Take our Survey

Chromosome V History Help



 

This page lists all sequence and annotation changes that have been made to the Chromosome V systematic reference sequence since its intial release on 1996-07-31.


SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of ChangeOld SequenceNew Sequence
2011-02-03ARS50491689168SubstitutionGT
 A single nucleotide substitution was made within ARS504.
New    9121    GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTTAAAAATAAGCAA  9180
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    9121    GTTGGCCTGCCATACTTTAATTGAATAAAAGCTCCGTATATGCTTCTGAAAAATAAGCAA  9180

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YEL070W, YEL071W1807918079SubstitutionAT
 A single nucleotide substitution was made in the intergenic region between ORFs DLD3/YEL071W and DSF1/YEL070W.
New    18061   ATCTCCTGATTGCGTACTTCAAAAAGTGTTCGTCCATTTTTTCTTTACTACATTAGATAA  18120
               |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    18061   ATCTCCTGATTGCGTACTACAAAAAGTGTTCGTCCATTTTTTCTTTACTACATTAGATAA  18120

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YEL007W, YEL008W141112141112Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs YEL008W and YEL007W.
New    141061  GCAATGATCTGTCCAACTCACCGAAACAAGAAAAAATTTTGCGTTTTTTTTTTCCTACAAATCCCCCATT  141130
               |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    141061  GCAATGATCTGTCCAACTCACCGAAACAAGAAAAAATTTTGCGTTTTTTTTT-CCTACAAATCCCCCATT  141129

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YER041W232634232634SubstitutionCG
 A single nucleotide substitution within the coding region of YEN1/YER041W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 59 is now Alanine rather than Proline.
New   232621  ATATAGATATAAGCGCCAGATCTAGATCAAGATCAAGGAGTCCTACCCGTTCTCCGCGTG  232680
              |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old   232620  ATATAGATATAAGCCCCAGATCTAGATCAAGATCAAGGAGTCCTACCCGTTCTCCGCGTG  232679

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YER056C, YER056C-A268857268857Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs FCY2/YER056C and RPL34A/YER056C-A.
New    268801  AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTTTCAGCGAGCATT  268870
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    268800  AACTTGGTTGAAAGTGGCTGAATTTACGACGTAATCTGTCTTGACATCTTTTTTTTTT-CAGCGAGCATT  268868

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YER061C278525278526SubstitutionCGGC
 Nucleotide changes within the coding region of CEM1/YER061C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Alanine rather than Arginine.
New   278521  GCGCCAGCTGCACCTAAAAGATGGCCAATTGCACCTTTGTTACTGGATATGTACAGTGGC  278580
              ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old   278519  GCGCCACGTGCACCTAAAAGATGGCCAATTGCACCTTTGTTACTGGATATGTACAGTGGC  278578

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YER072W, YER073W303532303532Insertion T
 A single nucleotide insertion was made in the intergenic region between ORFs VTC1/YER072W and ALD5/YER073W.
New    303481  CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTTTGGCCGCTACCGGACT  303550
               |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    303479  CCGTTTACACATCAATGATAAATAAGTATACAAAAAGGGTTCCATTTTTTTTTT-GGCCGCTACCGGACT  303547

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YER073W305258305258SubstitutionGA
 A single nucleotide substitution within the coding region of ALD5/YER073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 411 is now Glutamic Acid rather than Glycine.
New   305221  GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGAAGATATGAGAATTGTTAAG  305280
              |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old   305218  GGTTATTTTGTCAAGCCAACAGTGTTTGCTGATGTCAAAGGAGATATGAGAATTGTTAAG  305277

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YER073W, YER074W
305710305710Insertion A
305828305828SubstitutionAG
305880305880SubstitutionTG
305885305886SubstitutionCATC
305968305968SubstitutionTA
 A single nucleotide insertion and several different substitutions were made in the intergenic region between ORFs ALD5/YER073W and RPS24A/YER074W.
New    305701  CAAAAAAAAAAAAACAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT  305760
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    305698  CAAAAAAAAAAAA-CAAAACAAAAAAATAATAACGTGATAAACATTAATGAACAATGTAT  305756
New    305821  TATTGTATATTGAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT  305880
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    305817  TATTGTATATTAAAATATATAGTAATCAAATTCGTTTCATTGATCAAATTGCTCACTAGT  305876
New    305881  TCTGTTTTTCAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA  305940
               ||| ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    305877  TCTTTTTTCAAAAATTTCATCTTTATAGGTAGATACAAGTGCCAGAGAGATATATAAACA  305936
New    305941  GAAAACTCTATCGATGTGATAATGTATGCCAATATCGGGACTGTACACCCACACATTTAC  306000
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    305937  GAAAACTCTATCGATGTGATAATGTATGCCATTATCGGGACTGTACACCCACACATTTAC  305996

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YER075C
308627308627SubstitutionCG
308984308984SubstitutionGT
309047309047SubstitutionGC
 Nucleotide substitutions within the coding region of PTP3/YER075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 717 is now Alanine rather than Proline, and residue 738 is now Lysine rather than Q, and residue 857 is now Glutamine rather than Glutamic Acid.
New   308581  GTCATAAATGAAAATAAATTGATTAATGTTCTGGACCATGGATATTCGTTGCTTTCTAAA  308640
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old   308577  GTCATAAATGAAAATAAATTGATTAATGTTCTGGACCATGGATATTCGTTCCTTTCTAAA  308636

New   308941  TAACAATTCATAAGGTTTCTCTTGATCATGATATGTTAGCAGAATTTTTCTTATGAGAAT  309000
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old   308937  TAACAATTCATAAGGTTTCTCTTGATCATGATATGTTAGCAGAATTTGTCTTATGAGAAT  308996
New   309001  TGCGTCATCATCATCATCATCATCATCATCACAAGCAGCAGCAGTAACAGCAATATTACT  309060
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Old   308997  TGCGTCATCATCATCATCATCATCATCATCACAAGCAGCAGCAGTAACAGGAATATTACT  309056

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2000-03-16YER123W406383406383DeletionG
 A single G nucleotide was deleted within ORF YER123W at chromosomal coordinate 406383, creating a new stop codon; this ORF is shortened, but a prenylation site is created.
Old: 406381 TGGATAAAGCGATTTTTATACTTTTCTCTTTTTCCTTTTTTTTTTTGATTGGCTGTTTCC 406440
            || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 406381 TG-ATAAAGCGATTTTTATACTTTTCTCTTTTTCCTTTTTTTTTTTGATTGGCTGTTTCC 406439

Wang X, et al. (1996) Prenylated isoforms of yeast casein kinase I, including the novel Yck3p, suppress the gcs1 blockage of cell proliferation from stationary phase. Mol Cell Biol 16(10):5375-85
SGD Papers Entry  Pubmed Entry  PMC full text  

2011-02-03YER133W, tH(GUG)E2434284434284SubstitutionCT
 A single nucleotide substitution was made in the intergenic region between GLC7/YER133W and tH(GUG)E2.
New    434281  CAATTTTTCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT  434340
               ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    434277  CAATTTTCCTTTATTTTCTTTTATTACTATTATCATTACTATTATTATTAGTATTATTAT  434336

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YER138W-A, YER139C449959449959Insertion A
 A single nucleotide insertion was made in the intergenic region between ORFs YER138W-A and RTR1/YER139C.
New    449941  GTGGGTTTCCTATGTTCTCGAAGAGAGCTTCAAGTGTATTCTATAAACTAAGAATATTAG  450000
               ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    449937  GTGGGTTTCCTATGTTCTCGAAG-GAGCTTCAAGTGTATTCTATAAACTAAGAATATTAG  449995

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YER162C502222502222SubstitutionTA
 A single nucleotide substitution within the coding region of RAD4/YER162C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Valine rather than Glutamic Acid.
New   502201  CTTTCCAGGTTCTCATATAAAGTCCCACATTATCATATTTTTTAGTGATCTTCCAGTGTT  502260
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Old   502196  CTTTCCAGGTTCTCATATAAAGTCCCTCATTATCATATTTTTTAGTGATCTTCCAGTGTT  502255

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2007-07-09YEL003W
 The start of GIM4/YEL003W was moved 52 nt upstream, and an intron was added at relative coordinates 20-107, based on GenBank EF123144, Juneau et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 72%).The old coding coordinates were 148227..148598 (372 nt, 123 aa), and the new coding coordinates are 148175..148193,148282..148598 (1..19,108..424; 111 aa).

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2007-04-04YER131W
 RPS26B/YER131W mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2007-04-04YER102W
 RPS8B/YER102W mRNA contains an intron in the 5' untranslated region (UTR).

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2007-04-03YERCdelta8
 YERCdelta8, a Ty1 LTR on Chromosome V, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). The error has now been corrected.
2006-10-02ARS516
 The coordinates of ARS516 were updated based on Nieduszynski et al. 2006.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-09-07ARS507, ARS508, ARS510, ARS511, ARS512, ARS514, ARS517, ARS518, ARS522
 The coordinates of the following ARS elements on Chromosome V were updated based on Nieduszynski et al. 2006: ARS507, ARS508, ARS510, ARS511, ARS512, ARS514, ARS517, ARS518, ARS522/501.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-05-09YEL038W
 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for UTR4/YEL038W be moved 42 nt (14 codons) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2006-05-08CEN5
 The previously annotated boundaries of CEN5 were adjusted to coincide with the 5' end of CDEI and the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2005-11-29snR80
 New snoRNA added to genome annotation.

Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  SGD Curated Comments & Errata

2005-11-29YER030W
 The start site of YER030W is being moved 21 bp downstream from 213415 to 213436 because the 5' SAGE data used by Zhang & Dietrich 2005 to study transcription start sites confirmed the initial suggestion by Kellis et al. 2003 that this change be made. The size of the predicted protein is reduced from 160 aa to 153 aa.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2005-11-28YER050C
 The start site of RSM18/YER050C is being moved 192 bp downstream from 254578 to 254386, based on 5' SAGE data used by Zhang & Dietrich 2005 to study transcription start sites.

Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2004-10-19ARS502, ARS503, ARS504, ARS507, ARS508, ARS510, ARS511, ARS512, ARS513, ARS514, ARS515, ARS516, ARS517, ARS518, ARS519, ARS520, ARS521, ARS522, ARS523
 The following ARS elements on Chromosome V were added to SGD based on Tanaka et al. 1996 and Raghuraman et al. 2001: ARS502, ARS503, ARS504, ARS507, ARS508, ARS510, ARS511, ARS512, ARS513, ARS514, ARS515, ARS516, ARS517, ARS518, ARS519, ARS520, ARS521, ARS522, ARS523.

Tanaka S, et al. (1996) Systematic mapping of autonomously replicating sequences on chromosome V of Saccharomyces cerevisiae using a novel strategy. Yeast 12(2):101-13
SGD Papers Entry  Pubmed Entry  DOI full text  
Raghuraman MK, et al. (2001) Replication dynamics of the yeast genome. Science 294(5540):115-21
SGD Papers Entry  Pubmed Entry  DOI full text  SGD Curated Comments & Errata

2004-10-12CEN5
 Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-10-08SCR1
 The coordinates of the small cytoplasmic RNA SCR1 were corrected to match the sequence determined by Felici, et al. and reported in the GenBank entry M28116.

Felici F, et al. (1989) The most abundant small cytoplasmic RNA of Saccharomyces cerevisiae has an important function required for normal cell growth. Mol Cell Biol 9(8):3260-8
SGD Papers Entry  Pubmed Entry  PMC full text  

2004-08-27YER090C-A
 The ORF YER090C-A was added per Oshiro et al. 2002.

Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2004-04-01RUF4
 Feature annotation removed per John McCutcheon and Sean Eddy.

McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713
SGD Papers Entry  

2004-01-08YER074W-A
 Both introns in YER074W-A were extended 1 bp in the 5' direction and 2 bp in the 3' direction based on conserved splice site sequences in other fungal species as predicted by Blandin et al. 2000.

Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
SGD Papers Entry  Pubmed Entry  DOI full text  

2003-10-29SRG1
 This non-coding RNA feature was annotated based on information from Fred Winston; the SRG1 TATA begins at position 322124, the transcription start sites are at positions 322208 and 322209, and the size of the transcript is approximately 550 bases as determined by Northern analysis.
2003-09-22YER083C
 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YER083C was moved 66 nt (22 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YEL062W
 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for NPR2/YEL062W was moved 27 nt (9 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YER032W
 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for FIR1/YER032W was moved 147 nt (49 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YER178W
 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for PDA1/YER178W was moved 69 nt (23 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The predicted protein translated from the conserved methionine contains a predicted mitochondrial targeting signal sequence (using both MitoProt and Predotar), while the predicted protein translated from the currently annotated S. cerevisiae start codon does not.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YEL061C
 Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for CIN8/YEL061C was moved 114 nt (38 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL05L, TEL05L-XC, TEL05L-YP, TEL05R, TEL05R-XC, TEL05R-XR, TEL05R-YP
 The chromosomal locations for the following telomeric elements on Chromosome V were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL05L, TEL05L-XC, TEL05L-YP, TEL05R, TEL05R-XC, TEL05R-XR, TEL05R-YP.

Note that both TEL05L and TEL05R have telomeric repeats (TEL05L-TR and TEL05R-TR), but they are missing from the genome annotation due to sequencing difficulties encountered during the initial genome sequencing efforts in the 1990s.
2003-07-29YEL008C-A, YEL030C-A, YEL032C-A, YEL077W-A, YER023C-A, YER088W-B, YER158W-A, YER175W-A, YER190C-A, YER190C-B
 The coordinates for the following ORFs on Chromosome V were provided by Kumar et al. 2002: YEL008C-A, YEL030C-A, YEL032C-A, YEL077W-A, YER023C-A, YER088W-B, YER158W-A, YER175W-A, YER190C-A, YER190C-B.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

2003-07-29YEL009C-A, YEL018C-A, YEL034C-A, YEL053W-A, YER006C-A, YER038W-A, YER046W-A, YER067C-A, YER068C-A, YER076W-A, YER079C-A, YER084W-A, YER087C-A, YER088C-A, YER107W-A, YER133W-A, YER137W-A, YER145C-A, YER147C-A, YER148W-A, YER152W-A, YER165C-A, YER172C-A, YER188C-A
 The coordinates for the following ORFs on Chromosome V were provided by MIPS: YEL009C-A, YEL018C-A, YEL034C-A, YEL053W-A, YER006C-A, YER038W-A, YER046W-A, YER067C-A, YER068C-A, YER076W-A, YER079C-A, YER084W-A, YER087C-A, YER088C-A, YER107W-A, YER133W-A, YER137W-A, YER145C-A, YER147C-A, YER148W-A, YER152W-A, YER165C-A, YER172C-A, YER188C-A.
2003-07-29YEL020C-B, YEL050W-A, YER078W-A
 The coordinates for the following ORFs on Chromosome V were provided by Kessler et al. 2003: YEL020C-B, YEL050W-A, YER078W-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-03-07YER180C-A
 ORF YER180C-A was added to SGD based on Panic et al. 2003.

Panic B, et al. (2003) The ARF-like GTPases Arl1p and Arl3p act in a pathway that interacts with vesicle-tethering factors at the Golgi apparatus. Curr Biol 13(5):405-10
SGD Papers Entry  Pubmed Entry  DOI full text  

2003-03-06RUF4
 Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.

McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  SGD Curated Comments & Errata

2002-11-19YERCTy1-2, YERCsigma4
 The YERCsigma4 element was initially mistakenly annotated as a separate sigma LTR, though its coordinates completely overlapped with the full length transposon YERCTy1-2, which contains delta elements, not sigma elements. Thus, YERCsigma4 has been deleted from the genome annotation.
2002-11-19YERCTy1-1, YERWdelta18
 The YERWdelta18 element was initially mistakenly annotated as a separate LTR, though its coordinates completely overlapped with the full length transposon YERCTy1-1. Thus, YERWdelta18 has been deleted from the database.
2000-12-01YEL012W
 The start site of YEL012W was moved 159 nucleotides upstream, and an intron was added at relative coordinates 6-128. The stop remains unchanged. Relative coordinates change from 1-621 to 1-5..129-780, and chromosomal coordinates change from 131931-132551 to 131772-131776..131900-132551.
2000-12-01YER056C-A
 The intron of YER056C-A was moved 2 nucleotides upstream. The genomic sequence remains unchanged, but the coding sequence is now only very slightly altered. Relative coordinates change from 1-39..437-763 to 1-37..435-780, and chromosomal coordinates change from 270183-270145..269747-269421 to 270183-270147..269749-269421.
1999-07-17YER060W-A
 YER060W-A/FCY22 was originally incorrectly annotated as being identical to its neighboring ORF YER060W/FCY21, at coordinates 274565-276151 (1587 nucleotides long). This error has been corrected, and the coordinates of YER060W-A/FCY22 are now 276570-278162 (1593 nt). Sequence files have been updated accordingly.
1999-07-17YER108C, YER109C
 YER108C and YER109C were originally annotated as two separate open reading frames, but it has been demonstrated that they correspond to the FLO8 gene, which contains a nonsense mutation in the reference strain S288C - an A to G transition at position 431, changing amino acid 144 from a Trp to a stop. Therefore, they have been fused into one reading frame with an internal stop codon.

Liu H, et al. (1996) Saccharomyces cerevisiae S288C has a mutation in FLO8, a gene required for filamentous growth. Genetics 144(3):967-78
SGD Papers Entry  Pubmed Entry  PMC full text  

1998-05-21YER048W-A, YER091C-A, YER138W-A
 The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  

Jump to: Sequence Changes | Annotation Changes without Sequence Changes