- Site Map |
- Search Options |
- Help |
- Home |
| 
Chromosome VIII History |
|
| |||||||
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
Date  | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2005-11-07 | YHL026C | 54135 | 54135 | Insertion | G | |
Based on the automated comparison of closely related Saccharomyces species, Cliften et al. suggest that the start site for YHL026C be moved 141 nt upstream. SGD confirmed the insertion of a single G nt between the G at 54135 and the T at 54136. As a consequence of this sequence change, YHL026C will be extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 268 to 315 amino acids.
New: ATGGAATTTCTGAACCCGGTCGGGGTCGCTGGCGCTGGCTCTGAGGATTTCATATATGTGCliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6     | ||||||
| 2004-07-26 | YHR131C, YHR131W-A | 367891 | 367891 | Insertion | C | |
The work of Kellis et al. proposed an insertion that would extend the YHR131C reading frame. This sequence error was confirmed in S288C by SGD. As a consequence of this change, YHR131C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 840 to 850 amino acids. In addition, YHR131W-A was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 115 to 81 amino acids. New: TAATTTGCCCTCTATTGGCAGAGCCATCCTTAACAAACGAACAACTTGTATGCACGATGTKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2004-01-30 | YHL006C | 98461 | 98461 | Insertion | C | |
Kellis et al. predicted and confirmed the insertion of a single C nt. As a consequence of this sequence change, YHL006C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 159 to 150 amino acids.
New: 98439 GCCGTAACACAAGGCTAAGTAGCCGCAGCTGTTGCGGTCCATCTTGTGTCGCGGTGAGAT 98498
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old: 98439 GCCGTAACACAAGGCTAAGTAGC-GCAGCTGTTGCGGTCCATCTTGTGTCGCGGTGAGAT 98497
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2004-01-30 | YHR056C, YHR056W-A | 217751 | 217751 | Deletion | T | |
Based on the automated comparison of related fungi, Cliften et al. and Brachat et al. both suggest that the start site for RSC30/YHR056C be moved 155 nt upstream. Based on experimental evidence, Angus-Hill et al. proposed the deletion of a single T nt upstream of RSC30/YHR056C, allowing a 51 amino acid N-terminal extension. This sequence change was confirmed in S288c by SGD. As a consequence of this sequence change, two ORFs were extended: (1) RSC30/YHR056C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 832 to 883 amino acids; (2) YHR056W-A was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 143 to 144 amino acids.
New: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTT-GGCCCTGTCGC 217762
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old: 217704 AAAACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTTGGCCCTGTCGC 217763 Angus-Hill ML, et al. (2001) A Rsc3/Rsc30 zinc cluster dimer reveals novel roles for the chromatin remodeler RSC in gene expression and cell cycle control. Mol Cell 7(4):741-51  Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | ||||||
| 2003-12-01 | ||||||
| YHR176W | ||||||
| 455307 | 455307 | Insertion | G | |||
| 455503 | 455503 | Insertion | C | |||
Based on the comparison of related fungi, Brachat et al. suggested that the C-terminus of Fmo1p/YHR176Wp be extended at the C-Terminus. Zhang and Robertus resequenced this gene (in 2 S288C derived strains, X2180 and TR2), confirming the insertion of two nucleotides. As a consequence of these sequence changes, FMO1/YHR176W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 373 to 432 amino acids.
New: 455286 GGAACGCACAACTTCCCAAAGGGAAAGGACCTGGAATACTATGCAGAACTACAGGAACTA 455345
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old: 455286 GGAACGCACAACTTCCCAAAGG-AAAGGACCTGGAATACTATGCAGAACTACAGGAACTA 455344
New: 455346 CTGAATAGCATTCCACGTAGGGTCGGTCATTTCGAACCAGTTGTATGGGATGATAGACTG 455405
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 455345 CTGAATAGCATTCCACGTAGGGTCGGTCATTTCGAACCAGTTGTATGGGATGATAGACTG 455404
New: 455406 ATCGATCTAAGAAACAGTAGTTATACAGACAAAGAAGAAAGAAATGTGCTTCTAGCGGAA 455465
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 455405 ATCGATCTAAGAAACAGTAGTTATACAGACAAAGAAGAAAGAAATGTGCTTCTAGCGGAA 455464
New: 455466 CACGCACAAGCCCTAAAGAAAAAAAAAGCACCATACTTCCTTCCGGCGCCACATACTTAA 455525
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 455465 CACGCACAAGCCCTAAAGAAAAAAAAAGCACCATACTTC-TTCCGGCGCCACATACTTAA 455523
Zhang M and Robertus JD (2002) Molecular cloning and characterization of a full-length flavin-dependent monooxygenase from yeast. Arch Biochem Biophys 403(2):277-83 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2000-01-21 | YHR132W-A | 370332 | 370332 | Insertion | C | |
A single C nucleotide was inserted after the C at chromosomal coordinate 370331, resulting in the creation of a new ORF YHR132W-A spanning coordinates 370055-370450. See GenBank files: YSCH9315 GenBank entry, accession U10398, U00093. Thank you to Atsuko Horiuchi for alerting SGD to this omission.
New: aatcctagcggtttaagagag
|||| ||||||||||||||||
Old: aatc-tagcggtttaagagag | ||||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2009-05-06 | ARS801, ARS806, ARS810, ARS811, ARS814, ARS815 |
| The following ARS elements on Chromosome 8 were added to the genome annotation based on Raveendranathan et al. 2006: ARS801, ARS806, ARS810, ARS811, ARS814, and ARS815.Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 | |
| 2007-07-09 | YHR076W |
| An intron was annotated within PTC7/YHR076W at relative coordinates 56..148 based on GenBank EF123135, Juneau et al. 2007, and Zhang et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate = 55%). Note that the currently annotated start and stop remain the same.Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9 | |
| 2006-09-07 | ARS802, ARS807, ARS809, ARS813, ARS818, ARS820, ARS822, ARS824 |
| The following new ARS elements on Chromosome VIII were added to SGD based on Nieduszynski et al. 2006: ARS802, ARS807, ARS809, ARS813, ARS818, ARS820, ARS822, ARS824.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 | |
| 2006-09-07 | ARS805 |
| The coordinates of ARS805 were updated based on Nieduszynski et al. 2006.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 | |
| 2006-04-13 | ARS808 |
| ARS808, also known as ARS2, was added to the genome annotation for Chromosome VII at coordinates 140342-141267 based on Wyrick et al. 2001 and Hsiao & Carbon 1981. "ARS2" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS808" is being used for consistency purposes, to indicate that this ARS is part of Chromosome VIII.Hsiao CL and Carbon J (1981) Characterization of a yeast replication origin (ars2) and construction of stable minichromosomes containing cloned yeast centromere DNA (CEN3). Gene 15(2-3):157-66 Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 | |
| 2006-04-13 | ARS805 |
| ARS805, also known as "SPO11 ARS", was added to the genome annotation for Chromosome VIII at coordinates 64155-64459 based on Wyrick et al. 2001 and Atcheson et al. 1987.Atcheson CL, et al. (1987) Isolation, DNA sequence, and regulation of a meiosis-specific eukaryotic recombination gene. Proc Natl Acad Sci U S A 84(22):8035-9 Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 | |
| 2005-11-07 | YHR163W |
| High-throughput identification of transcription start sites by Zhang and Dietrich 2005 confirmed that the start site for YHR163W should be moved 93 nt downstream from 423632 to 423725. As a consequence of this annotation change, YHR163W was shortened at the 5' end, decreasing the size of the predicted protein from 280 amino acids to 249 amino acids.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 | |
| 2005-11-03 | YHR079C-A |
The following intron predicted by Brachat, et al was added to SAE3/YHR079C-A on the basis of experimental evidence provided by Hayase, et al and Tsubouchi and Roeder:
exon 1: ...tgtctaaaga aaagaaaaaBrachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Hayase A, et al. (2004) A protein complex containing Mei5 and Sae3 promotes the assembly of the meiosis-specific RecA homolog Dmc1. Cell 119(7):927-40 Tsubouchi H and Roeder GS (2004) The budding yeast mei5 and sae3 proteins act together with dmc1 during meiotic recombination. Genetics 168(3):1219-30 | |
| 2004-10-12 | CEN8 |
| The orientation of this centromere was reversed (from Watson to Crick) to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. and Espelin et al.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 | |
| 2004-04-01 | RUF5-1, RUF5-2 |
| Start and stop coordinates updated per McCutcheon and Eddy | |
| 2004-02-20 | YHR199C-A |
| Thanks to Cliften et al. for providing the coordinates of YHR199C-A.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YHR065C |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for RRP3/YHR065C be moved 126 nt (42 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YHR064C |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SSZ1/YHR064C be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) protein sequence conservation with other chaperone homologs in S. cerevisiae begins sharply at about 30 amino acids from the current start.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YHR128W |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for FUR1/YHR128W be moved 106 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-09 | TEL08L, TEL08L-TR, TEL08L-XC, TEL08L-XR, TEL08L-YP, TEL08R, TEL08R-TR1, TEL08R-TR2, TEL08R-XC, TEL08R-XR, TEL08R-YP |
| The chromosomal locations for TEL08L, TEL08L-TR, TEL08L-XC, TEL08L-XR, TEL08L-YP, TEL08R, TEL08R-TR1 , TEL08R-TR2, TEL08R-XC, TEL08R-XR, and TEL08R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). | |
| 2003-07-29 | YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, YHR218W-A |
| Thanks to MIPS for providing the coordinates for the following Chromosome VIII ORFs: YHL002C-A, YHL006W-A, YHL019W-A, YHL030W-A, YHL034W-A, YHL046W-A, YHR028W-A, YHR032C-A, YHR056W-A, YHR063W-A, YHR069C-A, YHR070C-A, YHR071C-A, YHR131W-A, YHR165W-A, YHR182C-A, YHR193C-A, and YHR218W-A. | |
| 2003-07-29 | YHL015W-A, YHL048C-A, YHR007C-A, YHR032W-A, YHR050W-A, YHR073C-B, YHR073W-A |
| Thanks to
Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome VIII ORFs: YHL015W-A, YHL048C-A, YHR007C-A, YHR032W-A, YHR050W-A, YHR073C-B, and YHR073W-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 | |
| 2003-07-29 | YHR086W-A, YHR175W-A, YHR180C-B, YHR180W-A |
| Thanks to Kessler et al. for providing the coordinates of the following Chromosome VIII ORFs: YHR180C-B, YHR180W-A, YHR175W-A, and YHR086W-A.Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 | |
| 2003-07-29 | YHL050W-A, YHR022C-A, YHR032C-A, YHR052W-A, YHR054W-A, YHR137C-A, YHR212W-A, YHR213W-A, YHR213W-B, YHR214C-D, YHR214C-E, YHR219C-A |
| Thanks to Kumar et al. for providing the coordinates of the followinc Chromosome VIII ORFs: YHL050W-A, YHR052W-A, YHR137C-A, YHR213W-A, YHR213W-B, YHR214C-D, YHR214C-E, YHR219C-A, YHR212W-A, YHR054W-A, YHR032C-A, and YHR022C-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 | |
| 2003-03-06 | RUF5-1, RUF5-2 |
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28  | |
| 2000-08-11 | YHR039C-A |
| Old name: YHR039C-B; new name: YHR039C-A; date: 11/1998; old coord: ChrVIII 187670 187164; SGDID: S0002100; Name changed due to nomenclature | |
| 2000-08-11 | YHR079C-A |
| Old name: YHR079C-B; new name: YHR079C-A; date: 11/1998; old coord: ChrVIII 262554 262402; SGDID: S0001957; Name changed due to nomenclature |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |
 Return to SGD |
