, YDL039C382381382381InsertionG
 Greg Prelich's lab discovered an error in the systematic reference sequence for Chromosome 4. This error was verified in the S288C strain background. Therefore, the following correction was made: insert a G after the G at 382381.
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
As a result of this change, ORF YDL038C was merged into ORF PRM7/YDL039C. The new longer ORF is 2097 nt long. The name YDL038C is being retained as an alias for PRM7/YDL039C.

Prelich G (2008)
SGD Papers Entry  

YDL047W, YDL048C
369163369163Insertion G
369180369180Insertion A
 Two separate single nucleotide insertions were made in the intergenic region between ORFs STP4/YDL048C and SIT4/YDL047W.
                |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL069C, YDL070W332995332995Insertion A
 A single nucleotide insertion was made in the intergenic region between ORFs BDF2/YDL070W and CBS1/YDL069C.
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL071C, YDL072C330573330573DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs YET3/YDL072C and YDL071C.
                ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR043C, snR47542033542033DeletionA
 A single nucleotide deletion was made in the intergenic region between snoRNA SNR47 and ORF NRG1/YDR043C.
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR300C, YDR301W10630291063029SubstitutionCA
 A single nucleotide substitution was made in the intergenic region between ORFs PRO1/YDR300C and CFT1/YDR301W.
                |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL033C, YDL034W392616392616SubstitutionAG
 A single nucleotide substitution was made in the intergenic region between ORFs YDL034W and SLM3/YDL033C.
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR541C, YDRWdelta3115195991519599SubstitutionCG
 A single nucleotide substitution was made in the intergenic region between Ty1 LTR YDRWdelta31 and ORF YDR541C.
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR310C, YDR311W10845341084534DeletionA
 A single nucleotide deletion was made in the intergenic region between ORFs SUM1/YDR310C and TFB1/YDR311W.
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR059C, YDR060W569994569994Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs UBC5/YDR059C and MAK21/YDR060W.
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR062W, YDR063W578232578232DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs LCB2/YDR062W and AIM7/YDR063W.
                ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR072C, YDR073W592033592033Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs IPT1/YDR072C and SNF11/YDR073W.
                ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR324C, YDR325W11171101117110Insertion GG
 A dinucleotide insertion was made in the intergenic region between ORFs UTP4/YDR324C and YCG1/YDR325W.
                ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR334W, YDR335W11406971140697Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs SWR1/YDR334W and MSN5/YDR335W.
                ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL137W, YDL138W215996215996Insertion C
 A single nucleotide insertion was made in the intergenic region between ORFs RGT2/YDL138W and ARF2/YDL137W.
                |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL182W, YDL183C132292132292SubstitutionTA
 A single nucleotide substitution was made in the intergenic region between ORFs YDL183C and LYS20/YDL182W.
                ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL183C, YDL184C130626130626SubstitutionTA
 A single nucleotide substitution was made in the intergenic region between ORFs RPL41A/YDL184C and YDL183C.
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL234C, YDL235C3400834008DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs YPD1/YDL235C and GYP7/YDL234C.
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR533C, YDR534C15027251502725Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs HSP31/YDR533C and FIT1/YDR534C.
                |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL039C, YDL040C381865381865DeletionT
 A single nucleotide deletion was made in the intergenic region between ORFs NAT1/YDL040C and PRM7/YDL039C.
                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDL046W, YDL047W371114371114Insertion A
 A single nucleotide insertion was made in the intergenic region between ORFs SIT4/YDL047W and NPC2/YDL046W.
                |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR536W, YDR538W15098851509885Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs STL1/YDR536W and PAD1/YDR538W.
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

YDR539W, YDR540C
15168191516819Insertion T
 Several small sequence changes were made in the intergenic region between ORFs FDC1/YDR539W and IRC4/YDR540C.
                |||||||||||||||   ||| ||||||| ||||||||||||||||||  | ||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR541C, YDR542W15225011522501DeletionT
 A single nucleotide deletion was made in the intergenic region between ORF YDR541C and PAU10/YDR542W.
                ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of UGO1/YDR470C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 114 is now Glutamic Acid rather than Glycine.
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of LRG1/YDL240W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 531 is now Glutamine rather than Histidine.
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

396410396410Insertion T
 Nucleotide changes within the coding region of DBP10/YDL031W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 733-741 are now SHSIEDEIL rather than HILSKMKFW, residue 746 is now Glycine rather than Valine, and residue 764 is now Aspartic Acid rather than Histidine.
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||

                |||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||

                ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

402661402661Insertion T
 Nucleotide changes within the coding region of MPS1/YDL028C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 211-213 are now TKR rather than RRE.
                |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of SEC31/YDL195W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Threonine rather than Serine.
                |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of ERD1/YDR414C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 168 is now Alanine rather than Glycine.
                ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Two nucleotide substitutions within the coding region of POL3/YDL102W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 78-79 are now EL rather than DV.
                |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of PSP1/YDR505C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 532 is now Lysine rather than Glutamic Acid.
                |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of AIM6/YDL237W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 44 is now Asparagine rather than Aspartic Acid.
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of ADY3/YDL239C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 569 is now Glutamic Acid rather than Glycine.
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 A single nucleotide substitution within the coding region of YDR541C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Glutamine rather than Glutamic Acid.
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Two nucleotide substitutions within the coding region of RBA50/YDR527W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 192-194 are now EEA rather than GEG.
                ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR350C11763951176395Insertion C
 A single nucleotide was inserted within ORF ATP22/YDR350C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 73 amino acids longer.
                |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR360W11949551194955Insertion C
 A single C nucleotide was inserted within ORF OPI7/YDR360W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
                ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 Two nucleotide substitutions in the coding region of UFD2/YDL190C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Leucine rather than Serine, and residue 677 is now Valine rather than Aspartic Acid. A third nucleotide substitution did not affect the protein sequence.
                ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||

                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||

                |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YDR215C894308894308Insertion G
 A single C nucleotide was inserted within ORF YDR215C, altering its coding sequence. The start and first half of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 10 amino acids longer.
                ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
 The chromosomal coordinates of the ARS consensus sequence annotated within ARS404 were updated based on Liachko et al. 2013.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-18ARS400, ARS403, ARS405, ARS406, ARS409, ARS410, ARS412, ARS413, ARS417, ARS419, ARS421, ARS422, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS440, ARS446, ARS451
 New ARS consensus sequences were annotated within the following ARS elements on Chromosome IV based on Liachko et al. 2013: ARS400, ARS403, ARS405, ARS406, ARS409, ARS410, ARS412, ARS413, ARS417, ARS419, ARS421, ARS422, ARS451, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS440, ARS446.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-18ARS404, ARS409, ARS412, ARS415, ARS416, ARS417, ARS418, ARS419, ARS420, ARS421, ARS423, ARS430, ARS431, ARS435, ARS453
 The chromosomal coordinates of the following ARS elements on Chromosome IV were updated based on Liachko et al. 2013: ARS404, ARS409, ARS412, ARS415, ARS416, ARS417, ARS418, ARS419, ARS420, ARS421, ARS423, ARS430, ARS431, ARS453, ARS435.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 ARS409.5 was added to the genome annotation based on Liachko et al. 2013.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The feature_type annotation of YDR134C was changed from pseudogene to blocked_reading_frame (SO:0000718) as part of SGD's genome annotation revision R64.2.
 The annotated translation start for GRX3/YDR098C was moved 105 nt downstream to what was previously Met36, based on Li et al. 2009.
Old chromosomal coords: 645035..644178     Old relative coords: 1..858
New chromosomal coords: 644930..644178     New relative coords: 1..753

Li H, et al. (2009) The yeast iron regulatory proteins Grx3/4 and Fra2 form heterodimeric complexes containing a [2Fe-2S] cluster with cysteinyl and histidyl ligation. Biochemistry 48(40):9569-81
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2014-11-18ETC1, ETC6
 The following previously unmapped features were identified as nuclear matrix attachment sites and assigned chromosomal coordinates based on Hiraga et al. 2012: ETC1, ETC2, ETC3, ETC4, ETC6, ETC7, ETC8.

Hiraga SI, et al. (2012) TFIIIC localizes budding yeast ETC sites to the nuclear periphery. Mol Biol Cell 23(14):2741-54
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2009-05-07ARS411, ARS412, ARS415, ARS420, ARS427, ARS436, ARS439, ARS442
 The following ARS elements on Chromosome 4 were added to the genome annotation based on Raveendranathan et al. 2006: ARS411, ARS412, ARS415, ARS420, ARS427, ARS436, ARS439, and ARS442.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

 The start of ORF IWR1/YDL115C was moved 409 nt upstream and an intron was added at relative coordinates 83-152 based on experimental evidence in Juneau et al. 2007 and Miura et al. 2006. See also GenBank EF123147 and Brachat et al. 2003. Note that this is the same intron that was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but then removed awaiting experimental evidence.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

 RBS1/YDL189W mRNA contains an intron in the 5' untranslated region (UTR). [see GenBank Accession #AY245794; Zhang, Z and Dietrich, F.S]

Davis CA and Ares M Jr (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

 BMH2/YDR099W mRNA contains an intron in the 5' untranslated region (UTR).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  
Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

 ARF2/YDL137W mRNA contains an intron in the 5' untranslated region (UTR).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

 RPS29B/YDL061C mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

 The coordinates of both the 5' and 3' ends of snR47 were shifted 47 nucleotides towards the left end of the chromosome to match those given in the yeast snoRNA database at UMass Amherst and as reported in Balakin AG et al. (1996) and the corresponding GenBank entry U56648. Thanks to Jason Hoskins for reporting this discrepancy and to Wayne Decatur for providing additional confirmation.

Balakin AG, et al. (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34
SGD Papers Entry  Pubmed Entry  DOI full text  

 YDRWsigma4, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRCsigma4 and is annotated on the Crick strand. The name YDRWsigma4 is being retained as an alias.
 YDRCsigma2, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Crick instead of Watson). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRWsigma2 and is annotated on the Watson strand. The name YDRCsigma2 is being retained as an alias.
 The ACS within ARS1/ARS416 was annotated based on Xu et al. 2006 and Celniker et al. 1984.

Celniker SE, et al. (1984) Deletion mutations affecting autonomously replicating sequence ARS1 of Saccharomyces cerevisiae. Mol Cell Biol 4(11):2455-66
SGD Papers Entry  Pubmed Entry  PMC full text  
Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 The ACS within ARS404 was annotated based on Xu et al. 2006 and Russell et al. 1986.

Russell DW, et al. (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94
SGD Papers Entry  Pubmed Entry  PMC full text  
Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 ARS400 was added to the genome annotation on Chromosome IV at coordinates 137-1392 based on Xu et al. 2006.

Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2006-10-05ARS432, ARS450, ARS451, ARS452, ARS453
 The following ARS elements on Chromosome IV, in addition to the ARS Consensus Sequence (ACS) for ARS432, were added to the genome annotation based on Nieduszynski et al. 2006: ARS450/417.5, ARS451/422.5, ARS452/431.5, ARS453/432.5.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-09-08ARS403, ARS405, ARS406, ARS409, ARS410, ARS413, ARS414, ARS417, ARS418, ARS419, ARS421, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS434, ARS435, ARS440, ARS443, ARS446
 The following new ARS elements on Chromosome IV were added to SGD based on Nieduszynski et al. 2006: ARS403, ARS405, ARS406, ARS409, ARS410, ARS413, ARS414, ARS417, ARS418, ARS419, ARS421, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS434, ARS435, ARS440, ARS443, ARS446.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

 The coordinates of ARS422 were updated based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

 The previously annotated 3' boundary of CEN4 was adjusted to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 New ORF HED1/YDR014W-A was added to the genome annotation for Chromosome IV at coordinates 477794 - 478282 based on Tsubouchi & Roeder 2005.

Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  SGD Curated Comments & Errata

 Due to the correction of a sequence error, the stop site of YDR015C was moved 150 nt upstream, making the predicted protein 79 amino acids rather than 129 aa. The old coordinates for YDR015C were 478195-477806, but are now 478196-477957.

Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  SGD Curated Comments & Errata

 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for MGT1/YDL200C was moved 54 nt (18 codons) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2006-04-12YDL065C, YDL216C
 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al. and this was incorporated into SGD.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on mutant analysis by Hedbacker et al. 2004, the start codon for SIP/YDR422C was moved 144 bp (48 codons) downstream. Hedbacker et al. 2004 showed that the first ATG of the ORF is not required for expression of functional Sip1p. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly.

Hedbacker K, et al. (2004) Cyclic AMP-dependent protein kinase regulates the subcellular localization of Snf1-Sip1 protein kinase. Mol Cell Biol 24(5):1836-43
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 ARS422, also known as "ARO1 ARS", was added to the genome annotation for Chromosome IV at coordinates 702799-703275 based on Wyrick et al. 2001 and Larimer et al. 1983.

Larimer FW, et al. (1983) Isolation of the ARO1 cluster gene of Saccharomyces cerevisiae. Mol Cell Biol 3(9):1609-14
SGD Papers Entry  Pubmed Entry  PMC full text  
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

 ARS416, originally designated ARS1, was added to the genome annotation for Chromosome IV at coordinates 462351-463189 based on Wyrick et al. 2001, Stinchcomb et al. 1979, and GenBank Accession U01086. "ARS1" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS416" is being used for consistency purposes, to indicate that this ARS is part of Chromosome IV.

Stinchcomb DT, et al. (1979) Isolation and characterisation of a yeast chromosomal replicator. Nature 282(5734):39-43
SGD Papers Entry  Pubmed Entry  DOI full text  
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

 ARS404, also known as "HO ARS", was added to the genome annotation for Chromosome IV at coordinates 45919-46272 based on Wyrick et al. 2001 and Russell et al. 1986.

Russell DW, et al. (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94
SGD Papers Entry  Pubmed Entry  PMC full text  
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  SGD Curated Comments & Errata

 The start site of NHP2/YDL208W is being moved 51 bp downstream from 87462 to 87513 based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. This annotation change was also suggested by Kellis et al. 2003. The annotated protein is reduced in length from 173 aa to 156 aa.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

 The start site of LSM6/YDR378C is being moved 111 bp downstream from 1229710 to 1229599, based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. Bouveret et al. 2000 also suggested this new start site because it is consistent with the protein's apparent molecular mass of 9.3 kDa, and is supported by comparison of the yeast Lsm6p sequence with homologs from other organisms. The annotated size of the protein changes from 123 aa to 86 aa.

Bouveret E, et al. (2000) A Sm-like protein complex that participates in mRNA degradation. EMBO J 19(7):1661-71
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2005-11-16YDL007C-A, YDR119W-A, YDR374W-A, YDR461C-A
 Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following new ORFs be added to the S. cerevisiae genome annotation: YDL007C-A, YDR119W-A, YDR374W-A, YDR461C-A.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Start and stop coordinates updated per McCutcheon & Eddy 2004.

McCutcheon JP and Eddy SR (2004) Detailed correction to: Computational identification of noncoding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res. 31:4119-4128, 2003
SGD Papers Entry  Web Supplement  

 Davis et al. 2000 demonstrated that there is an intron in the 5'UTR of IWR1/YDL115C that does not affect the coding region. Based on sequence comparison with related fungi, Brachat et al. 2003 later predicted a different intron that would extend the N-terminus of IWR1/YDL115C. Brachat et al. predict that the intron uses the same 5' splice junction demonstrated by Davis et al., but a different 3' splice junction. The intron predicted by Brachat et al. was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but was then removed and will be not annotated again until supported by experimental evidence.

Intron and splice junctions confirmed by Davis et al.:
Intron and splice junctions predicted by Brachat et al.:

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Increased the size of the intron in YDR381C-A by 1 bp on 5' end and 2 bp on 3' end based on conserved splice site sequences. See Blandin et al. 2000.

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
SGD Papers Entry  Pubmed Entry  DOI full text  

 Based on analyses of homology and synteny in Ashbya gossypii and Candida albicans, Brachat et al. (2003) proposed an intron and 5' extension for IWR1/YDL115C. The resulting ORF is in the same frame with the start codon shifted 409 bp upstream, now including a 70-bp intron; the protein has a 113-residue extension at the N-terminus.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

 Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for MCM21/YDR318W. The resulting ORF is in the same frame with the start moved 434 nt upstream, and the protein has a 117-residue extension at the N-terminus. The same intron and 5' exon are also described by Ortiz et al. 1999.

Ortiz J, et al. (1999) A putative protein complex consisting of Ctf19, Mcm21, and Okp1 represents a missing link in the budding yeast kinetochore. Genes Dev 13(9):1140-55
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 The start site of CBS1/YDL069C was moved 12 nt (4 codons) downstream, based on automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Deletion analyses by Krause-Bucholz et al. 2000 demonstrate that N-terminal sequences are not essential for either the function or mitochondrial targeting of this protein.

Krause-Buchholz U, et al. (2000) Identification of functionally important regions of the Saccharomyces cerevisiae mitochondrial translational activator Cbs1p. Yeast 16(4):353-63
SGD Papers Entry  Pubmed Entry  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for NKP1/YDR383C was moved 42 nt (14 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for URH1/YDR400W was moved 114 nt (38 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This start site was previously proposed by Kurtz et al, who noted that translation from this second methionine is more consistent with the observed size of URH1 and has closer similarity to related proteins.

Kurtz JE, et al. (2002) The URH1 uridine ribohydrolase of Saccharomyces cerevisiae. Curr Genet 41(3):132-41
SGD Papers Entry  Pubmed Entry  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 The start site of MSC2/YDR205W was moved 48 nt (16 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for VPS60/YDR486C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 The start site of YDL144C was moved 9 nt (3 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for STP1/YDR463W was moved 174 nt (58 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Previously published data from Wang et al. demonstrate that the second in frame methionine is the most likely start codon.

Wang SS, et al. (1992) STP1, a gene involved in pre-tRNA processing, encodes a nuclear protein containing zinc finger motifs. Mol Cell Biol 12(6):2633-43
SGD Papers Entry  Pubmed Entry  PMC full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 The start site of YDL139C was moved 72 nt (24 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 The start site of RRP8/YDR083W was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

 Based on the automated comparison of closely related Saccharomyces species by Kellis et al., the start site for VPS72/YDR485C was moved 45 nt (15 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL04L, TEL04R
 The chromosomal locations for the following telomeric elements on Chromosome IV were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL04L, TEL04L-XC, TEL04L-XR, TEL04L-TR, TEL04R, TEL04R-XC, TEL04R-XR, TEL04R-TR, TEL04R-YP.
2003-07-29YDL025W-A, YDL086C-A, YDL159C-B, YDR354C-A, YDR464C-A, YDR510C-A, YDR524C-A, YDR545C-A
 Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL025W-A, YDL086C-A, YDL159C-B, YDR354C-A, YDR464C-A, YDR510C-A, YDR524C-A, YDR545C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

 Thanks to Brachat et al. for providing the coordinates of ORF YDL160C-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YDL022C-A, YDR169C-A, YDR182W-A, YDR183C-A, YDR194W-A, YDR246W-A, YDR406W-A
 Thanks to Kessler et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL022C-A, YDR169C-A, YDR182W-A, YDR183C-A, YDR194W-A, YDR246W-A, YDR406W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YDR003W-A, YDR118W-A, YDR320W-B, YDR371C-A
 Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome IV: YDR003W-A, YDR118W-A, YDR320W-B, YDR371C-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2003-07-29YDR524C-B, YDR524W-C
 Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome IV: YDR524C-B, YDR524W-A.
 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  SGD Curated Comments & Errata

 Changed from W -> C: old start coord: 541641; old stop coord: 541701 new start coord: 541739; new stop coord: 541641 References: 1. Ni et al. (1996) Cell 86(5):823-834 2. snoRNA database: 3. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706
 ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
 The intron of ORF YDR139C was moved 3 nt downstream as a whole, changing the relative coordinates of the coding region from 1-146..220-307 to 1-149..223-307. Note that while the coding sequence has changed slightly, the genomic sequence remains unchanged.
 The start site of ORF YDL189W was moved 238 nt downstream and the annotated intron was removed, changing the relative coordinates of the coding region from 1-100..246-1612 to 1-1374. Note that the stop remains unchanged.
 A new intron and 5' exon were added to YDR381W. Relative coordinates change from 1-321 to 1-285..1052-1447, and chromosomal coordinates change from 1237718-1238038 to 1236547-1236831..1237598-1237993.
1998-05-21YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A
 The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  

Jump to: Sequence Changes | Annotation Changes without Sequence Changes