Chromosome XV History |
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
| Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2011-02-03 | ||||||
| YOL138C | ||||||
| 61985 | 61985 | Substitution | A | T | ||
| 63708 | 63708 | Substitution | C | T | ||
| 64173 | 64173 | Substitution | G | C | ||
|   | Nucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine.
New 61970 CGCATGTCTGGGCGATCCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old 61970 CGCATGTCTGGGCGAACCGATTATTGGTGCTGTATGGGAAGAAAGCTTTTTAAAAGTTTC 62029
New 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGTCAACTGAAAGT 63719
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 63660 GTAGGTTGAAGCTCCGGTTCTACCACCTCATATGAGCCTATCTCTTGGCCAACTGAAAGT 63719
New 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGCATTTACCGTCTCTACCACCTGTAGCA 64199
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old 64140 GCATTGGCATTGTCGCCAACAAACCAGAGGCAGGATTTACCGTCTCTACCACCTGTAGCA 64199Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL141W | 57699 | 57699 | Substitution | A | T |
|   | Nucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine.
New 57661 GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGTTGAGTATACACTACGACAAA 57720
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old 57660 GGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGATGAGTATACACTACGACAAA 57719Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL142W | 56036 | 56036 | Substitution | C | G |
|   | Nucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine.
New 55991 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTGAATTTCGCACGCC 56050
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old 55990 CTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTCAATTTCGCACGCC 56049Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL075C | 190052 | 190053 | Substitution | CG | GC |
|   | Nucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine.
New 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGAGCTTCGCCACAACAGGTAACAATAAAGG 190079
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old 190020 TTTCGAAAAATGTATTTGTCATTATACCAAGACGTTCGCCACAACAGGTAACAATAAAGG 190079Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOR140W | ||||||
| 588318 | 588318 | Insertion | T | |||
| 588363 | 588365 | Substitution | GCG | AGC | ||
| 588344 | 588344 | Deletion | C | |||
|   | Nucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE.
New 588314 TTTTTGTACAATACCAACCGCAGTCGCAAC-AACATGTGACTTATGCGAAGCAACCGGCA 588372
|||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||
Old 588315 TTTT-GTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGCGAGCGAACCGGCA 588373Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR306C | 889947 | 889947 | Substitution | G | C |
|   | Nucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine.
New 889913 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGCAAAAAATAATATAGTGTTGGTAA 889972
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old 889911 ATGTAGCAAACAGCGCTTACAAAAGTTGCCAAACCGGAAAAAATAATATAGTGTTGGTAA 889970Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOL058W | ||||||
| 220207 | 220207 | Insertion | C | |||
| 220195 | 220195 | Deletion | T | |||
|   | Nucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH.
New 220179 TTGATATATAACGGTT-CCTACTTCACCCCAGAGTGTGAGTACATCAGATCTATGATCCA 220238
|||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||
Old 220179 TTGATATATAACGGTTTCCTACTTCACCC-AGAGTGTGAGTACATCAGATCTATGATCCA 220237Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR297C | 874911 | 874911 | Substitution | C | T |
|   | Nucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine.
New 874863 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTTCCTTCGGTAT 874922
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old 874862 TCCTCCATAGAGGCAATAAAGGGCGAGCTTATGCCATCTTGGATACTTTCCCTTCGGTAT 874921Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOR149C | ||||||
| 611036 | 611036 | Substitution | A | G | ||
| 611023 | 611024 | Substitution | GC | TG | ||
|   | Nucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ.
New 610993 TACGTAAGAAGTTAAAAGTAGACTTTTTTTGATGAATTGTACGGCCTTTCTCTCATCCCT 611052
||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||
Old 610994 TACGTAAGAAGTTAAAAGTAGACTTTTTTGCATGAATTGTACAGCCTTTCTCTCATCCCT 611053Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL077C | 186243 | 186243 | Substitution | A | C |
|   | Nucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine.
New 186230 TTTGGTGGTACACCAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 186289
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old 186230 TTTGGTGGTACACAAAAATTATGCACTAGCAACTCCTTAATTAATTGGTAGTGTGGGGAG 1862890Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR130C | 570495 | 570495 | Substitution | A | G |
|   | Nucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine.
New 570474 TCAGGATTTGCCCCAACGGGGAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570533
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old 570475 TCAGGATTTGCCCCAACGGGAAAACGTTTGTATGTTTTTCTAAAAATTTAGAACATTGGT 570534Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| ARS1531, YOL152W | ||||||
| 36149 | 36149 | Substitution | G | A | ||
| 36119 | 36119 | Substitution | G | C | ||
| 36056 | 36056 | Substitution | G | A | ||
| 36013 | 36013 | Substitution | T | A | ||
|   | Four separate single nucleotide substitutions were made in the intergenic region between ARS1531 and ORF FRE7/YOL152W.
New 36001 AAAACTTGAGAATAACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGAAAA 36060
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||
Old 36000 AAAACTTGAGAATTACATAACCCTTTAATAGGCCAATGCAACTGATAGAACACCAGGAAA 36059
New 36061 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGC 36120
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old 36060 AGTTGTAATGCCAGTGCGGCTGAACAGAATCTGTGGTAATAGATTTCGGGTATAATGCGG 36119
New 36121 AAATTAGGAATACTCATATGTTCAGATAGAATAAATAATAAAGAGACCTTCAACATAAAA 36180
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old 36120 AAATTAGGAATACTCATATGTTCAGATAGGATAAATAATAAAGAGACCTTCAACATAAAA 36179Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ARS1531 | 35765 | 35765 | Substitution | G | C |
|   | A single nucleotide substitution was made within ARS1531.
New 35751 TTTTCAAAATCCGCGCAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35810
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old 35750 TTTTCAAAATCCGCGGAAAATTATAGAATTCATCATATATAATGAAGGAACTGTGTTCCT 35809Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR008C-A, YOR008W-B | 343142 | 343142 | Insertion | A | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs YOR008C-A and YOR008W-B.
New 343127 GAAGTATGTAAAAAAATTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old 343128 GAAGTATGTAAAAAA-TTACACACCATTAAGTTCTTATGTAAACCGAAGTCTGGAAGAGA 343186Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL022C | 280393 | 280393 | Substitution | A | G |
|   | A single nucleotide substitution was made within ORF TSR4/YOL022C. Note that the protein sequence was not changed.
New 280377 GGTACCCCATTCCATGCCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280436
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old 280378 GGTACCCCATTCCATACCGTTATCGACAGACACTACTTCTTCCAGATCAAAAATCATCTT 280437Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR049C, YOR050C | 423752 | 423752 | Deletion | T | |
|   | A single nucleotide deletion was made in the intergenic region between ORFs RSB1/YOR049C and YOR050C.
New 423716 CGAAGGTTCGGTACCATACCACCATAAAGGGAATT-ACTGTTAGCTGCTGCTTCTAACTG 423774
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old 423717 CGAAGGTTCGGTACCATACCACCATAAAGGGAATTTACTGTTAGCTGCTGCTTCTAACTG 423776Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOL036W, snR50 | ||||||
| 259235 | 259235 | Deletion | A | |||
| 259230 | 259230 | Deletion | T | |||
|   | Two single nucleotide deletions were made in the intergenic region between ORF YOL036W and snoRNA SNR50.
New 259199 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTT-GGCA-CACATGGTCAACTTTTCTTCTC 259256
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||
Old 259198 ATTAGGATGGTAGCCCTACCTTTTTTTTTTTTTGGCAACACATGGTCAACTTTTCTTCTC 259257Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL163W, YOL164W | 8476 | 8476 | Insertion | T | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs BDS1/YOL164W and YOL163W.
New 8461 AGAGCTTTTCGTATATTCTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8520
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old 8461 AGAGCTTTTCGTATAT-CTGTTTTCCTAATAACATTTACTATTGTGAATTGAAATTTAAA 8519Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR261C, YOR262W | 816959 | 816959 | Insertion | T | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs RPN8/YOR261C and YOR262W.
New 816943 TTTCCTTTCTTTCTTTCTTTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817002
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old 816943 TTTCCTTTCTTTCTTTC-TTTTTTAAATTCGAAAAATGCCCTCAATCAGTAGCAGTTGTA 817001Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR045W, YOR046C | 414326 | 414326 | Deletion | T | |
|   | A single nucleotide deletion was made in the intergenic region between ORFs TOM6/YOR045W and DBP5/YOR046C.
New 414297 ATATGCTGTGTTTGTATTTATATAAGCTT-GCCTCACAAGTAAAAGTGGATCAACAAACT 414355
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old 414297 ATATGCTGTGTTTGTATTTATATAAGCTTTGCCTCACAAGTAAAAGTGGATCAACAAACT 414356Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR256C | 809751 | 809751 | Substitution | C | T |
|   | A single nucleotide substitution was made within ORF TRE2/YOR256C. Note that the protein sequence was not changed.
New 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCTCCGAATTTCTC 809762
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old 809693 GTCTATATTCTCACCATATGGCTCAGATATGAAGATTACAGCTTTAGCCCCGAATTTCTC 809762Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR255W, YOR256C | 808197 | 808197 | Insertion | A | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs OSW1/YOR255W and TRE2/YOR256C.
New 808183 TTACATAATTAAAGAAAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old 808184 TTACATAATTAAAG-AAAAATTTTATTAACATACTTCCTTATACTTACAATATGTATTCT 808242Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOR106W, YOR107W | ||||||
| 521099 | 521099 | Deletion | C | |||
| 521071 | 521071 | Insertion | A | |||
|   | A single nucleotide insertion and a single nucleotide deletion were made in the intergenic region between ORFs VAM3/YOR106W and RGS2/YOR107W.
New 521055 TGGAGATGAAAAAAAAACTTGCTGAATAAAGATAGTTAAGGCGC-TAGTAATCAAATTAA 521113
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||
Old 521056 TGGAGATGAAAAAAAA-CTTGCTGAATAAAGATAGTTAAGGCGCCTAGTAATCAAATTAA 521114Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL076W, YOL077C | 186978 | 186979 | Substitution | CG | GC |
|   | A single nucleotide substitution was made in the intergenic region between ORFs BRX1/YOL077C and MDM20/YOL076W.
New 186960 ACAGAATTCATTGGCGAAGCAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old 186960 ACAGAATTCATTGGCGAACGAACGATACATAACGAGCTCGGTACAGCAATCATCGCATCG 187019Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOL145C | ||||||
| 52199 | 52199 | Substitution | C | T | ||
| 50767 | 50767 | Substitution | C | T | ||
| 50430 | 50431 | Substitution | GG | CC | ||
| 50081 | 50081 | Substitution | T | C | ||
| 50069 | 50069 | Substitution | G | T | ||
| 49941 | 49941 | Substitution | G | T | ||
| 49922 | 49922 | Substitution | T | A | ||
| 49919 | 49919 | Substitution | A | T | ||
| 49912 | 49912 | Substitution | A | T | ||
| 49829 | 49829 | Substitution | G | T | ||
|   | Several nucleotide changes were made in the coding region of CTR9/YOL145C, resulting in an altered protein sequence. The start, stop, and reading frame remain the same, but with the following changes: Gly197->Lys, Gly674->Glu, Thr786->Arg, Lys903->Glu, Arg907->Ser, residues 956-959 are now LIQE not IFQV, and Glu987->Lys.
New 49811 GTCTTGGCTTTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49870
||||||||| ||||||||||||||||||||||||||||||||||||||||
Old 49820 GTCTTGGCTGTTCTTCGTCATATTCATTGTCTTTATCAGACAGATCTGAA 49869
New 49871 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCTCCTGGAT 49920
|||||||||||||||||||||||||||||||||||||||||| ||||||
Old 49870 TCATCTTTAACATTATGTTCACTTATGGCCATGGCTTCTCGCACCTGGAA 49919
New 49921 TAACTTTTGTGCCTCATCTTGTAGTTTCCTATACTCCTCTGCCTGTTTTT 49970
|| |||||||||||||||||| ||||||||||||||||||||||||||||
Old 49920 TATCTTTTGTGCCTCATCTTGGAGTTTCCTATACTCCTCTGCCTGTTTTT 49969
New 50041 AATTTTACGTGCTTCATCAATTTTGGCGCTTTGTTCCTTCTCAAATTCTT 50090
||||||||||||||||||||||||||||| ||||||||||| ||||||||
Old 50040 AATTTTACGTGCTTCATCAATTTTGGCGCGTTGTTCCTTCTTAAATTCTT 50089
New 50401 TTCCAAGGCTTTTTGATAAAAATTCACAGACCTTTCCTTAATGGCACGTG 50450
|||||||||||||||||||||||||||||| ||||||||||||||||||
Old 50400 TTCCAAGGCTTTTTGATAAAAATTCACAGAGGTTTCCTTAATGGCACGTG 50449
New 50761 TGATTTTTCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50810
||||||| ||||||||||||||||||||||||||||||||||||||||||
Old 50760 TGATTTTCCCTGTTCCTTTGGATTCCTGGACTTTTTACCGTCTCTGGCAA 50809
New 52161 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTTCTTCTGATAA 52210
||||||||||||||||||||||||||||||||||||||| ||||||||||
Old 52160 GCAATTCTTGAAAAATTTTCAGACTGGCCATATAATTTTCCTTCTGATAA 52209Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOL140W, YOL141W | ||||||
| 58601 | 58601 | Substitution | C | G | ||
| 58558 | 58558 | Deletion | T | |||
|   | A single nucleotide deletion and a single nucleotide substitution were made in the intergenic region between ORFs PPM2/YOL141W and ARG8/YOL140W.
New 58550 GGATTCGA-ATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATGCGTCATTG 58609
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old 58550 GGATTCGATATGGTTGCCAGCTCGCTATGTGACTCACTTAAAGTACATGATCCGTCATTG 58609Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL139C, YOL140W | 60173 | 60173 | Substitution | A | G |
|   | A single nucleotide substitution was made in the intergenic region between ORFs ARG8/YOL140W and CDC33/YOL139C.
New 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATGATATAATTAATAAGAG 60189
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old 60130 CTTACGTGATATGTACATGTGGTGCGTCTTTCATACCTTGAATAATATAATTAATAAGAG 60189Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL135C, YOL136C | 69084 | 69084 | Substitution | C | T |
|   | A single nucleotide substitution was made in the intergenic region between ORFs PFK27/YOL136C and MED7/YOL135C.
New 69060 AACCGAGTAATCCAATTTACTTTTTCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old 69060 AACCGAGTAATCCAATTTACTTTTCCTACTTTTTTTTCATTATCAATCGATTCAGATGCC 69119Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | ||||||
| YOL062C, YOL063C | ||||||
| 210486 | 210487 | Substitution | AC | CA | ||
| 210453 | 210454 | Substitution | AC | CA | ||
|   | Two separate dinucleotide substitutions were made in the intergenic region between ORFs CRT10/YOL063C and APM4/YOL062C.
New 210440 TTAACAAAATGTGCATTCTAAAGGAAATTACTATAAAAAATACAGGCATGATAAAAATAT 210499
||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||
Old 210440 TTAACAAAATGTGACTTCTAAAGGAAATTACTATAAAAAATACAGGACTGATAAAAATAT 210499Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR090C, YOR091W | 492979 | 492979 | Insertion | T | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs PTC5/YOR090C and TMA46/YOR091W.
New 492955 TACCCTCCAATCGATCCTTTTTTTCTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493014
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old 492957 TACCCTCCAATCGATCCTTTTTT-CTTTTTTGTATCTTGTGTAGAAAGAAGTGAATCCTG 493015Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR298C-A, YOR299W | 877795 | 877795 | Insertion | G | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs MBF1/YOR298C-A and BUD7/YOR299W.
New 877783 CTATTATTGGTTAAGCGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877842
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old 877782 CTATTATTGGTTAA-CGACAGGCGCCTTTCCAGCTACCTAATATATACCACCACCGTCAA 877840Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR306C, YOR307C | 892173 | 892173 | Insertion | C | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs MCH5/YOR306C and SLY41/YOR307C.
New 892133 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCGCTTTCAGCAATCGAAGC 892192
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old 892131 TTTCTCTCAACCTTTCGAGTACTTGGAAAAAGGAGTAGATCCG-TTTCAGCAATCGAAGC 892189Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL058W, YOL059W | 219000 | 219000 | Insertion | G | |
|   | A single nucleotide insertion was made in the intergenic region between ORFs GPD2/YOL059W and ARG1/YOL058W.
New 218990 ATGACTGCGTAGCGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219049
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old 218990 ATGACTGCGTA-CGGCAGATAGTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGT 219048Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOL125W | 84121 | 84121 | Substitution | T | C |
|   | A single nucleotide substitution was made within ORF TRM13/YOL125W.
New 84110 AAAAAATGCAACAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old 84110 AAAAAATGCAATAAGACCAAACTAAGCCATTTAAACGATGATAAGCCATACTATGAACCG 84169Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2011-02-03 | YOR354C, YOR355W | 1004737 | 1004737 | Deletion | T | |
|   | A single nucleotide deletion was made in the intergenic region between ORFs MSC6/YOR354C and GDS1/YOR355W.
New 1004693 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCC-TATTATTTTATT 1004751
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Old 1004690 TCAGCATTCCATTATTGAAGGCTTTAAAATAATAGTTTCTTTTTTCCTTATTATTTTATT 1004749Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology. | |||||
| 2006-01-05 | YOL152W | 42535 | 42535 | Insertion | G | |
|   | A sequencing error was demonstrated in BY4741 (a derivative of S288C) by Mark Rinnerthaler and Michael Breitenbach, and SGD has updated the sequence accordingly. As a consequence of this change, the stop codon has been moved 27 nts upstream, shortening the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 629 to 620 amino acids. (Personal communication from MIPS, Mark Rinnerthaler and Michael Breitenbach)
New: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAGGTTTACAGGCC 42546
||||||||||||||||||||||||||||| ||||||||||
Old: 42507 AAGGTATACCGTCGGAAATTCCGTGGCAG-TTTACAGGCC 42545
| |||||
| 2006-01-05 | YOR252W | 803745 | 803745 | Insertion | G | |
|   | SGD confirmed the sequence error predicted by the work of Kellis, et al, and have updated the systematic sequence accordingly.
New: 803730 ACGGTTCATCCGAAGGGTAGAAAGTATGAAAAGCT 803764
|||||||||||||||| ||||||||||||||||||
Old: 803730 ACGGTTCATCCGAAGG-TAGAAAGTATGAAAAGCT 803763
As a consequence of this sequence change, YOR252W was extended on the 5' end, altering the N-terminus and increasing the size of the predicted protein from 141 to 178 amino acids.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() | |||||
| 2004-02-13 | YOR298C-A | 877622 | 877622 | Insertion | GC | |
|   | Two nucleotides GC were inserted after the G at coordinate 877622 in what had previously been annotated as the intergenic region between YOR298C-A and YOR299W. This region is now part of YOR298C-A, as the start for this ORF was moved 279 bp upstream from 877403 to 877682 (note that YOR298C-A is encoded on the Crick strand). As a result, YOR298C-Ap was increased from 58 aa to 151 aa. See Brachat et al. 2003 and GenBank AY260886. This change was also predicted by Kellis et al. and Cliften et al.
Query: 361 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGGGCCAGAACCACCAGCTCTTGCTCT 420
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 877587 AATTTGGCCTTGAGATCTGGCAACGTTGGCCCTTGG--CAGAACCACCAGCTCTTGCTCT 877644 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |||||
| 2003-01-09 | YOR087W, YOR088W | 488439 | 488439 | Insertion | T | |
|   | Due to the insertion of a T after the A at 488439 on chromosome 15, YOR087W and YOR088W have been merged to one single ORF - YVC1/YOR087W, with YOR088W as an alias. The old chromosomal coordinates for YOR087W were 487708-488451, and for YOR088W were 488286-489734. The new chromosomal coordinates for the fused ORF are 487708-489735. The old relative coordinates for YOR087W were 1-744, and for YOR088W were 1-1449. The new relative coordinates for the fused ORF are 1-2028.Denis V and Cyert MS (2002) Internal Ca(2+) release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. J Cell Biol 156(1):29-34 Palmer CP, et al. (2001) A TRP homolog in Saccharomyces cerevisiae forms an intracellular Ca(2+)-permeable channel in the yeast vacuolar membrane. Proc Natl Acad Sci U S A 98(14):7801-5 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() | |||||
| 2001-05-31 | YOR068C, YOR069W | 453804 | 453804 | Insertion | G | |
|   | Inserted one G nucleotide after the G at chromosomal coordinate 453805, in the intergenic region to the left of overlapping ORFs YOR068C and YOR068W:
Old: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGG-ACGAA 453810
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New: 453752 ATCCTGCAATAACAAGCCATGGACTACGAGGATAATCTAGAAGCACCTGTTTGGGACGAA 453811 | |||||
| 1997-08-11 | YOL025W | 276609 | 276609 | Substitution | G | A |
|   | A single nucleotide substitution was made in the systematic sequence in the region covering the ORF LAG2/YOL025W. The G at 276609 was changed to an A.
New: 276601 AAAGCAGGAAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 276601 AAAGCAGGGAATTTTACCCAAAAAATTGATGAAGGAGTGACCTTAAGAACAATGATTCTT 276660 | |||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2000-10-17 | ARS1501 |
|   | ARS1021 (aka ARS121) and ARS1501 were added to the genome annotation after personal communication from Shlomo Eisenberg. See Walker et al. 1991 for ARS1021 and Raychaudhuri et al. 1997 for ARS1501.Raychaudhuri S, et al. (1997) Functional analysis of a replication origin from Saccharomyces cerevisiae: identification of a new replication enhancer. Nucleic Acids Res 25(24):5057-64 Walker SS, et al. (1991) Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Res 19(22):6255-62 |
| 2001-03-06 | ARS1502 |
|   | Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan |
| 2006-09-08 | ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529 |
|   | The following new ARS elements on Chromosome XV were added to SGD based on Nieduszynski et al. 2006: ARS1507, ARS1508, ARS1509, ARS1510, ARS1511, ARS1513, ARS1519, ARS1521, ARS1523, ARS1524, ARS1526, ARS1528, ARS1529.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2009-05-05 | ARS1512, ARS1518 |
|   | The following ARS elements on Chromosome XV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1512 and ARS1518.Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 |
| 2006-09-08 | ARS1516 |
|   | The coordinates of ARS1516 were updated based on Nieduszynski et al. 2006.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-04-12 | ARS1516 |
|   | ARS1516, also known as "ADE2 ARS", was added to the genome annotation for Chromosome XV at coordinates 566191-566877 based on Wyrick et al. 2001 and Sasnauskas et al. 1987.Sasnauskas KV, et al. (1987) [Cloning of the ADE2 gene of Saccharomyces cerevisiae and localization of the ARS-sequence] Genetika 23(7):1141-8 Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 ![]() |
| 2006-10-02 | ARS1531 |
|   | ARS1531, also known as ARS1506.5, was added to the genome annotation based on Nieduszynski et al. 2006.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2004-10-12 | CEN15 |
|   | The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 |
| 2003-09-09 | TEL15L, TEL15L-TR, TEL15L-XC, TEL15L-XR, TEL15R, TEL15R-TR, TEL15R-XC, TEL15R-XR, TEL15R-YP |
|   | The chromosomal locations for TEL15L, TEL15L-TR, TEL15L-XC, TEL15L-XR, TEL15R, TEL15R-TR, TEL15R-XC, TEL15R-XR, and TEL15R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
| 2003-01-09 | YOL002C |
|   | The start site of YOL002C has been moved 30 nt downstream from 324394 to 324364. Chromosomal coordinates change from old:324394-323441 to new:324364-323411. Relative coordinates go from old:1-984 to new:1-954. Thanks to Gillian Small for reporting this sequence annotation change to SGD.Karpichev IV, et al. (2002) Multiple regulatory roles of a novel Saccharomyces cerevisiae protein, encoded by YOL002c, in lipid and phosphate metabolism. J Biol Chem 277(22):19609-17 |
| 2003-07-29 | YOL013W-A, YOL038C-A |
|   | Thanks to MIPS for providing the coordinates of the following Chromosome XV ORFs: YOL013W-B and YOL038C-A. |
| 2003-07-29 | YOL019W-A, YOL085W-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, YOR394C-A, YOR396C-A |
|   | Thanks to Kumar et al. for providing the coordinates of the following Chromosome XV ORFs: YOL019W-A, YOR394C-A, YOR396C-A, YOL166W-A, YOR032W-A, YOR108C-A, YOR161C-C, YOR161W-A, YOR161W-B, YOR186C-A, YOR231C-A, YOR335W-A, and YOL085W-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 ![]() |
| 2000-07-14 | YOL047C |
|   | The annotations of the start site and 3' intron boundary of YOL047C were both changed, so that the relative coding coordinates change from 1-1..189-892 to 1-243..307-1134. Note that the stop site and the 5' boundary of the intron were not changed. Chromosomal coordinates for the coding region change from 242503-242503..242315-241612 to 242745-242503..242439-241612. |
| 2003-09-27 | YOL048C |
|   | Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YOL048C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has a 236-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2000-08-11 | YOL052C-A |
|   | Old name: YOL053C-A; new name: YOL052C-A; date: 11/1998; old coord: ChrXV 231753 231568; SGDID: S0005413; Name changed due to nomenclature |
| 1999-07-17 | YOL075C |
|   | The start site of YOL075C was moved 597 bases upstream. Chromosomal coordinates change from 194944-189657 to 193541-189657. |
| 2003-07-29 | YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR072W-B, YOR192C-C, YOR293C-A |
|   | Thanks to
Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XV ORFs: YOR072W-B, YOL083C-A, YOL097W-A, YOL155W-A, YOR034C-A, YOR192C-C, and YOR293C-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 |
| 2003-09-22 | YOL096C |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for COQ3/YOL096C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site is not conserved in the closely related species S. paradoxus (CTA), S. mikatae (TTA), or S. bayanus (CCA).Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YOL103W |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ITR2/YOL103W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accpeted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream start site predicted previously for S. cerevisiae is not conserved in S. paradoxus, S. mikatae, or S. bayanus.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2006-10-06 | YOL126C |
|   | Based on N-terminal sequencing (Kopetzki E. et al., Minard K.I. et al) and mapping of the transcription start site (Roth S. and Schuller H.J.), the start site for MDH2/YOL126C has been moved 141 bp (47 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-prot for bringing this to our attention.Minard KI and McAlister-Henn L (1991) Isolation, nucleotide sequence analysis, and disruption of the MDH2 gene from Saccharomyces cerevisiae: evidence for three isozymes of yeast malate dehydrogenase. Mol Cell Biol 11(1):370-80 Roth S and Schuller HJ (2001) Cat8 and Sip4 mediate regulated transcriptional activation of the yeast malate dehydrogenase gene MDH2 by three carbon source-responsive promoter elements. Yeast 18(2):151-62 Ghaemmaghami S, et al. (2003) Global analysis of protein expression in yeast. Nature 425(6959):737-41 ![]() |
| 2003-09-22 | YOL146W |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PSF3/YOL146W be moved 126 nt (42 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The upstream ATG is conserved in S. paradoxus and S. mikatae, but insertions create stops between the two ATGs in these species. The upstream ATG (ATA in S. bayanus) and the frame are not conserved in S. bayanus; 4) Protein sequence comparisons against the nr dataset at NCBI show that there is no sequence similarity between S. cerevisiae and other species between the first and the second ATG; sequence similarity begins after the second methionine. Supporting evidence for this change has also been published by Takayama et al. who showed that the originally annotated upstream start site is not conserved in the S. pombe or human genes and that the apparent molecular mass of Psf3p is more consistent with the downstream start site. Takayama Y, et al. (2003) GINS, a novel multiprotein complex required for chromosomal DNA replication in budding yeast. Genes Dev 17(9):1153-65 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-07-29 | YOL164W-A, YOR011W-A, YOR072W-A, YOR073W-A, YOR316C-A, YOR329W-A, YOR376W-A, YOR381W-A |
|   | Thanks to Kessler et al. for providing the coordinates for the following Chromosome XV ORFs: YOR072W-A, YOR316C-A, YOR376W-A, YOR381W-A, YOR329W-A, YOR073W-A, YOR011W-A, and YOL164W-A. Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 |
| 2003-07-29 | YOR020W-A |
|   | Thanks to Brachat et al. for providing the coordinates of YOR020W-A.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 |
| 2003-09-22 | YOR037W |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CYC2/YOR037W be moved 114 nt (38 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (GTA), S. mikatae (ATA), and S. bayanus (ATA); 4) InDels create frame shifts between the upstream start site and the proposed downstream start site; 5) The MitoProt program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (e.g. Dumont et al); the longer protein has a much lower probability of mitochondrial localization according to the program.Dumont ME, et al. (1993) CYC2 encodes a factor involved in mitochondrial import of yeast cytochrome c. Mol Cell Biol 13(10):6442-51 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2004-04-21 | YOR069W |
|   | Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. suggest that the start site for VPS5/YOR069W be moved 1089 nt upstream, extending the 5' end of the protein an additional 363 amino acids. This suggestion was reviewed and accepted by SGD curators. Evidence supporting this change includes: (1) this is the predicted start methionine in all Saccharomyces species sequenced by Cliften et al. and/or Kellis et al. and (2) this is the start site described in literature characterizing VPS5/YOR069W (Horazdovsky BF, et al.,(1997) Mol Biol Cell. Aug; 8(8):1529-41),(Nothwehr ST, Hindes AE (1997) J Cell Sci. May;110 (Pt 9):1063-72.).Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2005-12-01 | YOR074C |
|   | Based on multiple sequence alignments and on data published by Taylor et al., Davis et al., and Poon et al., the intron has been removed from CDC21/YOR074C. The start codon, stop codon, and frame of translation all remain the same, but the sequence previously annotated as an intron is included in the translation.Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 Taylor GR, et al. (1987) Molecular characterization of the cell cycle-regulated thymidylate synthase gene of Saccharomyces cerevisiae. J Biol Chem 262(11):5298-307 Poon PP and Storms RK (1994) Thymidylate synthase is localized to the nuclear periphery in the yeast Saccharomyces cerevisiae. J Biol Chem 269(11):8341-7 |
| 2010-01-05 | YOR080W |
|   | The annotated start ATG of ORF YOR080W/DIA2 has been moved to Met15, based on Morohashi et al. 2009. Old chromosomal coordinates were 474554..476794; the new chromosomal coordinates are 474596..476794. Thanks to Karim Labib for bringing this annotation correction to the attention of SGD.Morohashi H, et al. (2009) The amino-terminal TPR domain of Dia2 tethers SCF(Dia2) to the replisome progression complex. Curr Biol 19(22):1943-9 |
| 2005-12-01 | YOR091W |
|   | Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for YOR091W was moved 168 nt (56 codons) downstream.Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 |
| 2003-09-22 | YOR103C |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for OST2/YOR103C be moved 9 nt (3 codons) downstream. This suggestion was reviewed by SGD curators and incorporated on September 22, 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The current start site is not conserved in S. paradoxus (ATA), S. mikatae (ACG), and S. bayanus (ACG).Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YOR125C |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for CAT5/YOR125C be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The start site predicted previously for S. cerevisiae is not conserved in S. paradoxus (AGG), S. mikatae (AGG), and S. bayanus (AGG); 4) Insertions in S. mikatae and S. bayanus create frame shifts between the up and downstream ATGs; 5) the MitoProt (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter) program predicts that the shorter protein is localized to the mitochondria, which is confirmed by the literature (see for example Jonassen et al (1998) J Biol Chem 273:3351-7); the longer protein has a lower probability (.97 vs. .55) of mitochondrial localization according to the program; 6) homology to related proteins and conserved domains are downstream of the region between the two ATGs.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2005-11-30 | YOR147W |
|   | Based on on 5' SAGE TSS data and multiple orthologous sequence alignments published by Zhang and Dietrich, the start site for MDM32/YOR147W was moved 93 nt (31 codons) downstream.Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 |
| 2006-10-05 | YOR173W |
|   | Based on N-terminal sequencing and mapping of the transcription start site (Malys N. et al.), the start site for DCS2/YOR173W has been moved 132 bp (44 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at SwissProt for bringing this to our attention.Malys N, et al. (2004) The 'scavenger' m7GpppX pyrophosphatase activity of Dcs1 modulates nutrient-induced responses in yeast. Nucleic Acids Res 32(12):3590-600 |
| 2006-05-11 | YOR197W |
|   | The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for MCA1/YOR197W was moved 57 nt (19 amino acids) downstream.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2006-10-03 | YOR211C |
|   | Based on genetic analyses done by Shepard K.A. et al. (1999), the start site for MGM1/YOR211C has been moved 63 bp (21 codons) downstream. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this change to our attention.Shepard KA and Yaffe MP (1999) The yeast dynamin-like protein, Mgm1p, functions on the mitochondrial outer membrane to mediate mitochondrial inheritance. J Cell Biol 144(4):711-20 |
| 2005-12-01 | YOR221C |
|   | Based on multiple sequence alignments and on data published by Davis et al., the intron and first exon have been removed from this gene. This change effectively moves the MCT1/YOR221C start site 273 nts downstream, but does not alter the translation frame of this gene, resulting in a shortened, altered N-terminus.Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() |
| 2003-09-22 | YOR238W |
|   | The automated comparison of closely related Saccharomyces species suggests that the start site for YOR238W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 ![]() Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2000-08-14 | YOR239W, YOR240W |
|   | Annotation change: it has been reported in Asakura et al. 1998 that a +1 translational frameshift merges YOR239W and YOR240W into one ORF. YOR240W is now an alias for YOR239W and YOR239W encompasses both the ORFs.Asakura T, et al. (1998) Isolation and characterization of a novel actin filament-binding protein from Saccharomyces cerevisiae. Oncogene 16(1):121-30 |
| 1997-07-01 | YOR304C-A |
|   | The original annotation of the YOR304C-A ORF was incorrect because it included one additional nucleotide past the stop codon. The stop coordinate has now been corrected so that this extra "G" nucleotide is no longer included. |
| 2007-07-10 | YOR312C |
|   | The start of ORF RPL20B/YOR312C was moved 13 nt upstream, and the 5' end of the intron was moved 19 nt upstream, based on GenBank EF138822, Miura et al. 2006, and Zhang et al. 2007. The ORF had been annotated as 932 nt with a 407-nt intron (174 aa), but is now 945 nt long with a 426-nt intron (172 aa).Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9 |
| 2005-11-30 | YOR330C |
|   | Based on 5' end mapping published by Francoise Foury, the start site for MIP1/YOR330C was moved 78 nt (26 codons) downstream.Foury F (1989) Cloning and sequencing of the nuclear gene MIP1 encoding the catalytic subunit of the yeast mitochondrial DNA polymerase. J Biol Chem 264(34):20552-60 |
| 2007-02-07 | YOR396W |
|   | The start site for YOR396W/YRF1-8, one of several telomeric Y' element-encoded helicases, was moved 1716 bp (572 codons) upstream. The gene model of YOR396W was shorter and lacked a substantial N-terminal part when compared to the other Y' helicases encoded by the YRF1 genes, although the reading frame could be extended at the N-terminus to match the other genes without problem. The shorter gene model may have originated from Louis & Haber 1992 and the prediction found in EMBL:U23472. The strain (YP1) sequenced in this study has a frameshift at position 1520 (aa-507) disrupting the gene and producing two ORFs, one of which was the original shorter version of YOR396W used by SGD. In contrary, a later sequence submission (EMBL:Z75302) submitted on behalf of the Chromosome XV Sequencing Project does not contain this frameshift, matching the chromosomal sequence for reference strain S288C stored in SGD. Thank you to Ivo Pedruzzi of Swiss-Prot for bringing this annotation error to the attention of SGD. Louis EJ and Haber JE (1992) The structure and evolution of subtelomeric Y' repeats in Saccharomyces cerevisiae. Genetics 131(3):559-74 |
| 2001-03-08 | snR31 |
|   | Changed the orientation of SNR31 from Watson to Crick (old start coord = 841953; old stop coord = 842177; new start coord = 842177; new stop coord = 841953).Dandekar T and Tollervey D (1993) Identification and functional analysis of a novel yeast small nucleolar RNA. Nucleic Acids Res 21(23):5386-90 Balakin AG, et al. (1993) SnR31, snR32, and snR33: three novel, non-essential snRNAs from Saccharomyces cerevisiae. Nucleic Acids Res 21(23):5391-7 |
| 2007-05-10 | snR35 |
|   | Updated coordinates of snR35 based on Samarsky et al. 1995 and GenBank L33803. Old coordinates were 759730..759191 (540 nt) and new coordinates are 759530..759327 (204 nt).Samarsky DA, et al. (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54 |
| 2007-05-10 | snR36 |
|   | Updated coordinates of snR36 based on Samarsky et al. 1995 and GenBank L33804. Old coordinates were 680997..680643 (355 nt), new coordinates are 680867..680686 (182 nt).Samarsky DA, et al. (1995) Characterization of three new snRNAs from Saccharomyces cerevisiae: snR34, snR35 and snR36. Nucleic Acids Res 23(13):2548-54 |
| 2006-01-24 | snR81 |
|   | New snoRNA added to genome annotation (GenBank accession # AY679769).Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96 ![]() |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |