Take our Survey

Chromosome XI History Help



 

This page lists all sequence and annotation changes that have been made to the Chromosome XI systematic reference sequence since its intial release on 1996-07-31.


SEQUENCE CHANGES, including any resulting annotation changesJump to: Annotation changes

DateAffected FeaturesStart Coordinate
of Change
End Coordinate
of Change
Type of ChangeOld SequenceNew Sequence
2011-02-03TEL11L, TEL11L-XC395395DeletionA
 A single nucleotide deletion was made within TEL11L, specifically within X element core sequence TEL11L-XC.
New    361     CACATATACTTACCCTACCACTCTAATCCCACCA-CACATCACATGCCATACTCACCTTC  419
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    361     CACATATACTTACCCTACCACTCTAATCCCACCAACACATCACATGCCATACTCACCTTC  420

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL221W71317132SubstitutionCGGC
 Nucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine.
New    7090    GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATAGCTTTTGGATTATTGGTTGG  7149
               ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
Old    7091    GGCCATGTGGATACCTTGTAAAAATTTGGCCACTGCGATACGTTTTGGATTATTGGTTGG  7150

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YKL219W, YKL220C
1294112941DeletionG
1446214462Insertion GG
 A single nucleotide deletion and a dinucleotide insertion were made in the intergenic region between ORFs FRE2/YKL220C and COS9/YKL219W.
New    12900   TATCCGAACAGTAAACGTTTGTCCGTAGTCATCGTGACTG-TTGACGTATTAACTGCAAG  12958
               |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    12901   TATCCGAACAGTAAACGTTTGTCCGTAGTCATCGTGACTGGTTGACGTATTAACTGCAAG  12960
New    14449   CGCCCGCTTGGCGGCTTTTTCTTTCCGACTATATAAATGCAAATAGTCAGAAGTTGTAAC  14508
               ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||
Old    14451   CGCCCGCTTGGC--CTTTTTCTTTCCGACTATATAAATGCAAATAGTCAGAAGTTGTAAC  14508

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL216W, YKL217W2480124801DeletionG
 A single nucleotide deletion was made within the intergenic region between ORFs JEN1/YKL217W and URA1/YKL216W.
New    24779   TGAGGTCATTCCCTAACCTTGG-ATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT  24837
               |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    24779   TGAGGTCATTCCCTAACCTTGGGATCCAAGTCAATCTGGTATCTTCCCACCCTAAATAGT  24838

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-02-13YKL207W4882848828InsertionG
 Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at chromosomal coordinate 48828 in YKL207W. As a consequence of this sequence change, YKL207W was extended at the 3' end, increasing the size of the predicted protein from 260 amino acids to 282 amino acids.
New: 48774 ATTGGGTTAAACGATCAGGACATGGGTATTCAGGCCGGGATAGGTGGCCCTCAGGGCCCC 48833
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Old: 48774 ATTGGGTTAAACGATCAGGACATGGGTATTCAGGCCGGGATAGGTGGCCCTCAGG-CCCC 48832

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-02-13YKL203C5894158941InsertionCCG
 Insertion of three nucleotides was confirmed by sequencing genomic DNA from BY4743 (which is derived from S288C). This is in agreement with GenBank accession X71416, which is the sequence of YKL203C from JK9-3da. Personal communication from Vik Anand (vik@ucla.edu).

New: 58925 CCAAACCCCAGGCAGCGCCGGCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58984
           |||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||
Old: 58925 CCAAACCCCAGGCAGCG---GCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58981
2001-05-31YKL201C, YKL202W6428764287SubstitutionTC
 SGD received a direct notification from MIPS about the following sequence change. The nucleotide at coordinate 64287 was changed from T to C, altering translation of YKL202W by changing amino acid 157 from a Phe (TTT) to a Ser (TCT). This change also affects overlapping ORF MNN4/YKL201C. Note that this is the exact reciprocal of the sequence change made to this nucleotide on 1998-11-10.

Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
1999-03-12YKL201C, YKL202W6428764287SubstitutionCT
 MIPS made a correction to YKL202W, that also affects overlapping ORF MNN4/YKL201C: the C at chromosomal coordinate 64287 was changed to a T.
Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
1999-03-12
YKL201C
6568965689DeletionA
6576165761DeletionT
6745767457InsertionT
 MIPS made corrections in the area covering MNN4/YKL201C which resulted in the removal of YKL200C. MNN4/YKL201C now encompasses both ORFs plus additional sequence (coordinates 67463-63927). The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927.

Deletion of the A at 65689

Old: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTGACTAGCTAGACC 65700
           |||||||||||||||||||||||||||||||||||||| |||||||||||
New: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTG-CTAGCTAGACC 65699

Deletion of the T at 65761
Old: 65751 TATTGTTTTTTACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65800
           |||||||||| |||||||||||||||||||||||||||||||||||||||
New: 65750 TATTGTTTTT-ACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65798

Insertion of a T after the T at 67457
Old: 67440 GTGAAGTTTAGATGATAT-CGCTGAAGCATAACTAATTAGTTTATTTGTG 67488
           |||||||||||||||||| |||||||||||||||||||||||||||||||
New: 67434 GTGAAGTTTAGATGATATTCGCTGAAGCATAACTAATTAGTTTATTTGTG 67483

Odani T, et al. (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10
SGD Papers Entry  Pubmed Entry  DOI full text  
Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
SGD Papers Entry  

1999-03-12
YKL200C, YKL201C
6592265922DeletionA
6627866278DeletionT
6629866298InsertionG
6668566685DeletionT
6671566715DeletionT
6672566725DeletionT
 MIPS made sequence corrections in the area covering YKL200C that resulted in its subsumption into MNN4/YKL201C, which now encompasses both ORFs plus additional sequence (coordinates 67463-63927). The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927.

Deletion of the A at 65922

Old: 65871 GGGCATTTGCAAGTCGAAATCGTTATCCCAAAGGGAAAGCCATTCCATTG 65940
           ||||||||||||||||||||||||||||||| ||||||||||||||||||
New: 65869 GGGCATTTGCAAGTCGAAATCGTTATCCCAA-GGGAAAGCCATTCCATTG 65937

Deletion of the T at 66278, insertion of a G after the G at 66298
Old: 66231 CTAACTCTTCAATTTTTTTGGAGGCATTCGAACTTGAAATCCGAAGGG-A 66299
           ||||||||||||||||||||||||||| |||||||||||||||||||| |
New: 66228 CTAACTCTTCAATTTTTTTGGAGGCAT-CGAACTTGAAATCCGAAGGGGA 66296

Deletion of the T at 66685, deletion of the T at 66715
Old: 66650 GTATTAAATCTTAAATCCCTTAGGAGAGCCATGCCCGTCTGGAGTTGAAT 66719
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||
New: 66647 GTATTAAATCTTAAA-CCCTTAGGAGAGCCATGCCCGTCTGGAGT-GAAT 66714

Deletion of the T at 66725
Old: 66720 AGCTTTGGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66769
           ||||| ||||||||||||||||||||||||||||||||||||||||||||
New: 66715 AGCTT-GGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66763

Odani T, et al. (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10
SGD Papers Entry  Pubmed Entry  DOI full text  
Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
SGD Papers Entry  

2011-02-03YKL198C, YKL201C6795667956DeletionA
 A single nucleotide deletion was made within the intergenic region between ORFs MNN4/YKL201C and PTK1/YKL198C.
New    67918   CGTGCACCGCATCAAATTTTCTCGGAGGATTCTTTGC-GCCGGTTTTCATTTTCTTCCAC  67976
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    67919   CGTGCACCGCATCAAATTTTCTCGGAGGATTCTTTGCAGCCGGTTTTCATTTTCTTCCAC  67978

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YKL198C
6831568315DeletionC
6932569326SubstitutionTGCT
6949469494DeletionG
6950169501Insertion C
 Five nucleotide changes were made within the ORF PTK1/YKL198C, altering its coding sequence: one single insertion, two single deletions, and two substitutions. The start and majority of the reading frame remain the same, but a small section of the annotated protein sequence is now different, the C-terminus has changed, and the annotated protein is now 13 amino acids longer.
New    68277   GACCAAGCTGTTGACAATGTTCAGATGGTGATGCAC-TACCCTGTGCGGGGAGTGGCCAC  68335
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    68279   GACCAAGCTGTTGACAATGTTCAGATGGTGATGCACCTACCCTGTGCGGGGAGTGGCCAC  68338
New    69296   TACAAAACTTTTCTGCTAGGGCCACGCTGCGCCAGCCCGATTTTTGTATCATCGCGAACA  69355
               ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||
Old    69299   TACAAAACTTTTCTGCTAGGGCCACGTGGCGCCAGCCCGATTTTTGTATCATCGCGAACA  69358
New    69476   TGATAAACTCCTTTG-AGCAGCGCTTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA  69534
               ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||
Old    69479   TGATAAACTCCTTTGGAGCAGCG-TTGTAGAATTTCTCGGGCGTTTCATTATAGATCATA  69537

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

1999-03-12
YKL198C, YKL199C
6886368863InsertionC
6910169101InsertionG
 MIPS made corrections in the area covering PTK1/YKL198C and YKT9/YKL199C.

Insertion of a C after the C at 68861

Old: 68819 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGC-GCGATTGCGGAATGCG 68877
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New: 68814 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGCCGCGATTGCGGAATGCG 68873

Insertion of a G after the G at 69100
Old: 69058 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCG-CGAGCCGATCATCCCT 69116
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New: 69054 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCGGCGAGCCGATCATCCCT 69113
2003-01-08YKL198C, YKL199C6915669156DeletionG
 Due to the deletion of the G at coordinate 69156 on Chromosome XI, YKL198C and YKL199C have been merged into one single ORF - PTK1/YKL198C - encoding a protein of 649 amino acids (1950 nucleotides). The new start and stop coordinates of PTK1/YKL198C are 70219 and 68270, respectively. The names YKT9 and YKL199C are being retained as aliases. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. We thank Gerard Manning (gerard-manning@sugen.com) for reporting this sequence error on Chromosome XI to SGD.

Old: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTGGTGGTACCAGTCTGAGATACCAAAA 69180
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTG-TGGTACCAGTCTGAGATACCAAAA 69179
2011-02-03
YKL197C, YKL198C
7048770487DeletionA
7068370683DeletionA
 Two separate single nucleotide deletions were made in the intergenic region between ORFs PTK1/YKL198C and PEX1/YKL197C.
New    70435   AAAAAAGCGTATAGGTGCTAAGAAGAATTAAGTATCAAAAGGTAGCAGG-CATTTATGTT  70493
               ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    70438   AAAAAAGCGTATAGGTGCTAAGAAGAATTAAGTATCAAAAGGTAGCAGGACATTTATGTT  70497
New    70664   TAATAAGCAACGTGC-GCCGCATTTTTTGCCCTTTAAAGGGAAACGCGCTTTGTTCTTTT  70722
               ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    70668   TAATAAGCAACGTGCAGCCGCATTTTTTGCCCTTTAAAGGGAAACGCGCTTTGTTCTTTT  70727

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL157W158179158179DeletionG
 A single G nucleotide was deleted within ORF APE2/YKL157W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids longer.
New    158153  CTATTACTTCGAAAGCGCAGT-GGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG  158211
               ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    158158  CTATTACTTCGAAAGCGCAGTGGGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTG  158217

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL156W158690158690Insertion A
 A single nucleotide insertion was made within the intron of ORF RPS27A/YKL156W.
New    158642  GCAACTGGACCAGTGAATAGAACAATACATATAGATAAGTCGCAAAAAGAAAAGAATACA  158701
               ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    158648  GCAACTGGACCAGTGAATAGAACAATACATATAGATAAGTCGC-AAAAGAAAAGAATACA  158706

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2005-12-15
YKL137W
185979185979DeletionA
185988185988DeletionA
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the start site for YKL137W be moved 26 nt upstream. SGD has confirmed the deletion of the A at 185979 and the deletion of the A at 185988. As a consequence, YKL137W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 103 amino acids to 111 amino acids.
New:        ATGGAGCAAAACAAAGA-TCCGCAGA-TGATCTCGAAACATAGTTCTAGGCTACCTATAT
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||
Old: 185962 ATGGAGCAAAACAAAGAATCCGCAGAATGATCTCGAAACATAGTTCTAGGCTACCTATAT 186021

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03
YKL134C
189339189339DeletionA
189367189367Insertion T
190397190397Insertion A
190404190404Insertion T
190405190405Insertion G
190408190408Insertion T
190409190409Insertion T
190415190415Insertion T
 Six single nucleotides were inserted near the middle of ORF OCT1/YKL134C, and one nucleotide was inserted and another deleted near its 3' end, altering the OCT1 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now one amino acid longer and two separate small sections of the protein sequence are now different.
New    189292  CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATC-AAATAAGTAGCTGTAAT  189350
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    189297  CTCGAAAAGGGCGTACCAGATTTTAGAAGCTATCGTCCTATCAAAATAAGTAGCTGTAAT  189356
New    189351  AAGTTGCCCCGTATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA  189410
               ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    189357  AAGTTGCCCCG-ATCCAAATAAATGGCCGAATCTTCCACACCAATTACTCTGATCGTCCA  189415
New    190371  TTAACGTCAAAATAAAATCTTGAACATCTTTCGGATTCTTTGCCATTTTACCTTCCAATT  190430
               |||||||||||||||||||||| ||||||| | ||| | |||||| ||||||||||||||
Old    190376  TTAACGTCAAAATAAAATCTTG-ACATCTT-C-GAT-C-TTGCCA-TTTACCTTCCAATT  190429

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL133C192315192316SubstitutionATTA
 Nucleotide change(s) in the coding region of YKL133C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 252 is now Tyrosine rather than Isoleucine.
New    192291  TCTTTTAGAGTTTAAATGCATTTGGTAGTCAGGTTTGGATTTACCAATAAATGGTAGACC  192350
               |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||
Old    192290  TCTTTTAGAGTTTAAATGCATTTGGATGTCAGGTTTGGATTTACCAATAAATGGTAGACC  192349

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YKL129C
197105197106SubstitutionCGGC
199353199353Insertion T
199359199359Insertion T
199368199368Insertion T
199377199378SubstitutionATTA
 Three nucleotides were inserted within the ORF MYO3/YKL129C, and a dinucleotide substitution was also made in the same region, altering the MYO3 coding sequence. A silent dinucleotide substitution was also made within the ORF. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New    197091  TGTGCAGCGGTAGCTGCCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC  197150
               |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||
Old    197090  TGTGCAGCGGTAGCTCGCAAAGATAACGGATTCACAGGTTTTTGCGAAGGGAGAGGTTGC  197149
New    199311  ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATCTTTTACGTCATCAATT  199370
               |||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||
Old    199310  ACTAAACCAATGGTTCTCATAGCCTCTAACGTGCCTTCGTAATC-TTTACG-CATCAATT  199367
New    199371  GTATCTGCAGTAGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA  199430
               | ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||
Old    199368  G-ATCTGCAGATGTACAGCCAGCCGCAGCAGTGTAAATATATTGCTCAGGCATTTGCACA  199426

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL128C, YKL129C200382200382Insertion GTTTACCTTTAGTTAGAAAAGCGAT GGAGCTAGCATCTTGCTACTATATA ATAGTTGTTCAAGATCGTAGGTCTG CCTGCCGAGTGATTAGGGGAGGCTA CTGAAGTTTGTTTTAATGTACCGGT TACATTTTCTTGTACGAAAGTATAT GAAGGGGGCTTATTACTTCCAAGCC TATATTTTCTGTGGCATCGATTAGT ATAGTATAAAAGAGGGAGTGGACAT AGCGGTGAAAACTATACAAGAATAA AAAAGGAACTAAGAACCCTTTGCAT TCATATAATTTCACATATGCATTTT TTATTTTATACTCAAATGTATGTTC TCACCTAGCTTGAGAAAGCGATGAT CA
 A 352-nucleotide insertion was made in the intergenic region between ORFs MYO3/YKL129C and PMU1/YKL128C.
New    200331  TTTCCTTTTTCGGTAAAGCTCTTCCCGAGGTTTATTATATAAATGCAAATCGATCA  200386
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    200327  TTTCCTTTTTCGGTAAAGCTCTTCCCGAGGTTTATTATATAAATGCAAATCGATCA  200382
New    200387  GTTTACCTTTAGTTAGAAAAGCGATGGAGCTAGCATCTTGCTACTATATAATAGT  200441
New    200442  TGTTCAAGATCGTAGGTCTGCCTGCCGAGTGATTAGGGGAGGCTACTGAAGTTTGTTTTA  200501
New    200502  ATGTACCGGTTACATTTTCTTGTACGAAAGTATATGAAGGGGGCTTATTACTTCCAAGCC  200561
New    200562  TATATTTTCTGTGGCATCGATTAGTATAGTATAAAAGAGGGAGTGGACATAGCGGTGAAA  200621
New    200622  ACTATACAAGAATAAAAAAGGAACTAAGAACCCTTTGCATTCATATAATTTCACATATGC  200681
New    200682  ATTTTTTATTTTATACTCAAATGTATGTTCTCACCTAGCTTGAGAAAGCGATGATCA  200738
New    200739  AAGTGAAAGGTTCAACCATTTCTCAAAGTGCTTAACACATTATTTGAAAAGAAAG  200793
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    200383  AAGTGAAAGGTTCAACCATTTCTCAAAGTGCTTAACACATTATTTGAAAAGAAAG  200437

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL104C, YKL105C242811242811SubstitutionTA
 A single nucleotide substitution was made in the intergenic region between ORFs YKL105C and GFA1/YKL104C.
New    243154  AAGGAGAAGTGATAGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG  243213
               ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    242798  AAGGAGAAGTGATTGTAGAAAGACGGATGGGAGGCTGGGGGACGAAGAGAAAGTAAAAGG  242857

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL101W253006253007SubstitutionATTA
 Nucleotide change(s) in the coding region of HSL1/YKL101W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1482 is now Threonine rather than Serine.
New    253354  AATGCATCTACGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT  253413
               ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    252998  AATGCATCATCGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAAT  253057

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2005-12-15YKL099C255410255410InsertionA
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YKL099C be moved 19 nt upstream. SGD has confirmed the insertion of an A after the A at 255410. As a consequence, YKL099C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 256 amino acids to 250 amino acids.
New:        CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGAAGAGTCTACGATTTT
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old: 255366 CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGA-GAGTCTACGATTTT 255424

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03YKL065C316656316656SubstitutionCT
 Nucleotide change(s) in the coding region of YET1/YKL065C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 16 is now Methionine rather than Valine.
New    316964  TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCATCTCAACAGTGA  317023
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    316608  TACGGATCCGGAATGGCAAAGGCAAAACGAAGATGAAGAGCATTACCACCTCAACAGTGA  316667

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL055C335190335190SubstitutionCT
 A single nucleotide substitution was made within ORF OAR1/YKL055C. Note that the protein sequence was not affected.
New    335504  TGGTTCCATTTCTGCAGCTAAAACTTCTGTAAATCTGGACAGTGCGGCTTTAGAGGCGGA  335563
               |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    335148  TGGTTCCATTTCTGCAGCTAAAACTTCTGTAAATCTGGACAGCGCGGCTTTAGAGGCGGA  335207

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2008-06-03YKL052C340150340150SubstitutionAT
 Greg Prelich's lab demonstrated a sequence error at coordinate 340150 on Chromosome XI within ASK1/YKL052C: on Watson strand the A should be a T. This is nucleotide 41 of the Crick strand ASK1/YKL052C, and changes Val14 to Asp. The error was verified in S288C-derivative strain FY4.
New: 50     ATTTCTTGATCAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 1
            ||||||||| ||||||||||||||||||||||||||||||||||||||||
Old: 340141 ATTTCTTGAACAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 340190

Prelich G (2008)
SGD Papers Entry  

2003-01-07YKL049C346324346324InsertionG
 Due to the insertion of a G after the G at 346324, the coordinates of CSE4/YKL049C have been changed from 346130-345717 to 346406-345717, extending the ORF from 414 bp in length to 690 bp. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. Thanks to Sam Stoler, Judith Sharp, Vivian Measday, Sue Biggins, and Kelcy Newell for reporting this sequence error on Chromosome XI to SGD.
Old: 346321 CCTG-AAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 346320 CCTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379

Stoler S, et al. (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86
SGD Papers Entry  Pubmed Entry  DOI full text  

2003-01-10YKL049C346324346324SubstitutionGC
 The G inserted after the G at 346324 three days ago was changed to a C.
Old: 346321 CTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 346321 CTGCAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380
2011-02-03YKL042W, YKL043W357929357929SubstitutionTC
 A single nucleotide substitution was made in the intergenic region between ORFs PHD1/YKL043W and SPC42/YKL042W.
New    358244  GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAACACCTGCTAAAAAATATCA  358303
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old    357888  GCGTCGTGGTTGGTGAACCTGGTACAAAATAAATAAAAAAATACCTGCTAAAAAATATCA  357947

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKL041W, YKL042W359604359604Insertion G
 A single nucleotide insertion was made in the intergenic region between ORFs SPC42/YKL042W and VPS24/YKL041W.
New    359914  ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAATGGCGTAAACGCAT  359973
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old    359558  ATCGCTTTTGACGATATAGTACTAGCAATCTGCGGTTCCAATGGAAT-GCGTAAACGCAT  359616

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2005-12-14YKL039W363802363802InsertionG
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for PTM1/YKL039W be moved 25 nt upstream. SGD has confirmed the insertion of a G after the G at 363802. As a consequence, YKL039W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 531 amino acids to 523 amino acids.
New:        AGAAGGACACGATAATGTAAATAACCATAGCCAAGGCCACGGGCCAGTGTCTCCCTCTCC
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old: 363768 AGAAGGACACGATAATGTAAATAACCATAGCCAAG-CCACGGGCCAGTGTCTCCCTCTCC 363826

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2004-02-12YKL033W-A374308374308InsertionG
 Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at chromosomal coordinate 374308 in YKL033W-A. As a consequence of this sequence change, YKL033W-A was extended at the 3' end, increasing the size of the predicted protein from 60 amino acids to 236 amino acids.
New: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCGGAAGCAGGAAAAAGGGTGATCGAACACT 374336
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCG-AAGCAGGAAAAAGGGTGATCGAACACT 374335

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2011-02-03YKL023W393438393439SubstitutionCGGC
 Nucleotide change(s) in the coding region of YKL023W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 25-26 are now QQ rather than HE.
New    393754  GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCAGCAGGCCTACTCTAATTGG  393813
               |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Old    393397  GATGACAGTATTGATAGCCAAAAAAGATGCGTCACGGATCACGAGGCCTACTCTAATTGG  393456

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKR008W453012453012SubstitutionTA
 Nucleotide change(s) in the coding region of RSC4/YKR008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 390 is now Lysine rather than Isoleucine.
New    453334  ACTGAACCCAAACAACTTCAAAAAGTTAATAGCCAAACCGGAAACAGTGCAATCCGAAGT  453393
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old    452977  ACTGAACCCAAACAACTTCAAAAAGTTAATAGCCATACCGGAAACAGTGCAATCCGAAGT  453036

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKR009C, YKRCdelta8457775457775SubstitutionCT
 A single nucleotide substitution was made in the intergenic region between ORF FOX2/YKR009C and Ty1 LTR YKRCdelta8.
New    458084  CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTTGTCATATTGAG  458143
               |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    457727  CTCTTCATACATATAAATGTTGCAATAAAAATCAACTAATATCTATGTCGTCATATTGAG  457786

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YKR012C
463435463435SubstitutionGT
463468463468SubstitutionGT
 Nucleotide change(s) in the coding region of YKR012C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 98 is now Lysine rather than Glutamine, and residue 109 is now Lysine rather than Glutamine.
New    463774  CTCTATATGTAATGTTTTTGAAACATAGACGTCGTTCAAAGGCAATGCTTTTGATCTTTG  463833
               |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||
Old    463417  CTCTATATGTAATGTTTTGGAAACATAGACGTCGTTCAAAGGCAATGCTTTGGATCTTTG  463476

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKR021W479596479596SubstitutionCT
 A single nucleotide substitution was made within ORF ALY1/YKR021W. Note that the protein sequence was not affected.
New    479914  TAACTCTTTGTCACCTCATACCTTCATATCTGATTTGTTTACAAAAACATTCAGTAATAG  479973
               ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    479557  TAACTCTTTGTCACCTCATACCTTCATATCTGATTTGTTCACAAAAACATTCAGTAATAG  479616

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKR028W496923496923Insertion G
 A single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
New    497254  ATATCAAGCGATGAAGAAGACTCCGAAGATGAAGATGAAGAGAATGATATGGGCAATGAG  497313
               ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    496897  ATATCAAGCGATGAAGAAGACTCCGAA-ATGAAGATGAAGAGAATGATATGGGCAATGAG  496955

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03YKR036C509993509994SubstitutionCGGC
 Nucleotide change(s) in the coding region of CAF4/YKR036C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 94-95 are now QR rather than HG.
New    510334  GTTGGGTAGCGGGTATCGCTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA  510393
               |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||
Old    509976  GTTGGGTAGCGGGTATCCGTGCTCATCTAAATGAGCAAGTATTCTGAAAGTTGTTGCAGA  510035

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-02-11YKR056W550828550828InsertionA
 Brachat et al. 2003 predicted and confirmed the insertion of a single A nucleotide after the A at chromosomal coordinate 550828 in YKR056W. As a consequence of this sequence change, YKR056W was extended in the 3' end, increasing the size of the predicted protein from 617 to 639 amino acids.
New: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATAATCCAGCCAAGATTATTTACATATCGTGT 550857
            ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATA-TCCAGCCAAGATTATTTACATATCGTGT 550856

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2005-12-01
YKR058W
552426552426InsertionG
552522552522DeletionA
 Based on the automated comparison of related fungi, Cliften et al. (2003) and Brachat et al. (2003) suggest that the start site for GLG1/YKR058W be moved 409 nt upstream. SGD has confirmed the insertion of a G after the G at 522426 and the deletion of the A at 552522. As a consequence, YKR058W was extended at the 5' end, altering the N-terminus and increasing the size the predicted protein from 480 amino acids to 616 amino acids.
New:        GCGTACTAGTGTGATGGGAATGTATAAGAAGCTGGCTATTGCCACATTGCTCTATTCCGC
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old: 552393 GCGTACTAGTGTGATGGGAATGTATAAGAAGCTG-CTATTGCCACATTGCTCTATTCCGC 552451
and
New:        TAGAGGAAGCAGGCAAAAAA-GGCGACATTGAAACATGC
|||||||||||||||||||| ||||||||||||||||||
Old: 552502 TAGAGGAAGCAGGCAAAAAAAGGCGACATTGAAACATGC 552540

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2004-07-23YKR087C603776603776InsertionT
 The work of Kellis et al. 2003 predicted a single nucleotide insertion upstream of OMA1/YKR087C. SGD resequenced this region and found that a single T nucleotide after the G at chromosomal coordinate 603776 was necessary to correct the reference sequence. As a consequence of this change, OMA1/YKR087C was extended at the 5' end, altering the N-terminus without changing the translation frame for most of the protein, and increasing the size of the predicted protein from 314 to 345 amino acids.
New: 603735 CCATTATTAAATCGACGATATGAAGGACCATTGTCATAGCGGTAACATCGCGTTAACTGA 603794
            |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old: 603735 CCATTATTAAATCGACGATATGAAGGACCATTGTCATAGCGG-AACATCGCGTTAACTGA 603793

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2011-02-03YKR090W610650610650SubstitutionCG
 Nucleotide change(s) in the coding region of PXL1/YKR090W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Serine rather than Threonine.
New    610964  CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAAGCAATGATAAGAACAA  611023
               |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    610606  CATGGAAGCTCTCTTGAAGGAAGGTATCGACAATGCTACATCAACCAATGATAAGAACAA  610665

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-07-23YKR091W611279611279InsertionG
 The works of Kellis et al. 2003 and Cliften et al. 2003 predicted a single nucleotide insertion upstream of SRL3/YKR091W. SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, SRL3/YKR091W was extended at the 5' end, altering the N-terminus without changing the translation frame, and increasing the size of the predicted protein from 152 to 246 amino acids.
New: 611256 GATACTGAATCTAACAGCCTTCTGGCGACGCCGGCAAGGAAATATTTCAAAACTTCAATA 611315
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old: 611256 GATACTGAATCTAACAGCCTTCTG-CGACGCCGGCAAGGAAATATTTCAAAACTTCAATA 611314

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2011-02-03YKR094C618236618237SubstitutionGAAG
 A dinucleotide substitution was made within the intron of ORF RPL40B/YKR094C.
New    618574  TAAACTCAGAAGCTTGCCGCAGGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT  618633
               ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
Old    618216  TAAACTCAGAAGCTTGCCGCGAGTAATAGTTTTTCTCAATTGCTACTTGTTTAATAAATT  618275

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2011-02-03
YKR096W, YKR097W
630159630159Insertion C
630168630168Insertion G
630274630274Insertion T
630275630275Insertion T
 Four nucleotides were inserted within the intergenic region between ORFs YKR096W and PCK1/YKR097W.
New    630504  GCACTTGGGCAGAGCCCCCACCCAGGGCCTTGTCGGAAAAAATCGGAATATCCCACACGA  630563
               |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||
Old    630146  GCACTTGGGCAGAG-CCCCACCCA-GGCCTTGTCGGAAAAAATCGGAATATCCCACACGA  630203
New    630624  TACATCTCTTTTCTTTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC  630683
               ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
Old    630264  TACATCTCTTT-C-TTTTTTGACTCACAATAGGAAAAAACCGAGCTTCCTTTCATCCGGC  630321

Engel SR, et al. (2013) The Reference Genome Sequence of Saccharomyces cerevisiae: Then and Now. G3 (Bethesda)
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2004-02-11YKR099C-A, YKR100C638899638899InsertionG
 Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at 638899 in YKR100C. As a consequence of this sequence change, YKR099C-A was merged into YKR100C. YKR100C was extended in the 3' end, increasing the size of the predicted protein from 241 amino acids to 355 amino acids.

New: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGGGTAATACGAACCAAAGTCCTG 638920
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGG-TAATACGAACCAAAGTCCTG 638919

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

ANNOTATION CHANGES without sequence changesJump to: Sequence changes

Date Affected Features
2014-11-19ARS1103, ARS1106, ARS1125
 New ARS consensus sequences were annotated within the following ARS elements on Chromosome XI based on Liachko et al. 2013: ARS1103, ARS1125, ARS1106.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2014-11-19ARS1106, ARS1120, ARS1125
 The chromosomal coordinates of the following ARS elements on Chromosome XI were updated based on Liachko et al. 2013: ARS1125, ARS1106, ARS1120.

Liachko I, et al. (2013) High-resolution mapping, characterization, and optimization of autonomously replicating sequences in yeast. Genome Res 23(4):698-704
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2009-05-06ARS1102, ARS1104, ARS1115
 The following ARS elements on Chromosome XI were added to the genome annotation based on Raveendranathan et al. 2006: ARS1102, ARS1104, and ARS1115.

Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
SGD Papers Entry  Pubmed Entry  DOI full text  PMC full text  

2009-02-20YKR101W
 The annotated translation start of SIR1/YKR101W was moved 24 aa (72 nt) downstream based on Gallagher et al. 2009. The old chromosomal coordinates were 640106-642142, and are now 640178-642142.

Gallagher JE, et al. (2009) Elaboration, diversification and regulation of the sir1 family of silencing proteins in Saccharomyces. Genetics 181(4):1477-91
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2007-09-05YKR005C
 The start of ORF YKR005C was moved upstream 303 nt from 449507 to 449810, and an intron was added at new relative coordinates 148-216, based on Miura et al. 2006.

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  

2007-04-04YKL186C
 MTR2/YKL186C mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version.

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  

2007-04-04YKL150W
 MCR1/YKL150W mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version.

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  Web Supplement  yfgdb  
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  yfgdb  

2006-10-03ARS1125, ARS1126, ARS1127
 The following ARS elements on Chromosome XI were added to the genome annotation based on Nieduszynski et al. 2006: ARS1125/ARS1104.5, ARS1126/ARS1106.3, ARS1127/ARS1106.7.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-09-08ARS1103, ARS1106, ARS1109, ARS1112, ARS1113, ARS1114, ARS1116, ARS1118, ARS1120, ARS1123
 The following new ARS elements on Chromosome XI were added to SGD based on Nieduszynski et al. 2006: ARS1103, ARS1106, ARS1109, ARS1112, ARS1113, ARS1114, ARS1116, ARS1118, ARS1120, ARS1123.

Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  

2006-05-08YKL168C
 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for KKQ8/YKL168C was moved 30 nt (10 codons) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2006-05-08YKR036C
 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for CAF4/YKR036C was moved 48 nt (16 codons) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2006-05-08YKL207W
 The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for YKL207W was moved 87 nt (29 codons) downstream.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2006-03-02snR87
 New snoRNA published by Davis and Ares.

Davis CA and Ares M Jr (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2005-11-17YKL023C-A, YKL065W-A
 Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following ORFs be added to the annotation of Chromosome XI: YKL065W-A and YKL023C-A.

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2005-11-03YKR042W
 The work of Zhang and Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of UTH1/YKR042W be moved 255 nt downstream from 518914 to 519169. This annotation change results in a predicted protein of 365 aa, as opposed to the previously annotated 450 aa.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2004-10-12CEN11
 The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003).

Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-03-08YKR004C, YKR004C-A
 The small ORF YKR004C-A was added based on Kessler et al. 2003. However, Brachat et al. 2003 demonstrated that this ORF is actually an exon of YKR004C. Based on this information, YKR004C-A has been merged into YKR004C.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-02-09YKL157W, YKL158W
 In July 2003, YKL158W was mistakenly added back to SGD as an independent ORF. This annotation mistake has been corrected, and YKL158W has again been "merged" into YKL157W.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2004-01-29YKR095W-A
 The coordinates for Exon1 and the intron have changed. The 5' end of Exon1 has been moved 210 bp downstream, and the size of the intron has been reduced from 300 bp to 75 bp. Note that there is no change to Exon2.
2003-09-27YKR004C
 Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for ECM9/YKR004C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has an 85-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YKR006C
 Based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003, the translation start site for MRPL13/YKR006C was moved 33 nt (11 codons) downstream. Evidence supporting this change includes: 1) The upstream ATG is not conserved in 3 related Saccharomyces species; 2) The reading frame is conserved only after the 2nd ATG; 3) Although the amino terminus contains a mitochondrial targeting sequence (Grohmann et al. 1994), this protein is still predicted to be targeted to the mitochondrion even if it uses the proposed start methionine (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter).

Grohmann L, et al. (1994) The yeast nuclear gene MRP-L13 codes for a protein of the large subunit of the mitochondrial ribosome. Curr Genet 26(1):8-14
SGD Papers Entry  Pubmed Entry  DOI full text  
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata

2003-09-22YKR045C
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR045C be moved 24 nt (8 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YKR038C
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR038C be moved 105 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although there is an upstream ATG in S. paradoxus, an insertion causes a frame shift between this ATG and the predicted start site; 4) Sequence comparison to the nr dataset shows there is no sequence similarity between S. cerevisiae and other species between the first and second ATG; the sequence similarities begin after the 2nd ATG.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-22YKL195W
 Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKL195W be moved 72 nt (24 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  SGD Curated Comments & Errata
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-09-09TEL11L, TEL11R
 The chromosomal locations for TEL11R-TR, TEL11R-XR, TEL11R-XC, TEL11R, TEL11L-TR, TEL11L-XR, TEL11L-XC, and TEL11L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2003-08-07YKR099C-A
 The chromosomal coordinates of ORF YKR099C-A were shifted 1 nucleotide downstream, from 638723-638532 to 638722-638531. Note that the sequence remains unchanged.
2003-07-29YKL183C-A, YKR004C-A
 Thanks to Kessler et al. for providing the coordinates of the following Chromosome XI ORFs: YKL183C-A and YKR004C-A.

Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YKL100W-A, YKL145W-A, YKR099C-A
 Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XI ORFs: YKL100W-A, YKL145W-A, and YKR099C-A.

Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9
SGD Papers Entry  Pubmed Entry  PMC full text  
Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  
Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  Web Supplement  yfgdb  

2003-07-29YKL068W-A
 Thanks to Brachat et al. for providing the coordinates of YKL068W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

2003-07-29YKL096C-B, YKL156C-A, YKR075W-A
 Thanks to Kumar et al. for providing the coordinates of the following Chromosome XI ORFs: YKL096C-B, YKR075W-A, and YKL156C-A.

Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  yfgdb  SGD Curated Comments & Errata

2003-07-29YKR095W-A
 Thanks to Brachat et al and Cliften et al. for providing the coordinates of YKR095W-A.

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
SGD Papers Entry  Pubmed Entry  DOI full text  Web Supplement  

2003-07-29YKL158W
 Thanks to MIPS for providing the coordinates of YKL158W.
2001-03-14YKL003W-A
 This ORF was initially added to SGD on 2001-02-26 based on homology (Blandin et al.), but was subsequently deleted because it is contained within DID4/YKL002W (Mark Hochstrasser, personal communication; Amerik et al.).

Amerik AY, et al. (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol Biol Cell 11(10):3365-80
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  
Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
SGD Papers Entry  Pubmed Entry  DOI full text  

2001-03-09snR42
 Changed from W -> C: old start coord: 558652; old stop coord: 559002 new start coord: 559002; new stop coord: 558652 References: 1. Ni et al. (1996) Cell 86(5):823-834 2. snoRNA Database: http://www.bio.umass.edu/biochem/rna-sequence/Yeast_snoRNA_Database/snoRNA_DataB ase.html 3. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706
2000-12-01YKL199C
 The start site of YKL199C was moved 276 nucleotides upstream, increasing the size of the ORF from 564 nt to 840 nt, and the size of the predicted protein from 187 amino acids to 279 aa.
2000-08-11YKL096W-A
 Old name: YKL097W-A; new name: YKL096W-A; date: 11/1998; old coord: ChrXI 258895 259173; SGDID: S0001956; Name changed due to nomenclature
2000-07-22YKL002W
 The start site of YKL002W was moved 243 bp upstream, and a 68-bp intron was added at relative coordinates 61-128.
2000-07-14YKL157W, YKL158W
 YKL157W and YKL158W were merged into a single ORF, designated YKL157W, based on evidence published by Davis et al. 2000 demonstrating the presence of an intron between these two ORFs.

Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6
SGD Papers Entry  Pubmed Entry  PMC full text  DOI full text  

1998-05-21YKL033W-A, YKL053C-A, YKL162C-A
 The following 27 ORFs were added to the genome annotation based on Velculescu et al. 1997: YBL091C-A, YBL107W-A, YCR018C-A, YCR102W-A, YDL130W-A, YDR034C-A, YDR034W-B, YDR363W-A, YDR525W-A, YER048W-A, YER091C-A, YER138W-A, YGR122C-A, YIR020W-B, YKL033W-A, YKL053C-A, YKL162C-A, YLL018C-A, YLR262C-A, YML081C-A, YMR046W-A, YMR158C-B, YMR194C-A, YNR032C-A, YOL013W-A, YOR298C-A, and YPR002C-A.

The coordinates of the tag sequences along the genome were determined and each tag was classified into one of these four categories: 1) class 1 - within an existing ORF, 2) class 2 - within 500 bp downstream of existing an ORF, 3) class 4 - opposite of an existing ORF, or 4) class 3 - none of the above. The regions between two existing ORFs which contained one or more unique class 3 tags (number 4) above) were examined for potential coding sequences in which the unique tag was located either within the coding sequence or 500bp downstream of this sequence. BLASTP analysis was then performed for each potential ORF meeting these criteria against the non-redundant (nr) NCBI dataset, and those with a P value exponent of -6 or less were analyzed further. The BLAST results were analyzed on an individual basis for each potential ORF meeting the above criteria. Those potential ORFs which exhibited reasonable homology to other proteins, and did not appear to be matched with other proteins based on homology to repetitive sequences alone, were identified and entered into SGD.

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51
SGD Papers Entry  Pubmed Entry  DOI full text  yfgdb  

Jump to: Sequence Changes | Annotation Changes without Sequence Changes