Chromosome XVI History |
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
| Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2011-02-03 | ||||||
| YPL224C | ||||||
| 126768 | 126768 | Insertion | C | |||
| 128039 | 128039 | Substitution | T | G | ||
|   | Two nucleotide changes were made within the ORF MMT2/YPL224C, altering its coding sequence: one single nucleotide substitution near the 5' end, and one single nucleotide insertion near the 3' end. The start and majority of the reading frame remain the same, but the C-terminus has changed, and the annotated protein is now 35 amino acids longer.
New 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCCCACGTTTGGCAC 126780
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 126721 ACCTTTAGAGTCAGAGGTTACATCAACAAACTCGACGTCCACCTTCCC-ACGTTTGGCAC 126779
New 127981 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGGCACAAAGGAA 128050
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old 127980 CAGGCTTGATGTTCTTATGGCCCTCCCGGCAGCATGGTAACTAGTGTTGTTATAACCTGTCACAAAGGAA 128049
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2004-07-21 | ||||||
| YPL109C | ||||||
| 347265 | 347265 | Deletion | T | |||
| 347273 | 347273 | Insertion | T | |||
| 347285 | 347285 | Insertion | A | |||
| 347375 | 347375 | Insertion | T | |||
|   | The works of Kellis et al. 2003 and Cliften et al. 2003 predicted
multiple insertions and deletions in YPL109C, and the sequence errors
were confirmed in S288C by SGD. As a consequence of these changes,
YPL109C was extended at the 5' end, altering the N-terminus and
increasing the size of the predicted protein from 590 to 657 amino
acids.
New: TGTTTTGGAAACGAATTTT-GTGTCAAATAAAAAGCAATTGACGTAGGTATTATGAACTG
||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||||
Old: 347246 TGTTTTGGAAACGAATTTTTGTGTCAAA-AAAAAGCAATTG-CGTAGGTATTATGAACTG 347303Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |||||
| 2011-02-03 | ||||||
| YPL108W, YPL109C | ||||||
| 347528 | 347528 | Insertion | G | |||
| 347759 | 347759 | Insertion | C | |||
|   | Two separate single nucleotides were inserted in the intergenic region between ORFs YPL109C and YPL108W.
New 347521 GGTATTATTGCCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT 347580
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old 347520 GGTATTATT-CCCCTCATATATTCGGGGTTATTTATTTTTCGTTGCTTGAAGTAAAGCCT 347578
New 347751 CCCTTTCGCGGCACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA 347820
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 347749 CCCTTTCGCGG-ACTTTTTCTCTTAGCTCTGCTTGATACATCGACTGGGAACTTCTTCTCTTTGAGCCAA 347817Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YPL036W, YPL037C | 482773 | 482773 | Deletion | T | |
|   | A single nucleotide was deleted from the intergenic region between ORFs YPL037C/EGD1 and YPL036W/PMA2.
New 482761 AAACATACCCATAAC-TTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA 482819
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old 482758 AAACATACCCATAACTTTTTTTTTTTTCATTTTTCGTTGCTGTGTGCTAGTACAATTTAA 482817Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YPL016W, YPL017C | ||||||
| 520375 | 520375 | Insertion | C | |||
| 520378 | 520378 | Substitution | C | G | ||
| 520646 | 520646 | Insertion | C | |||
| 520818 | 520818 | Deletion | T | |||
|   | Four single nucleotide changes were made in the intergenic region between ORFs YPL016W/SWI1 and YPL017C/IRC15: two insertions, one substitution, and one deletion.
New 520320 AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCGCCGGAGGAAAAT 520389
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Old 520318 AGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGCCTCG-CGCAGGAAAAT 520386
New 520620 CATATTCACATTGCGTTTTAGTCATAACCACCTTCCGGTATTCATCATTCGTATTGAATA 520679
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old 520617 CATATTCACATTGCGTTTTAGTCATAACCA-CTTCCGGTATTCATCATTCGTATTGAATA 520675
New 520800 ATCTCTGCTTTGGCATTTCGCG-TTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA 520858
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old 520796 ATCTCTGCTTTGGCATTTCGCGTTTGTTTCCTCTCACGGATTGCAGATTATTGTTCACCA 520855Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YPL016W | 523639 | 523639 | Substitution | C | T |
|   | A single nucleotide substitution was made within the ORF SWI1/YPL016W. Note that the protein sequence was not changed.
New 523619 GATTCCTCCCTAACCAATTTCCTTTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA 523678
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old 523616 GATTCCTCCCTAACCAATTTCCTCTGAAAATTCACAGAACTCCTTATTTGACTTCTTTGA 523675Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YPR035W | ||||||
| 642955 | 642955 | Substitution | G | A | ||
| 642995 | 642995 | Substitution | C | T | ||
|   | Nucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine.
New 642949 GGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTATGAAATACATCGAACAAGCCA 643018
||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old 642946 GGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAACCAGGTGGTACGAAATACATCGAACAAGCCA 643015
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YPR035W, YPR036W | 643579 | 643579 | Substitution | T | C |
|   | A single nucleotide substitution was made in the intergenic region between ORFs YPR035W/GLN1 and YPR036W/VMA13.
New 643559 TCGAATTTTTTCTTTTTTTTTTTCTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT 643618
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old 643556 TCGAATTTTTTCTTTTTTTTTTTTTGCAAAGCGACGCTGTGTTGTATATTGCTCTAAAAT 643615Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YPR078C, YPR079W | 698524 | 698524 | Deletion | A | |
|   | A single nucleotide deletion was made in the intergenic region between ORFs YPR078C and YPR079W/MRL1.
New 698519 TTCTTCTG-AAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA 698577
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old 698516 TTCTTCTGAAAAAAAAAAAAAAAAAATTCAAAAAAAGACACCTTTCTACCTTGGCAGTAA 698575Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2003-09-29 | YPR089W, YPR090W | 713683 | 713683 | Deletion | T | |
|   | Due to deletion of a T at position 713683, YPR089W and YPR090W were merged. After merging YPR089W (713271 - 713738 (1-468)) and YPR090W (713728 - 715938 (1-2211)), the coordinates of the merged ORF, YPR089W, are 713271 - 715937 (1-2667). YPR090W is now an alias of YPR089W.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |||||
| 2011-02-03 | YPR097W | 727933 | 727933 | Substitution | G | A |
|   | A single nucleotide substitution within the coding region of YPR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 848 is now Serine rather than Glycine.
New 727918 ATTTTGAGAAGTTCATGAGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT 727977
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old 727916 ATTTTGAGAAGTTCATGGGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGTCAGT 727975
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YPR121W, YPRWdelta16 | ||||||
| 778302 | 778302 | Insertion | G | |||
| 778376 | 778376 | Insertion | C | |||
|   | Two single nucleotide insertions were made in the intergenic region between YPRWdelta16 and YPR121W/THI22.
New 778258 TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTCGGCGTGCGCTTCC 778317
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old 778256 TTAATGGAATAACGTGATTTTTGTACCAAATTGCCTATTTCAGATTC-GCGTGCGCTTCC 778314
New 778368 TGCACGGAAGATCCTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC 778437
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 778365 TGCACGGAAGAT-CTTGCAGGAATCAAATACTGCCTTTCACTTTGCAACCTCTTAATCACATAGTAGCAC 778433Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YPR121W | 778863 | 778863 | Substitution | T | A |
|   | A single nucleotide substitution within the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine.
New 778858 CGGCGCTCAAAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA 778917
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old 778854 CGGCGCTCATAATATACCAAAGAAAATGGTATCTCAAATATTAGACGCCAATTTACAGGA 778913
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2009-05-08 | ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, ARS1632 |
|   | The following ARS elements on Chromosome 16 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, and ARS1632.Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 |
| 2007-07-10 | YPR153W |
|   | The start of ORF YPR153W was moved 122 nt upstream and an intron was added at relative coordinates 6..139 based on GenBank EF123126, Juneau et al. 2007, Zhang et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 50%). The ORF had been annotated as 435 nt long (144 aa), but is now 557 nt long with a 134-nt intron (140 aa).Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9 |
| 2007-05-09 | YPR010C-A |
|   | YPR010C-A added as a new ORF on ChrXVI between tRNA-Lys and YPR011C. Contains an intron and is conserved among all the Saccharomyces sensu stricto species. Ken Wolfe's lab found a conserved homolog in Kluyveromyces polysporus, without an intron.
Note: Miura et al. refer to this as "transcription unit no. 633".Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 |
| 2007-05-09 | snR70 |
|   | Updated coordinates of snR70 based on GenBank AF064282. Removed 1 nt from 5' end. |
| 2007-04-04 | YPL230W |
|   | YPL230W mRNA contains an intron in the 5' untranslated region (UTR).Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 |
| 2006-10-04 | ARS1633, ARS1634, ARS1635 |
|   | The following ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1633/1620.5, ARS1634/1622.5, ARS1635/1626.5.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-09-08 | ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631 |
|   | The following new ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-05-09 | CEN16 |
|   | The previously annotated 3' boundary of CEN16 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 |
| 2005-12-14 | YPL052W, YPL052W-A |
|   | Palanimurugan et al. 2004 have shown that the translation start site of OAZ1/YPL052W is located at chromosomal coordinate 458796, 274 bp upstream from the originally annotated start site. This change results in a merge of upstream ORF YPL052W-A into OAZ1/YPL052W. The full translation product is generated by translational frameshifting to skip the first base of what was previously annotated as the stop codon of YPL052W-A.Palanimurugan R, et al. (2004) Polyamines regulate their synthesis by inducing expression and blocking degradation of ODC antizyme. EMBO J 23(24):4857-67 |
| 2005-12-13 | YPL052W-A |
|   | Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPL052W-A, be added to the S. cerevisiae genome annotation.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2005-12-01 | YPR169W |
|   | The work of Zhang & Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of YPR169W be moved 66 nt downstream from 878620 to 878686. This annotation change results in a predicted protein of 492 aa, as opposed to the previously annotated 514 aa.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 |
| 2005-11-21 | YPR145C-A |
|   | Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPR145C-A, be added to the S. cerevisiae genome annotation.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2004-10-12 | CEN16 |
|   | Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 |
| 2004-04-01 | RUF6 |
|   | Feature annotation removed per John McCutcheon and Sean Eddy.McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713 |
| 2004-01-09 | YPL094C |
|   | Start moved 27 bp downstream; protein is actually 274 aa rather than the previously annotated 283 aa. This is an annotation change only; no sequence change. See Willer et al. This change was also suggested by Kellis et al. based on the automated comparison of closely related Saccharomyces species.Willer M, et al. (2003) Identification of novel protein-protein interactions at the cytosolic surface of the Sec63 complex in the yeast ER membrane. Yeast 20(2):133-48 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() |
| 2003-09-27 | YPR098C |
|   | Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YPR098C. The resulting ORF is in the same frame, but has a 53-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-27 | YPL109C |
|   | Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 3' exon for YPL109C. The resulting ORF is 47 residues longer and has an altered C-terminus. This proposal was reviewed and accepted by SGD curators.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YPR085C |
|   | The automated comparison of closely related Saccharomyces species suggests that the start site for YPR085C be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YPR175W |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for DPB2/YPR175W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 888960 is not conserved in S. paradoxus, S. mikatae, and S. bayanus.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YPR047W |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MSF1/YPR047W be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This protein is predicted to have a function in mitochondria and using the new 5' coordinate in prediction programs (MITOP and Predator) still results in a strong prediction that Msf1p will be targeted to the mitochondria.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YPL210C |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SRP72/YPL210C be moved 18 nt (6 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 156229 is not conserved in the other Saccharomyces species; 4) Protein sequence comparisons against the nr dataset show that sequence similarity begins after 156211 between S. cerevisiae YPL210C and related proteins.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YPL270W |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MDL2/YPL270W be moved 141 nt (47 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although a corresponding ATG is found at the original start (30341) in S. paradoxus, S. mikatae, and S. bayanus, there are indels between this ATG and the predicted start site which lead to frameshifts in the predicted mRNAs in non S. cerevisiae sequences. 4) the protein is found in mitochondria (Young et al.) and the MITPROT prediction program predicts a signal cleavage site for the new shorter protein suggesting this protein would be targeted to the mitochondria. In contrast, mitochondrial targeting is not predicted with the protein's original start at 30341.Young L, et al. (2001) Role of the ABC transporter Mdl1 in peptide export from mitochondria. Science 291(5511):2135-8 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YPR093C |
|   | The automated comparison of closely related Saccharomyces species suggests that the start site for YPR093C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YPL148C |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PPT2/YPL148C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al. 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-09 | TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, TEL16R-YP |
|   | The chromosomal locations for TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, and TEL16R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
| 2003-07-29 | YPL119C-A, YPR160W-A, YPR170W-A |
|   | Thanks to
Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR170W-A, YPL119C-A and YPR160W-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 |
| 2003-07-29 | YPL135C-A, YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A |
|   | Thanks to Kumar et al. for providing the coordinates of the following Chromosome XVI ORFs: YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A, and YPL135C-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 ![]() |
| 2003-07-29 | YPL038W-A, YPL250W-A, YPR108W-A, YPR169W-A |
|   | Thanks to Kessler et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR169W-A, YPR108W-A, YPL038W-A, and YPL250W-A.Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 |
| 2003-07-29 | YPL189C-A |
|   | Thanks to Brachat et al. for providing the coordinates of YPL189C-A.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 |
| 2003-07-29 | YPR170W-B |
|   | Thanks to Brachat et al and Cliften et al. for providing the coordinates of YPR170W-B.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-05-23 | YPR131C |
|   | The start site of NAT3/YPR131C has been moved 168 nt downstream from 794661 to 794493 based on experimental evidence as well as sequence comparisons in other species published by Polevoda et al. Also, the downstream ATG codon is clearly conserved in the closely related sensu stricto Saccharomyces species.Polevoda B, et al. (2003) Nat3p and Mdm20p are required for function of yeast NatB Nalpha-terminal acetyltransferase and of actin and tropomyosin. J Biol Chem 278(33):30686-97 |
| 2003-03-06 | RUF6 |
|   | Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28 ![]() |
| 2002-07-25 | YPR036W-A |
|   | Based on the work of Miura et al. (2001), the new ORF YPR036W-A was added to Chromosome XV.Miura F, et al. (2001) Differential display analysis of mutants for the transcription factor Pdr1p regulating multidrug resistance in the budding yeast. FEBS Lett 505(1):103-8 |
| 1999-07-17 | YPR111W |
|   | The intron in ORF YPR111W was removed. The start, stop, and frame were left as is, so that the sequence that was previously annotated as the intron is now part of the translation. The chromosomal coordinates of the coding region change from 747303-747593..748014-748997 to 747303-748997. The relative coordinates of the coding region change from 1-291..712-1695 to 1-1695. |
| 1997-10-20 | YPL075W |
|   | Edition 14: The GCR1 gene was modified in October 1997 to include an intron reported by Tornow and Santangelo (1994).Tornow J and Santangelo G (1994) The GCR1 gene of Saccharomyces cerevisiae is a split gene with an unusually long intron. Genetics 138(3):973-4 Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73 |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |