---

• Site Map |
• Search Options |
• Help |
• Home |
•   |
•  

•  
• Community Info
• Submit Data
• BLAST
• Primers
• PatMatch
• Gene/Seq Resources
• Advanced Search
• Community Wiki

---

Chromosome IV History

Summary Chromosome History

• The sequence of Chromosome IV has been updated 14 times, affecting 15 features.
• The annotation of Chromosome IV has been updated 55 times, affecting 108 features.
• Current and past versions can be obtained from SGD's FTP site.

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2008-06-05	YDL038C, YDL039C	382381	382381	Insertion		G
	Greg Prelich's lab discovered an error in the systematic reference sequence for Chromosome 4. This error was verified in the S288C strain background. Therefore, the following correction was made: insert a G after the G at 382381. New: 1737 TTTGGTGATGGTAGTGTCTTTGGGACCCGAGTAATTTGGGTTCCCAACCTCAGACTGAAT 1678 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old: 382343 TTTGGTGATGGTAGTGTCTTTGGGACCCGAGTAATTTGG-TTCCCAACCTCAGACTGAAT 382401 As a result of this change, ORF YDL038C was merged into ORF PRM7/YDL039C. The new longer ORF is 2097 nt long. The name YDL038C is being retained as an alias for PRM7/YDL039C. Prelich G (2008)
2006-04-13	YDR015C	478023	478023	Insertion		C
	A sequence error in the SGD sequence has been corrected: a single C was inserted in between the G at chromosomal coordinate 478023 and the C at 478024 on chromosome IV (what was three Cs is now 4 Cs). This makes the ORF of YDR015C shorter (79 amino acids) than what was originally annotated (129 aa). New: 181 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAGCCCCAATGGG 240 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Old: 477974 AAACAACAACTTCGTGCCAAAAATCTGTCTGAGAACACAGGTGGCGGAAG-CCCAATGGG 478032 Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
2006-01-19	YDR083W	613206	613206	Insertion		G
	SGD confirmed the sequence error suggested by Kellis et al and has updated the sequence accordingly. As a consequence of this change, RRP8/YDR083W has been extended on the 3' end, altering the C-terminus and increasing the size of the predicted protein from 383 to 392 amino acids. Insert a G after the G at 613206 New: 613187 AAGACGGAAAATTGCCGAAGGAAAATGGCTCTTGAAGC 613224 |||||||||||||||||||| ||||||||||||||||| Old: 613187 AAGACGGAAAATTGCCGAAG-AAAATGGCTCTTGAAGC 613223 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-07-22	YDR031W	503841	503841	Insertion		G
	The work of Kellis et al. 2003 predicted insertion of a single nucleotide within the coding region of YDR031W; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR031W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 117 to 121 amino acids. New: 301 TAAAAATATTAAGCCTTCAATTAATGGAGTAAACTTGGAATTAATCAAGGACTGA 355 ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Old: 503805 TAAAAATATTAAGCCTTCAATTAATGGAGTAAACTTG-AATTAATCAAGGACTGA 50385 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-07-21	YDR179W-A	819479	819479	Insertion		G
	The work of Brachat et al. 2003 predicted insertion of a single nucleotide upstream of YDR179W-A; SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, YDR179W-A was extended at the 5' end, altering the N-terminus without changing the translation frame and increasing the size of the predicted protein from 268 to 463 amino acids. New: 1 TTTTATACAACACCAATTCCAGTTTAATTACCAAGTACCGAAGGCCAAATGCCTCAAATC 60 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old: 819437 TTTTATACAACACCAATTCCAGTTTAATTACCAAGTACCGAAG-CCAAATGCCTCAAATC 819495 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2004-02-11	YDR007W	462037	462037	Substitution	A	C
	Although the systematic sequence for TRP1/YDR007W originally contained a nonsense (ochre) mutation at codon 67, systematic reference strain S288C does not actually contain this mutation in TRP1, which was introduced during the creation of strain AB972. AB972 is an ethidium bromide-induced derivative of the strain X2180-1B-trp1, which was supplied by E. Jones [M.V. Olson]. The lineage of AB972 traces directly to the strain S288C with no intervening outcrosses. The strain AB972 was the origin of the clone used for sequencing this segment of chromosome IV. In order to more accurately present this region of within the S288C reference strain, SGD has sequenced the S288C TRP1 locus and did not find the internal STOP codon. Thus, SGD has updated the TRP1 sequence by changing the previously annotated internal STOP (TAA) to serine (TCA). New: 462018 AAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old: 462018 AAAGCATATAAAAATAGTTAAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAA 462077
2004-02-11	YDL127W	235713	235713	Insertion		A
	Kellis et al. 2003 predicted and confirmed the insertion of a single A nt. As a consequence of this sequence change, PCL2/YDL127W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 279 to 308 amino acids. New: 235675 GAACATACAACATAGACTCCAAACACGATAACAAGGAAAATAGGCCAATACCGACAATTA 235734 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Old: 235675 GAACATACAACATAGACTCCAAACACGATAACAAGGAAA-TAGGCCAATACCGACAATTA 235733 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-02-06	YDR359C	1192051	1192051	Deletion	A
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggested that the stop site for YDR359C be moved 67 nt downstream. Jacques Cote and colleagues resequenced S288C, W303, and BY4741 and confirmed the deletion of a single A nt (see GenBank accession AY464182). As a consequence of this sequence change, the stop of YDR359C was moved 70 nt downstream, increasing the size of the predicted protein from 959 to 982 amino acids. New: 1192020 AGATGGAGATGATTTCGGTGGCGGAGCTTGA-GACCCTGGTTGTAGTTGCTGCA 1192072 ||||||||||||||||||||||||||||||| |||||||||||||||||||||| Old: 1192020 AGATGGAGATGATTTCGGTGGCGGAGCTTGAAGACCCTGGTTGTAGTTGCTGCA 1192073 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2003-09-30
	YDR474C, YDR475C
		1409510	1409510	Insertion		G
		1409656	1409656	Insertion		C
	Due to insertion of G at position 1409511 and a C at position 1409657, YDR474C and JIP4/YDR475C have been merged. After merging YDR474C (1409119 - 1407452 (1-1668)) and JIP4/YDR475C (1410080 - 1409613 (1-468)), the coordinates of the merged ORF, JIP4/YDR475C, are 1410082 - 1407452 (1-2631). YDR474C is now an alias of JIP4/YDR475C. This sequence change was verified in strain S288C by SGD. Old: 1409461 ATCGATGATCTATCTGATTTTTCTTCTTGATCCATAGTTGTCTCCAATTG-CATACGCCC 1409519 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| New: 1409461 ATCGATGATCTATCTGATTTTTCTTCTTGATCCATAGTTGTCTCCAATTGGCATACGCCC 1409520 Old: 1409640 GAGGTGGAGAAGAATAC-TGCCGGGACTAGCACTGCCCTCTCGCCTACTCGAATAGCTAT 1409698 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| New: 1409641 GAGGTGGAGAAGAATACCTGCCGGGACTAGCACTGCCCTCTCGCCTACTCGAATAGCTAT 1409700 Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6        Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2002-12-17	YDR325W	1117105	1117105	Deletion	G
	Due to the deletion of G at 1117105, the start for YDR325W has been moved 48 nt downstream from 1117069 to 1117116. The stop has not been changed. Thanks to Denise Bertsch for reporting this sequence error to SGD. Old: 1117081 TTGGATAAGACAAAGAAGTTAACAGCCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117140 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| New: 1117081 TTGGATAAGACAAAGAAGTTAACA-CCGCGCCCATCATGCAAGATCCTGATGGTATTGAC 1117139 Lavoie BD, et al. (2002) In vivo dissection of the chromosome condensation machinery: reversibility of condensation distinguishes contributions of condensin and cohesin. J Cell Biol 156(5):805-15
2002-12-17	YDR494W	1437732	1437747	Deletion	GATCCTCCTTGATTTT
	Due to the deletion of 16 nt between 1437732-1437747, which had been tandemly duplicated in error, the coordinates of RSM28/YDR494W have been changed. The 16 nucleotides that were removed were near the 3' end of YDR494W, shifting the stop 235 nt downstream, for a net increase in length of 219 nt (from 867 nt to 1086 nt). See GenBank accession number AF459095. Thanks to Tom Fox for reporting this sequence error to SGD. Old: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731 ||||||||||||||||||||||||||||||||||||||||||||||||||| New: 1437681 cctaaacacgccaaactttggtaaatatacaccaggatcctccttgatttt 1437731 Old: 1437732 gatcctccttgatttttgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437791 |||||||||||||||||||||||||||||||||||||||||||| New: 1437732 ----------------tgccaaagagcctcaattgcagaatttacttattgaagaagacc 1437775
2000-04-06	YDR470C	1400863	1400863	Substitution	T	C
	The T at coordinate 1400863 within YDR470C was replaced with a C (tgtCcaa). This results in a replacement of a Glu (GAA) with a Gly (GGA) on the Crick strand where the gene is located. This change was sent to SGD by Hartmut Wohlrab (wohlrab@bbri.org). Old: 1400821 AGCAATTGAAAATACTTTCTGAAAAACATATCCAGCAGTTGTTCAAATATTTTTCGCCAT 1400880 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| New: 1400821 AGCAATTGAAAATACTTTCTGAAAAACATATCCAGCAGTTGTCCAAATATTTTTCGCCAT 1400880 Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18
1999-02-09	YDL048C	368211	368255	Deletion	CATTACTGAGTCAATGCTTGATGCA AAAGATGATGATACCAGCAT
	The first 45 nucleotides of YDL048C (from chromosomal coordinates 368211-368255) were deleted, leaving translation unaffected. This chunk was tandemly-duplicated in error. Old: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New: 368154 cgtctcatgggacattactgagtcaatgcttgatgcaaaagatgatgataccagcat 368210 Old: 368211 cattactgagtcaatgcttgatgcaaaagatgatgataccagcataggggaagccaaaga 368270 ||||||||||||||| New: 368211 ---------------------------------------------aggggaagccaaaga 368225

ANNOTATION CHANGES without sequence changes

Jump to: Sequence changes

Date	Affected Features
2009-05-07	ARS411, ARS412, ARS415, ARS420, ARS427, ARS436, ARS439, ARS442
	The following ARS elements on Chromosome 4 were added to the genome annotation based on Raveendranathan et al. 2006: ARS411, ARS412, ARS415, ARS420, ARS427, ARS436, ARS439, and ARS442. Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
2007-07-10	YDL115C
	The start of ORF IWR1/YDL115C was moved 409 nt upstream and an intron was added at relative coordinates 83-152 based on experimental evidence in Juneau et al. 2007 and Miura et al. 2006. See also GenBank EF123147 and Brachat et al. 2003. Note that this is the same intron that was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but then removed awaiting experimental evidence. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45      Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51              Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2007-04-27	YDL189W
	RBS1/YDL189W mRNA contains an intron in the 5' untranslated region (UTR). [see GenBank Accession #AY245794; Zhang, Z and Dietrich, F.S] Davis CA and Ares M Jr (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7
2007-04-04	YDR099W
	BMH2/YDR099W mRNA contains an intron in the 5' untranslated region (UTR). Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51              Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7            Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9
2007-04-04	YDL137W
	ARF2/YDL137W mRNA contains an intron in the 5' untranslated region (UTR). Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51              Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2007-04-04	YDL061C
	RPS29B/YDL061C mRNA contains an intron in the 5' untranslated region (UTR). Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6          Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51              Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2007-04-04	snR47
	The coordinates of both the 5' and 3' ends of snR47 were shifted 47 nucleotides towards the left end of the chromosome to match those given in the yeast snoRNA database at UMass Amherst and as reported in Balakin AG et al. (1996) and the corresponding GenBank entry U56648. Thanks to Jason Hoskins for reporting this discrepancy and to Wayne Decatur for providing additional confirmation. Balakin AG, et al. (1996) The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86(5):823-34
2007-04-02	YDRCsigma4
	YDRWsigma4, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRCsigma4 and is annotated on the Crick strand. The name YDRWsigma4 is being retained as an alias.
2007-04-02	YDRWsigma2
	YDRCsigma2, a Ty3 LTR on Chromosome IV, was mistakenly annotated on the wrong strand (i.e., on Crick instead of Watson). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YDRWsigma2 and is annotated on the Watson strand. The name YDRCsigma2 is being retained as an alias.
2007-03-06	ARS416
	The ACS within ARS1/ARS416 was annotated based on Xu et al. 2006 and Celniker et al. 1984. Celniker SE, et al. (1984) Deletion mutations affecting autonomously replicating sequence ARS1 of Saccharomyces cerevisiae. Mol Cell Biol 4(11):2455-66      Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
2007-03-06	ARS404
	The ACS within ARS404 was annotated based on Xu et al. 2006 and Russell et al. 1986. Russell DW, et al. (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94      Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
2007-03-06	ARS400
	ARS400 was added to the genome annotation on Chromosome IV at coordinates 137-1392 based on Xu et al. 2006. Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
2006-10-05	ARS432, ARS450, ARS451, ARS452, ARS453
	The following ARS elements on Chromosome IV, in addition to the ARS Consensus Sequence (ACS) for ARS432, were added to the genome annotation based on Nieduszynski et al. 2006: ARS450/417.5, ARS451/422.5, ARS452/431.5, ARS453/432.5. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-09-08	ARS403, ARS405, ARS406, ARS409, ARS410, ARS413, ARS414, ARS417, ARS418, ARS419, ARS421, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS434, ARS435, ARS440, ARS443, ARS446
	The following new ARS elements on Chromosome IV were added to SGD based on Nieduszynski et al. 2006: ARS403, ARS405, ARS406, ARS409, ARS410, ARS413, ARS414, ARS417, ARS418, ARS419, ARS421, ARS423, ARS425, ARS428, ARS429, ARS430, ARS431, ARS433, ARS434, ARS435, ARS440, ARS443, ARS446. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-09-08	ARS422
	The coordinates of ARS422 were updated based on Nieduszynski et al. 2006. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-05-08	CEN4
	The previously annotated 3' boundary of CEN4 was adjusted to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60        Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2006-04-14	YDR014W-A
	New ORF HED1/YDR014W-A was added to the genome annotation for Chromosome IV at coordinates 477794 - 478282 based on Tsubouchi & Roeder 2005. Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
2006-04-13	YDR015C
	Due to the correction of a sequence error, the stop site of YDR015C was moved 150 nt upstream, making the predicted protein 79 amino acids rather than 129 aa. The old coordinates for YDR015C were 478195-477806, but are now 478196-477957. Tsubouchi H and Roeder GS (2006) Budding yeast Hed1 down-regulates the mitotic recombination machinery when meiotic recombination is impaired. Genes Dev 20(13):1766-75
2006-04-13	YDL200C
	The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for MGT1/YDL200C was moved 54 nt (18 codons) downstream. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2006-04-12	YDL065C, YDL216C
	The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al. and this was incorporated into SGD. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2006-04-12	YDR422C
	Based on mutant analysis by Hedbacker et al. 2004, the start codon for SIP/YDR422C was moved 144 bp (48 codons) downstream. Hedbacker et al. 2004 showed that the first ATG of the ORF is not required for expression of functional Sip1p. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Hedbacker K, et al. (2004) Cyclic AMP-dependent protein kinase regulates the subcellular localization of Snf1-Sip1 protein kinase. Mol Cell Biol 24(5):1836-43
2006-04-12	ARS422
	ARS422, also known as "ARO1 ARS", was added to the genome annotation for Chromosome IV at coordinates 702799-703275 based on Wyrick et al. 2001 and Larimer et al. 1983. Larimer FW, et al. (1983) Isolation of the ARO1 cluster gene of Saccharomyces cerevisiae. Mol Cell Biol 3(9):1609-14      Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2006-04-10	ARS416
	ARS416, originally designated ARS1, was added to the genome annotation for Chromosome IV at coordinates 462351-463189 based on Wyrick et al. 2001, Stinchcomb et al. 1979, and GenBank Accession U01086. "ARS1" is being retained as the Standard Gene Name for historical reasons, but the systematic name "ARS416" is being used for consistency purposes, to indicate that this ARS is part of Chromosome IV. Stinchcomb DT, et al. (1979) Isolation and characterisation of a yeast chromosomal replicator. Nature 282(5734):39-43      Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2006-04-10	ARS404
	ARS404, also known as "HO ARS", was added to the genome annotation for Chromosome IV at coordinates 45919-46272 based on Wyrick et al. 2001 and Russell et al. 1986. Russell DW, et al. (1986) Structure of the Saccharomyces cerevisiae HO gene and analysis of its upstream regulatory region. Mol Cell Biol 6(12):4281-94      Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2005-11-22	YDL208W
	The start site of NHP2/YDL208W is being moved 51 bp downstream from 87462 to 87513 based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. This annotation change was also suggested by Kellis et al. 2003. The annotated protein is reduced in length from 173 aa to 156 aa. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
2005-11-22	YDR378C
	The start site of LSM6/YDR378C is being moved 111 bp downstream from 1229710 to 1229599, based on the 5' SAGE data used by Zhang & Dietrich 2005 to map transcription start sites. Bouveret et al. 2000 also suggested this new start site because it is consistent with the protein's apparent molecular mass of 9.3 kDa, and is supported by comparison of the yeast Lsm6p sequence with homologs from other organisms. The annotated size of the protein changes from 123 aa to 86 aa. Bouveret E, et al. (2000) A Sm-like protein complex that participates in mRNA degradation. EMBO J 19(7):1661-71        Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
2005-11-16	YDL007C-A, YDR119W-A, YDR374W-A, YDR461C-A
	Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following new ORFs be added to the S. cerevisiae genome annotation: YDL007C-A, YDR119W-A, YDR374W-A, YDR461C-A. Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2004-10-12	CEN4
	Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60        Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2004-04-01	snR84
	Start and stop coordinates updated per McCutcheon and Eddy
2004-02-24	YDL115C
	Davis et al. 2000 demonstrated that there is an intron in the 5'UTR of IWR1/YDL115C that does not affect the coding region. Based on sequence comparison with related fungi, Brachat et al. 2003 later predicted a different intron that would extend the N-terminus of IWR1/YDL115C. Brachat et al. predict that the intron uses the same 5' splice junction demonstrated by Davis et al., but a different 3' splice junction. The intron predicted by Brachat et al. was briefly incorporated into SGD (for one month from 2004-01-23 to 2004-02-24), but was then removed and will be not annotated again until supported by experimental evidence. Intron and splice junctions confirmed by Davis et al.: 1st exon ...GGATTCTGTG CAGGCATTAT intron GTATGTGTTG TTATTCTACC GATATAACAA AAATGCGTTT GACTAACTAA GTTCATCTGG GACAATTCAG TAATTGATGA GGGGAAAAG 2nd exon AGTGAAGAAG CAGAAGTTCA... Intron and splice junctions predicted by Brachat et al.: 1st exon ...GGATTCTGTG CAGGCATTAT intron GTATGTGTTG TTATTCTACC GATATAACAA AAATGCGTTT GACTAACTAA GTTCATCTGG GACAATTCAG 2nd exon TAATTGATGA GGGGAAAAGA... Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6        Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2004-01-26	YDR381C-A
	Increased the size of the intron in YDR381C-A by 1 bp on 5' end and 2 bp on 3' end based on conserved splice site sequences. See Blandin et al. 2000. Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
2004-01-23	YDL115C
	Based on analyses of homology and synteny in Ashbya gossypii and Candida albicans, Brachat et al. (2003) proposed an intron and 5' extension for IWR1/YDL115C. The resulting ORF is in the same frame with the start codon shifted 409 bp upstream, now including a 70-bp intron; the protein has a 113-residue extension at the N-terminus. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2003-09-27	YDR318W
	Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 5' exon for MCM21/YDR318W. The resulting ORF is in the same frame with the start moved 434 nt upstream, and the protein has a 117-residue extension at the N-terminus. The same intron and 5' exon are also described by Ortiz et al. 1999. Ortiz J, et al. (1999) A putative protein complex consisting of Ctf19, Mcm21, and Okp1 represents a missing link in the budding yeast kinetochore. Genes Dev 13(9):1140-55        Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDR486C
	Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for VPS60/YDR486C was moved 99 nt (33 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDR485C
	Based on the automated comparison of closely related Saccharomyces species by Kellis et al., the start site for VPS72/YDR485C was moved 45 nt (15 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDR400W
	Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for URH1/YDR400W was moved 114 nt (38 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This start site was previously proposed by Kurtz et al, who noted that translation from this second methionine is more consistent with the observed size of URH1 and has closer similarity to related proteins. Kurtz JE, et al. (2002) The URH1 uridine ribohydrolase of Saccharomyces cerevisiae. Curr Genet 41(3):132-41        Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDR463W
	Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for STP1/YDR463W was moved 174 nt (58 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Previously published data from Wang et al. demonstrate that the second in frame methionine is the most likely start codon. Wang SS, et al. (1992) STP1, a gene involved in pre-tRNA processing, encodes a nuclear protein containing zinc finger motifs. Mol Cell Biol 12(6):2633-43      Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDL144C
	The start site of YDL144C was moved 9 nt (3 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDL069C
	The start site of CBS1/YDL069C was moved 12 nt (4 codons) downstream, based on automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Deletion analyses by Krause-Bucholz et al. 2000 demonstrate that N-terminal sequences are not essential for either the function or mitochondrial targeting of this protein. Krause-Buchholz U, et al. (2000) Identification of functionally important regions of the Saccharomyces cerevisiae mitochondrial translational activator Cbs1p. Yeast 16(4):353-63        Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDR383C
	Based on the automated comparison of closely-related Saccharomyces species by Kellis et al., the start site for NKP1/YDR383C was moved 42 nt (14 codons) downstream. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDL139C
	The start site of YDL139C was moved 72 nt (24 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDR083W
	The start site of RRP8/YDR083W was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YDR205W
	The start site of MSC2/YDR205W was moved 48 nt (16 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-09	TEL04L, TEL04L-TR, TEL04L-XC, TEL04L-XR, TEL04R, TEL04R-TR, TEL04R-XC, TEL04R-XR, TEL04R-YP
	The chromosomal locations for the following telomeric elements on Chromosome IV were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL04L, TEL04L-XC, TEL04L-XR, TEL04L-TR, TEL04R, TEL04R-XC, TEL04R-XR, TEL04R-TR, TEL04R-YP.
2003-07-29	YDL025W-A, YDL086C-A, YDL159C-B, YDR354C-A, YDR464C-A, YDR510C-A, YDR524C-A, YDR545C-A
	Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL025W-A, YDL086C-A, YDL159C-B, YDR354C-A, YDR464C-A, YDR510C-A, YDR524C-A, YDR545C-A. Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
2003-07-29	YDR524C-B, YDR524W-C
	Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome IV: YDR524C-B, YDR524W-A.
2003-07-29	YDR003W-A, YDR118W-A, YDR320W-B, YDR371C-A
	Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome IV: YDR003W-A, YDR118W-A, YDR320W-B, YDR371C-A. Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9        Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51          Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
2003-07-29	YDL160C-A
	Thanks to Brachat et al. for providing the coordinates of ORF YDL160C-A. Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2003-07-29	YDL022C-A, YDR169C-A, YDR182W-A, YDR183C-A, YDR194W-A, YDR246W-A, YDR406W-A
	Thanks to Kessler et al. for providing the coordinates of the following ORFs on Chromosome IV: YDL022C-A, YDR169C-A, YDR182W-A, YDR183C-A, YDR194W-A, YDR246W-A, YDR406W-A. Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
2003-03-06	snR84
	Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
2001-03-09	snR47
	Changed from W -> C: old start coord: 541641; old stop coord: 541701 new start coord: 541739; new stop coord: 541641 References: 1. Ni et al. (1996) Cell 86(5):823-834 2. snoRNA database: http://www.bio.umass.edu/biochem/rna-sequence/Yeast_snoRNA_Database/snoRNA_DataBase.html 3. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706
2001-01-30	YDL085C-A
	ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
2000-12-01	YDR139C
	The intron of ORF YDR139C was moved 3 nt downstream as a whole, changing the relative coordinates of the coding region from 1-146..220-307 to 1-149..223-307. Note that while the coding sequence has changed slightly, the genomic sequence remains unchanged.
2000-07-22	YDL189W
	The start site of ORF YDL189W was moved 238 nt downstream and the annotated intron was removed, changing the relative coordinates of the coding region from 1-100..246-1612 to 1-1374. Note that the stop remains unchanged.
1999-07-17	YDR381W
	A new intron and 5' exon were added to YDR381W. Relative coordinates change from 1-321 to 1-285..1052-1447, and chromosomal coordinates change from 1237718-1238038 to 1236547-1236831..1237598-1237993.

Jump to: Sequence Changes | Annotation Changes without Sequence Changes

Return to SGD

Send a Message to the SGD Curators