Chromosome VII History |
|
| |||||||
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
| Date | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2007-12-11 | YGR271C-A, YGR272C | 1038054 | 1038054 | Insertion | C | |
|   | Kastenmayer et al confirmed the insertion of one C nucleotide in YGR272C in an S288C strain background. As a consequence of this sequence change, YGR272C was merged into an adjacent ORF, YGR271C-A. This change extended YGR271C-A at the 5' end, increasing the size of the protein from 63 amino acids to 233 amino acids.NEW: TTCTACGCCCTTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
OLD: 1038046 TTCTACGCC-TTTGGGTCTGTAGATGGTGTATCATTCGGATATAGTGCAATATACTTTTC 1038104
Kastenmayer JP, et al. (2006) Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae. Genome Res 16(3):365-73 | |||||
| 2005-11-29 | YGR225W, YGR226C | 946899 | 946899 | Insertion | T | |
|   | Based on the automated comparison of related fungi, Brachat et al. (2003) suggest that the C-terminus of Ama1p/YGR225Wp be extended 31 amino acids. SGD has confirmed the insertion of a T after the T at 946899 and is supported by Cooper, et al (2000). As a consequence, YGR225W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 562 amino acids to 593 amino acids. In addition, YGR226C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 199 amino acids to 69 amino acids.
New: ACTAACGATGAAACGATAAGATTTTATGAACTGTGGAACGATAAGGAGGAAATAATTAATCooper KF, et al. (2000) Ama1p is a meiosis-specific regulator of the anaphase promoting complex/cyclosome in yeast. Proc Natl Acad Sci U S A 97(26):14548-53 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | |||||
| 2005-11-22 | YGR236C | 962549 | 962549 | Deletion | G | |
|   | Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YGR236C be moved 101 nt upstream. SGD has confirmed the deletion of the G at 962549. As a consequence, YGR236C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 129 amino acids to 95 amino acids.New: CAAATTCCCTTACATGATTGAAGAG-AACATCAAATACGTTACTTCATCATKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |||||
| 2004-07-20 | ||||||
| YGL210W-A, YGL211W | ||||||
| 93425 | 93425 | Deletion | A | |||
| 93254 | 93254 | Insertion | C | |||
| 93037 | 93037 | Insertion | C | |||
|   | The work of Brachat et al. 2003 suggested potential sequence errors within and downstream of NCS6/YGL211W. SGD resequenced this region in S288C and found that the following sequence changes were necessary to correct the reference sequence: insertion of a single C nucleotide after the G at chromosomal coordinate 93037, insertion of a C after the C at 93254, and deletion of the A at 93425. As a consequence of these changes (1) NCS6/YGL211W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 193 to 359 amino acids and (2) YGL210W-A was merged into YGL211W.
Old: 93001 TTTTAGAAGACAATCATTGGACCGTGGTGCTGCAAAG-TGGGCATATCTCACGTTGTCAC 93059
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
New: 93001 TTTTAGAAGACAATCATTGGACCGTGGTGCTGCAAAGCTGGGCATATCTCACGTTGTCAC 93060
AND
Old: 93240 GCTGGATTATTTTTC-ACTGAGTGTACCTATGCCCCAGAAGCGTTTAGGGGCACTGCGAG 93298
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
New: 93241 GCTGGATTATTTTTCCACTGAGTGTACCTATGCCCCAGAAGCGTTTAGGGGCACTGCGAG 93300 AND
Old: 93419 TGTTGAACGGCAATAGATGCGCTAGATGTGGATATCTGTCGTCAAATAACATTTGCAAGG 93478
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 93421 TGTTGA-CGGCAATAGATGCGCTAGATGTGGATATCTGTCGTCAAATAACATTTGCAAGG 93479Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | |||||
| 2004-07-19 | ||||||
| YGL196W | ||||||
| 131047 | 131047 | Insertion | A | |||
| 130416 | 130416 | Deletion | G | |||
| 130298 | 130298 | Deletion | C | |||
| 130260 | 130260 | Substitution | A | C | ||
| 130106 | 130106 | Insertion | C | |||
|   | The work of Kellis et al. 2003 predicted insertion of a single nucleotide downstream of YGL196W; SGD resequenced this region, as well as the region upstream of YGL196W, and confirmed 5 separate sequence errors in the regions flanking YGL196W. SGD has made the following corrections to the reference sequence: insertion of a single C nucleotide after the C at 130106, transversion of A to C at 130260, deletion of a C at 130298, deletion of a G at 130416, and insertion of an A after the A at 131047. As a consequence of these sequence changes, YGL196W was extended at both the 5' and the 3' ends, altering both the N- and C-termini without changing the translation frame, and increasing the size of the predicted protein from 165 to 428 amino acids. N-terminus:
Old: 130079 ACTTTGAAACAATTGGGCCACGGACTTC-ATTGGCTAAACGCACTACAAGAGCCATATTA 130137
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New: 130080 ACTTTGAAACAATTGGGCCACGGACTTCCATTGGCTAAACGCACTACAAGAGCCATATTA 130139
Old: 130258 AGAAATTTGTCAAGAAGGGTGAATAATTTTCAGGTTTTTGCTTGATAACATTGAACACTT 130317
|| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
New: 130260 AGCAATTTGTCAAGAAGGGTGAATAATTTTCAGGTTTTTG-TTGATAACATTGAACACTT 130318
Old: 130378 GGTTGATATGGGGACTAAGAGGGCAGGTCTTGCTTTCGGACTCTCCAGAATTTTTGAGTC 130437
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
New: 130379 GGTTGATATGGGGACTAAGAGGGCAGGTCTTGCTTTCG-ACTCTCCAGAATTTTTGAGTC 130437
C-Terminus
Old: 131038 CTCCATTAAA-TTAGGCAGCAAAATTGCCGTCCTTCCTCAACACGCTTGTATCACAATGG 131096
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
New: 131038 CTCCATTAAAATTAGGCAGCAAAATTGCCGTCCTTCCTCAACACGCTTGTATCACAATGG 131097Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |||||
| 2004-07-15 | YGL236C | 53811 | 53811 | Insertion | C | |
|   | The work of Kellis et al. 2003 predicted the insertion of a single C nucleotide after the C at chromosomal coordinate 53811; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, MTO1/YGL236C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 679 to 669 amino acids. Old: 53761 TATACAAGCTAACGATTAAAGGATATTTACATGACTGGTTGGCTTGGCTTC-GTGCCACA 53819
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
New: 53761 TATACAAGCTAACGATTAAAGGATATTTACATGACTGGTTGGCTTGGCTTCCGTGCCACA 53820Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |||||
| 2004-07-15 | YGR231C | 952555 | 952555 | Deletion | A | |
|   | The work of Kellis et al. 2003 predicted the deletion of a single A nucleotide at chromosomal coordinate 952555; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, PHB2/YGR231C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 315 to 310 amino acids.
Old: 952500 CTTAACATTGTTACTCAATTCTTAAAGATAATATCTAGCCTTCGCTATTTATTTGACCCC 952559
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
New: 952501 CTTAACATTGTTACTCAATTCTTAAAGATAATATCTAGCCTTCGCTATTTATTTG-CCCC 952559Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |||||
| 2004-01-23 | ||||||
| YGL198W | ||||||
| 124331 | 124331 | Deletion | T | |||
| 124279 | 124279 | Insertion | C | |||
| 124271 | 124271 | Deletion | T | |||
| 124251 | 124251 | Insertion | C | |||
|   | Kellis et al. 2003 predicted and confirmed four sequence errors in YGL198W: the insertion of a single C nucleotide after the C at chromosomal coordinate 124251, and the deletion of a single T at 124271, the insertion of a single C after the C at 124279, and the deletion of a single T at 124331. As a consequence of these sequence changes, YGL198W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 261 to 235 amino acids.
New: 124234 CCATTATCGAGATATACCCTCTGGCACTCTGTCTTTTT-GGCATGGCCTGGTTGTCAACT 124290
|||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||
Old: 124234 CCATTATCGAGATATACC-TCTGGCACTCTGTCTTTTTTGGCATGGC-TGGTTGTCAACT 124291
New: 124291 ATTTTATAACACTAGTTACATATGTATAAAACCCAATAT-CATGGACATAGAATTGCCTA 124351
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 124292 ATTTTATAACACTAGTTACATATGTATAAAACCCAATATTCATGGACATAGAATTGCCTA 124351 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |||||
| 2004-01-23 | YGL201C | 120375 | 120375 | Substitution | C | G |
|   | A single C nucleotide at chromosomal coordinate 120375 was changed to a G, altering the coding sequence of MCM6/YGL201C. The start, stop, and reading frame remain the same, but protein residue 179 is now a proline rather than an alanine. See GenBank Accession AY258324. Thanks to Andrea Duina and F. Winston for resequencing this region in S288c.
New: 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGGCAAAAATCTGTAATATTGT 120394
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old: 120335 TACTTTCTTACTACTCTTCTTAAACCCTTTTGTAAAAAAGCCAAAAATCTGTAATATTGT 120394 | |||||
| 2004-01-22 | YGR006W | 506672 | 506672 | Insertion | G | |
|   | Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YGR006W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 219 to 251 amino acids.
New: 506640 ATGTGGCCTGGCCTATTGGTGTTACTAGCGTAGGCATTCATGCTCGTAGTGCACATTCGA 506699
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old: 506640 ATGTGGCCTGGCCTATTGGTGTTACTAGCGTAG-CATTCATGCTCGTAGTGCACATTCGA 506698
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |||||
| 2003-01-09 | ||||||
| YGL045W, YGL046W | ||||||
| 415042 | 415042 | Deletion | G | |||
| 414883 | 414883 | Insertion | A | |||
| 414910 | 414910 | Insertion | C | |||
| 414983 | 414983 | Insertion | CC | |||
|   | Due to the following changes to the systematic sequence of Chromosome VII, YGL045W and YGL046W have been merged into one single larger ORF: A insertion at 414883, C insertion at 414910, CC insertion at 414983, and G deletion at 415042. RIM8 is the standard name for the new merged ORF; YGL046W is now an alias of RIM8/YGL045W. We thank Claude Gaillardin and Aaron P. Mitchell for reporting this sequence error to SGD.
Old: 414838 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAA-CGGTGACTATATC 414896
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
New: 414841 TTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAATAAAACGGTGACTATATC 414900
Old: 414897 CGTAGACATAC-GCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414955
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New: 414901 CGTAGACATACCGCAGGCTGGATTCATGATTGGTGAAATTATCCCTATAGACGTTAAGAT 414960
Old: 414956 TGACCACTATAAGCCTTTCTATGCC--TGCGGGTCTCACCACCACTTTGGTGAGGATATG 415013
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 414961 TGACCACTATAAGCCTTTCTATGCCCCTGCGGGTCTCACCACCACTTTGGTGAGGATATG 415020
Old: 415014 TAGGGTGGGCGGTGCAGGCAAAGATGGATCCTATGGAGACTTTCAGAAAAGATATATGTC 415073
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 415021 TAGGGTGGGCGGTGCAGGCAAAGATG-ATCCTATGGAGACTTTCAGAAAAGATATATGTC 415079Treton B, et al. (2000) Ambient pH signalling in ascomycetous yeasts involves homologues of the Aspergillus nidulans genes palF and paIH. Mol Gen Genet 263(3):505-13 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |||||
| 2003-01-06 | ||||||
| YGL125W | ||||||
| 273208 | 273209 | Substitution | AT | GC | ||
| 273049 | 273049 | Insertion | A | |||
| 273061 | 273061 | Insertion | CG | |||
| 273111 | 273112 | Substitution | AC | CA | ||
|   | Due to the insertion of an A after the A at coordinate 273049, a CG insertion after the A at 273061, a substitution of AC at 273111-273112 with CA, and a substitution of AT at 273208-273209 with GC, the coordinates for the ORF YGL125W have changed to 272524-274326. The old coordinates for YGL125W were 272524-274323. Thanks to Dean Appling and Sherwin Chan for reporting this sequence error on Chromosome VII to SGD. Old: 273001 CATCCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGA-GCAGAAGATC 273059
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
New: 273001 CATCCGGAGTTGCCTAACAAAGACGTGAAGCTTGATCTCGAGTATTTGAAGCAGAAGATC 273060
Old: 273060 GA--CCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTACTCAAC 273117
|| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||
New: 273061 GACGCCGGCGGCGACTTCATCATCACTCAGATGTTTTACGATGTTGATAATTTCATCAAC 273120
Old: 273118 TGGTGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCG 273177
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 273121 TGGTGTTCCCAAGTTAGAGCTGCGGGCATGGACGTGCCCATTATTCCCGGGATCATGCCG 273180
Old: 273178 ATCACTACCTACGCGGCCTTCTTGAGAAGGATCCAATGGGGCCAAATCTCCATCCCTCAA 273237
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New: 273181 ATCACTACCTACGCGGCCTTCTTGAGAAGGGCCCAATGGGGCCAAATCTCCATCCCTCAA 273240Brachmann CB, et al. (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14(2):115-32 | |||||
| 2003-01-03 | YGL059W | 393525 | 393525 | Insertion | A | |
|   | In 2001, Lubo Tomaska and Yde Steensma reported that they had resequenced the C-terminal part of YGL059W and found that a single A nucleotide was missing between relative coordinates 1303 and 1304 in the reference sequence. As a consequence, the predicted protein should be 46 amino acids longer than originally annotated. This corresponds to the prediction based on comparative genomics by Blandin et al. 2000. SGD verified this change through resequencing of the region in strain FY1679, a derivative of S288c, and inserted an A after the A at chromosomal coordinate 393525 in the systematic sequence of Chromosome VII. As a result of this change, the new coordinates are 39223-393698, extending the predicted length of the protein from 445 amino acids to 491 amino acids.
Old: 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAA-GCGGTCTTTTAGAT 393539
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
New: 393481 TAAATGGGCACATCAAATATGAAACTCCCCTAATTGAATTGTTAAAGCGGTCTTTTAGAT 393540Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 | |||||
| 2000-06-16 | YGR113W | 719761 | 719761 | Insertion | C | |
|   | Iain Cheeseman reported that a single frameshift 874 bp into the open reading frame at chromosomal coordinate 719761 (TATAC to TATCAC) results in a different coding sequence for the last 44 amino acids and a different stop codon 24 bp downstream from the sequence originally stored in SGD. The Candida DAM1 homolog is more similar to the sequence that Iain Cheeseman reports. SGD incorporated this sequence change on 2001-05-31.
Old: 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 719701 TACCCATCGAAAACGACAATGTTGTTAATTTGGGAGATCTGCATCCAAATAATCGAATAT 719760
Old: 719761 -ACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719819
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 719761 CACTCGGAAGTGGTGCTGCAAGAGTGGTCAATGGGCCCGTTACGAAGAACAGAAATTCAA 719820 | |||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2009-05-07 | ARS709, ARS712, ARS715, ARS723, ARS724, ARS735, ARS736 |
|   | The following ARS elements on Chromosome 7 were added to the genome annotation based on Raveendranathan et al. 2006: ARS709, ARS712, ARS715, ARS723, ARS724, ARS735, and ARS736.Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 |
| 2008-06-02 | YGL256W |
|   | The start of ADH4/YGL256W was moved 249 nt downstream, based on Williams & Paquin 1987 and Lyons et al. 2000, who state that Met84 appears to be the true translational start. See also GenBank X05992.Lyons TJ, et al. (2000) Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast. Proc Natl Acad Sci U S A 97(14):7957-62 Williamson VM and Paquin CE (1987) Homology of Saccharomyces cerevisiae ADH4 to an iron-activated alcohol dehydrogenase from Zymomonas mobilis. Mol Gen Genet 209(2):374-81 |
| 2007-05-08 | snR46 |
|   | Updated coordinates of snR46 based on GenBank Z72814, U56647, Z72815. Shifted entire feature downstream 1 nucleotide.Balakin AG, et al. (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34 |
| 2007-04-04 | YGR148C |
|   | RPL24B/YGR148C mRNA contains an intron in the 5' untranslated region (UTR).Baronas-Lowell DM and Warner JR (1990) Ribosomal protein L30 is dispensable in the yeast Saccharomyces cerevisiae. Mol Cell Biol 10(10):5235-43 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Mitra G and Warner JR (1984) A yeast ribosomal protein gene whose intron is in the 5' leader. J Biol Chem 259(14):9218-24 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 |
| 2007-04-04 | YGR027C |
|   | RPS25A/YGR027C mRNA contains an intron in the 5' untranslated region (UTR).Nieuwint RT, et al. (1985) The gene for yeast ribosomal protein S31 contains an intron in the leader sequence. Curr Genet 10(1):1-5 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 |
| 2007-04-04 | YGL189C |
|   | RPS26A/YGL189C mRNA contains an intron in the 5' untranslated region (UTR).Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 |
| 2007-04-04 | YGL187C |
|   | COX4/YGL187W mRNA contains an intron in the 5' untranslated region (UTR).Schneider JC and Guarente L (1987) The untranslated leader of nuclear COX4 gene of Saccharomyces cerevisiae contains an intron. Nucleic Acids Res 15(8):3515-29 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 |
| 2007-04-04 | YGL031C |
|   | RPL24A/YGL031C mRNA contains an intron in the 5' untranslated region (UTR).Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Mitra G and Warner JR (1984) A yeast ribosomal protein gene whose intron is in the 5' leader. J Biol Chem 259(14):9218-24 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 |
| 2006-10-05 | YGR034W |
|   | Based on N-terminal sequencing (Otaka E. et al) and conservation with RPL26A, the first exon of RPL26B was moved upstream. The new first exon is 19 nts in length (the previous first exon was 25 nts), and the new start codon is 117 nt upstream of the previously annotated start. The 5' end of the intron has been extended upstream, but the 3' end of the intron remains the same, as does the second exon. The protein product is now two residues shorter and altered at the N-terminus. Special thanks to Ivo Pedruzzi and the team at Swiss-Prot for bringing this to our attention.Otaka E, et al. (1984) Yeast ribosomal proteins. VIII. Isolation of two proteins and sequence characterization of twenty-four proteins from cytoplasmic ribosomes. Mol Gen Genet 195(3):544-6 |
| 2006-10-03 | ARS737 |
|   | ARS737, also known as ARS731.5, was added to the genome annotation based on Nieduszynski et al. 2006.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-10-03 | ARS702, ARS704, ARS707, ARS710, ARS714, ARS717, ARS718, ARS719, ARS721, ARS727, ARS728, ARS729, ARS731, ARS733 |
|   | ARS Consensus Sequences (ACS elements) were annotated in the following ARS elements on Chromosome VII based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS717, ARS718, ARS719, ARS721, ARS727, ARS728, ARS729, ARS731, ARS733.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-09-08 | ARS702, ARS704, ARS707, ARS710, ARS714, ARS716, ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734 |
|   | The following new ARS elements on Chromosome VII were added to SGD based on Nieduszynski et al. 2006: ARS702, ARS704, ARS707, ARS710, ARS714, ARS716, ARS717, ARS718, ARS719, ARS720, ARS721, ARS722, ARS727, ARS728, ARS729, ARS731, ARS733, ARS734.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 |
| 2006-05-09 | CEN7 |
|   | The previously annotated 3' boundary of CEN7 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 |
| 2006-04-12 | ARS706 |
|   | ARS706, also known as "ARO8 ARS", was added to the genome annotation for Chromosome VII at coordinates 117565-117858 based on Wyrick et al. 2001 and Iraqui et al. 1998.Iraqui I, et al. (1998) Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily. Mol Gen Genet 257(2):238-48 Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 |
| 2006-01-23 | YGR088W |
|   | Based on based on 5' SAGE TSS and multiple orthologous sequences alignment, Zhang and Dietrich suggest that the start site CTT1/YGR088W be moved 33 nt (11 codons) downstream. This is the same start codon published in the initial characterization by Hartig and Ruis. This change has been incorporated into SGD and the numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly.Hartig A and Ruis H (1986) Nucleotide sequence of the Saccharomyces cerevisiae CTT1 gene and deduced amino-acid sequence of yeast catalase T. Eur J Biochem 160(3):487-90 Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 |
| 2005-11-10 | YGL194C-A |
|   | Based on comparisons of the genome sequences of six Saccharomyces species,Cliften et al. 2003 suggested that this new ORF,YGL194C-A,be added to the S. cerevisiae genome annotation.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2005-11-01 | YGR271C-A |
|   | Identified based on conservation in closely related fungi.Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 |
| 2004-10-12 | CEN7 |
|   | The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003).Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 |
| 2004-08-27 | YGR161W-C |
|   | The ORF YGR161W-C was added per Blandin et al. Note that this ORF was originally published using the systematic name "YGR161W-A;" however, the systematic name "YGR161W-A" had already been used to refer to a TyA Gag protein downstream of the new ORF predicted by Blandin et al.Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 |
| 2004-04-01 | snR7-L, snR7-S |
|   | 5' chromosomal coordinate of both snR7-L and snR7-S changed to that experimentally determined in Patterson, B and Guthrie, C. (1987).Patterson B and Guthrie C (1987) An essential yeast snRNA with a U5-like domain is required for splicing in vivo. Cell 49(5):613-24 |
| 2004-04-01 | snR82 |
|   | Start and stop coordinates updated per McCutcheon and Eddy |
| 2003-09-22 | YGR095C |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RRP46/YGR095C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) this is the form of the protein detected in analyses by Synowsky et al. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Synowsky SA, et al. (2006) Probing genuine strong interactions and post-translational modifications in the heterogeneous yeast exosome protein complex. Mol Cell Proteomics 5(9):1581-92 |
| 2003-09-22 | YGL128C |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for CWC23/YGL128C was moved 192 nt (64 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGL250W |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL250W was moved 12 nt (4 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGR201C |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGR201C was moved 147 nt (49 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGL245W |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for YGL245W was moved 48 nt (16 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGR275W |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for RTT102/YGR275W was moved 87 nt (29 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGL240W |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for DOC1/YGL240W was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGL025C |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for PGD1/YGL025C was moved 102 nt (34 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGR057C |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for LST7/YGR057C was moved 9 nt (3 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-22 | YGR120C |
|   | Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for COG2/YGR120C was moved 39 nt (13 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 |
| 2003-09-09 | TEL07L, TEL07L-TR, TEL07L-XC, TEL07L-XR, TEL07R, TEL07R-XC, TEL07R-XR, TEL07R-YP |
|   | The chromosomal locations for TEL07L, TEL07L-TR, TEL07L-XC, TEL07L-XR, TEL07R, TEL07R-XC, TEL07R-XR, and TEL07R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). |
| 2003-07-29 | YGR169C-A |
|   | Thanks to Brachat et al. for providing the coordinates of YGR169C-A.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 |
| 2003-07-29 | YGL041C-B, YGL210W-A, YGR121W-A, YGR240C-A |
|   | Thanks to Kessler et al. for providing the coordinates of the following Chromosome VII ORFs: YGR240C-A, YGL210W-A, YGR121W-A, and YGL041C-B.Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 |
| 2003-07-29 | YGL007C-A, YGL063C-A, YGL123C-A, YGL188C-A, YGR031C-A, YGR068W-A, YGR146C-A, YGR174W-A, YGR204C-A, YGR270C-A, YGR296C-A, YGR296C-B |
|   | Thanks to Kumar et al. for providing the coordinates of the following Chromosome VII ORFs: YGR270C-A, YGR296C-A, YGR296C-B, YGL007C-A, YGL063C-A, YGL123C-A, YGL188C-A, YGR031C-A, YGR068W-A, YGR146C-A, YGR174W-A, and YGR204C-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 |
| 2003-07-29 | YGL006W-A |
|   | Thanks to MIPS for providing the coordinates of YGL006W-A. |
| 2003-07-29 | YGL014C-A, YGL041W-A, YGR035W-A |
|   | Thanks to
Oshiro et al., Velculescu et al., and Basrai et al. for providing the following Chromosome VII ORFs: YGL014C-A, YGL041W-A and YGR035W-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 |
| 2003-03-06 | snR82 |
|   | Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28 ![]() |
| 2003-01-07 | YGL183C |
|   | A new intron and in-frame 5' exon were added to MND1/YGL183C, changing the N-terminus and increasing the size of the protein from 174 aa to 219 aa. The relative coordinates of the coding region change from 1-525 to 1-3..87-743. Note that the stop remains unchanged. Thanks to Pinar Kondu (Yeast Proteome Database) for reporting this change to SGD. Tsubouchi H and Roeder GS (2002) The Mnd1 protein forms a complex with hop2 to promote homologous chromosome pairing and meiotic double-strand break repair. Mol Cell Biol 22(9):3078-88 |
| 2001-03-06 | ARS701 |
|   | Courtesy of Prof. BiK Tye; based on Ph. D. thesis of Dr. Clarence Chan |
| 2000-12-01 | YGL033W |
|   | The start of ORF YGL033W was moved 374 nucleotides downstream, and the existing intron was narrowed at both ends. The relative coordinates of the coding region change from 1-24..568-1101 to 1-55..126-727, and the chromosomal coordinates of the coding region change from 435247-435270..435814-436347 to 435621-435675..435746-436347. |
| 2000-12-01 | YGR225W |
|   | The stop of ORF YGR225W was moved 552 nucleotides downstream, and at the same time an intron was added at relative coordinates 1184-1276. The relative coordinates of the coding region change from 1-1230 to 1-1183..1277-1782, and the chromosomal coordinates of the coding region change from 945137-946366 to 945137-946319..946413-946918. Note that the start remains unchanged. |
| 2000-07-14 | YGR029W |
|   | The start of ORF YGR029W was moved 299 nucleotides upstream, and at the same time an intron was added at relative coordinates 87-169. The relative coordinates of the coding region change from 1-354 to 1-86..170-653, and the chromosomal coordinates of the coding region change from 543846-544199 to 543547-543632..543716-544199. Note that the stop remains unchanged. |
| 2000-07-14 | YGL251C |
|   | The start of ORF YGL251C was moved 575 nucleotides upstream, and at the same time an intron was added at relative coordinates 59-210. The relative coordinates of the coding region change from 1-3141 to 1-58..211-3716, and the chromosomal coordinates of the coding region change from 31061-27921 to 31636-31579..31426-27921. Note that the stop remains unchanged. |
| 2000-05-19 | YGR001C |
|   | Davis et al. 2000 demonstrated a second intron upstream of the annotated YGR001C ORF that extends the N-terminus by 55 amino acids (aa). The gene was previously annotated to chromosomal coordinates 497802-497128, with two exons at relative coordinates 1-349 and 443-675, for a predicted protein of 193 aa. The updated annotation is from chromosomal coordinates 498029-497128, with three exons at 1-35, 98-576, and 670-902, for a predicted protein of 248 aa.Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 |
| 1999-07-17 | YGL244W |
|   | The start of ORF YGL244W was moved 300 nucleotides upstream. The relative coordinates of the coding region change from 1-1377 to 1-1677, and the chromosomal coordinates of the coding region change from 41798-43174 to 41498-43174. Note that the stop remains unchanged. |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |
Return to SGD |