Chromosome II History

Summary

Chromosome History

This page lists all sequence and annotation changes that have been made to the Chromosome II systematic reference sequence since its intial release on 1996-07-31.

The sequence of Chromosome II has been updated 44 times, affecting 31 features.
The annotation of Chromosome II has been updated 43 times, affecting 86 features.
Current and past versions can be obtained from SGD's FTP site.

SEQUENCE CHANGES, including any resulting annotation changes

Jump to: Annotation changes

Date Affected Features Start Coordinate
of Change End Coordinate
of Change Type of Change Old Sequence New Sequence
2004-07-16 YBL066C 96812 96962 Substitution GTGGTTGGATAGAGAACAGTGTTAG TCCCGTAGAATCGTGGTCGTTGTTC TATGATATCAACTTTGGAACAACTC AGAGGTGGATATCCCGTCTTTTAGA GGACCGGGGTCGGACGCGGAATCCA ACTGTCATATATTGACCGAAACAAA G GATGGTTTGGAAGTTAGAAGAAGTT ACAGTGTTAGTGCCCGTAGAAAATC GTTGGTTCGTTTTGTTGCTATTGAT ATCATTACTTTTGGAAAACAAGCTC AGAGGTGGATATGCCGTGCTTTTAG AGGAGCCGGGGTCGGAAACGACGGA ATGCAAATCTGTCATATTATTTGAC TTCGAAGCAATCG
SGD re-sequenced this region in S288C and found that 37 nucleotide insertions and 4 nucleotide changes were necessary to correct the reference sequence. As a consequence of these changes, SEF1/YBL066C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 1,057 to 1,148 amino acids.
New: 1 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCGATGGTTTGGAAGTTAGAAGAAGTTA 60 ||||||||||||||||||||||||||||||||||| ||||| ||| ||| |||| Current: 96777 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCG-TGGTT-GGA---TAG-AGAA---- 96826 New: 61 CAGTGTTAGTGCCCGTAGAAAATCGTTGGTTCGTTTTGTTGCTATTGATATCATTACTTT 120 |||||||||| ||||||||| |||| || ||||| ||| ||| |||||||| ||||| Current: 96827 CAGTGTTAGT-CCCGTAGAA--TCGT-GG-TCGTT--GTT-CTA-TGATATCA--ACTTT 96875 New: 121 TGGAAAACAAGCTCAGAGGTGGATATGCCGTGCTTTTAGAGGAGCCGGGGTCGGAAACGA 180 |||| ||| ||||||||||||||| |||| ||||||||||| ||||||||||| || Current: 96876 -GGAA--CAA-CTCAGAGGTGGATATCCCGT-CTTTTAGAGGA-CCGGGGTCGGA--CG- 96926 New: 181 CGGAATGCAAATCTGTCATATTATTTGACTTCGAAGCAATCGGTGTACGTGAATGGGACA 240 |||||| ||| ||||||||| | ||||| |||| ||| ||||||||||||||||||| Current: 96927 CGGAATCCAA--CTGTCATAT-A-TTGAC--CGAAACAAA-GGTGTACGTGAATGGGACA 96979
2004-07-13 YBL067C 93899 93899 Insertion A
The work of Kellis et al. 2003 predicted the insertion of a single nucleotide; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, UBP13/YBL067C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 688 to 747 amino acids.
New: 93883 TCGCTTTATAAAACAAAACATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93942 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old: 93883 TCGCTTTATAAAACAAA-CATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93941
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2004-07-12 YBR062C 366383 366383 Deletion T
The work of Cliften et al. 2003 predicted that there is a sequencing error in YBR062C: an single nucleotide should be deleted 100 nt upstream of the currently annotated start site. Assuming this sequence change, Cliften et al. further propose a new intron and 5' exon, and a framechange for this ORF. When spliced, this ORF would now encode a predicted protein of 180 amino acids. This sequence error was confirmed in S288C by SGD and the coordinates have been changed accordingly (start was moved upstream 195 nt and an intron was added at relative coordinates 17-98).
New: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCT-GACCTGTCTTCTCTGCTCCTCCTGTG ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Old: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCTTGACCTGTCTTCTCTGCTCCTCCTGTG
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2004-07-09 YBR108W 457298 457298 Insertion G
The work of Kellis et al. 2003 predicted the insertion of a single G after the G at chromosomal coordinate 457298. This sequence error was confirmed in strain S288C by SGD. As a consequence of this sequence change which caused a frameshift, YBR108W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 848 to 947 amino acids.
New: CGGTTCGAAAAAAGTGAAGGACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Old: CGGTTCGAAAAAAGTGAAG-ACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2004-01-29 YBL097W 40900 40901 Deletion GA
Kellis et al. 2003 predicted and confirmed the deletion of two nucleotides (GA) at chromosomal coordinates 40900-40901. As a consequence of this deletion, YBL097W was extended at the 5' end, altering the N-terminus and increasing the predicted protein from 728 to 754 amino acids.
New 61 TTTACCAATAGA--TCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG 118 |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Old 40888 TTTACCAATAGAGATCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG 40947
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2004-01-29 YBL013W 203180 203180 Insertion C
A single C nucleotide insertion was confirmed by sequencing genomic DNA from FY23 (S288C) and a D273-10B related strain; GenBank accession number for FY23 is AY490279. The stop codon of ORF YBL013W has been moved downstream, so that the ORF is now 1206 nucleotides long as opposed to the previously annotated 1182 nt.
New 1141 GGCCAGTTCATGGCGCGCCTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC 1200 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Old 203163 GGCCAGTTCATGGCGCG-CTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC 203221
2004-01-28 YBL006C, YBL006W-A 216785 216785 Deletion G
Kellis et al. 2003 predicted and confirmed the deletion of a single nucleotide at 216785. As a consequence of this sequence change, YBL006C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 145 to 180 amino acids. In addition, YBL006W-A was extended at the 3' end, altering the C-terminus and increasing size of the predicted protein from 39 to 49 amino acids.
New 301 TCAAGTGTCGA-CTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA 359 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Old TCAAGTGTCGACCTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2004-01-26
YBL103C-A, YBL104C
21347 21347 Insertion A
21345 21345 Insertion A
21288 21288 Insertion C
21279 21279 Insertion T
18364 18364 Insertion G
Brachat et al. 2003 and Kellis et al. 2003 predicted and confirmed DIFFERENT sequence changes for YBL104C. Brachat et al. demonstrated the insertion of a single G nt, which extended the 3' end by 141 nt and altered the C-terminus, resulting in overlapping ORF YBL103C-A becoming part of YBL104C (Cliften et al. also predicted this change).
New: CTTCTGTCTGCATTGGATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Previous: 18350 CTTCTGTCTGCATTG-ATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 18408
Kellis et al. demonstrated the insertion of four separate nucleotides (a single T, a single C, and two separate As), which extended at the 5' end by 198 nt and altered the N-terminus. The inserted C (G on the opposite, coding strand) is the third nucleotide of the new ATG start codon.
New: ATTATCATATGACCAATGGGTCACTTTTTTGATGAGACCCATGTTTATTCTTCTATACGT ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| Previous: 21251 ATTATCATATGACCAATGGGTCACTTTTT-GATGAGACC-ATGTTTATTCTTCTATACGT 21308 New: TCGTGATACTGCACTTACGACTACCAGTAACATCAGAATAACCATAGAGC ||||||||||||||||||||||||||||||||||||| || ||||||||| Previous: 21309 TCGTGATACTGCACTTACGACTACCAGTAACATCAGA-TA-CCATAGAGC 21356
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2004-01-21 YBR041W 320081 320082 Deletion CC
Kellis et al. 2003 and Brachat et al. 2003 independently predicted and confirmed the deletion of two C nucleotides from YBR041W. As a consequence of this change, YBR041W was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 623 to 669 amino acids.
New: TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAA--TC |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Previous: 320025 TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAACCTC 320084
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

2004-01-20 YBR157C 553996 553996 Insertion G
Kellis et al. 2003 predicted and confirmed the insertion of a single G nt after the C at chromosomal coordinate 553996. As a consequence of this sequence change, YBR157C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 106 to 255 amino acids.
New: TATGGAGGAATTTCTCCTCGTTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Previous: 553978 TATGGAGGAATTTCTCCTC-TTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT 554036
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2004-01-09
YBR269C
742175 742175 Insertion G
742165 742165 Insertion G
Kellis et al. 2003 predicted and confirmed the insertion of G after the G at chromosomal coordinate 742165, and the insertion of another G after the G at 742175. As a consequence of these sequence changes, YBR269C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 130 to 138 amino acids. This sequence change was incorporated at MIPS prior to SGD, and was verified in strain S288C.
New: ACGAATAATCGCCGTGTCTCAACGGGTCCTGCTTGGGACCCCCAACTTCACCAGTCTTGG ||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| Previous: 742141 ACGAATAATCGCCGTGTCTCAACGG-TCCTGCTTGG-ACCCCCAACTTCACCAGTCTTGG
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2003-09-29
YBR074W, YBR075W
387625 387625 Deletion G
387430 387430 Deletion C
Due to deletion of a C after the C at position 387430 and a deletion of G after the G at position 387625, YBR074W and YBR075W were merged. After merging YBR074W (386243 - 387484 (1-1242)) and YBR075W (387793 - 389175 (1-1383)), the coordinates of the merged ORF, YBR074W, are 386243 - 389173 (1 - 2931). YBR075W is now an alias of YBR074W. These sequence changes were verified in S288c strain by SGD.
Query: 1141 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGAC-ACGCTTTCCTCT 1199 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 387383 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGACCACGCTTTCCTCT 387442 Query: 1380 AAG-CCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 1438 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 387623 AAGGCCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 387682
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

2003-01-03 YBR098W, YBR100W 442868 442868 Deletion C
Due to a change to the systematic sequence of chromosome II (C deletion at 442868), YBR098W and YBR100W have been merged to one single ORF of 691 aa. MMS4 is the standard name for the new, elongated ORF after merging; YBR100W and SLX2 are its aliases. The new coordinates of MMS4/YBR098W are 441473-443548, for a coding sequence of 2076 nt.
We thank Jim Brown (james.brown@stanford.edu), and Kirk Ehmsen (ktehmsen@ucdavis.edu) for reporting this sequence error on Chr II, which was verified in the FY1679 (S288c derivative) strain background by SGD.
Old: 442861 AGAAAACCGTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442920 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| New: 442861 AGAAAAC-GTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442919
Xiao W, et al. (1998) Mms4, a putative transcriptional (co)activator, protects Saccharomyces cerevisiae cells from endogenous and environmental DNA damage. Mol Gen Genet 257(6):614-23

Kaliraman V, et al. (2001) Functional overlap between Sgs1-Top3 and the Mms4-Mus81 endonuclease. Genes Dev 15(20):2730-40

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

2003-01-02 YBR086C 422272 422273 Substitution TA AT
We received a direct notification from MIPS about the following sequence changes; we did not have this change in SGD, so the sequence was edited: The T at 422272 was changed to an A, and the A at 422273 was changed to a T. These differences changed amino acid residue 243 of IST2/YBR086C from Tyr (TAC) -> Ile (ATC). The coordinates of YBR086C are not changed due to this sequence update. References: (1) Sequence verification in FY1679 (S288c derivative strain) background by SGD, (2) Personal communication from Anna Kurlandzka (ania218@poczta.ibb.waw.pl).
Old: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGTAGAAAATT 422280 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| New: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGATGAAAATT 422280
2001-05-29 YBL004W 234918 234918 Substitution C A
A change was made to the systematic sequence of Chromosome II within the ORF UTP20/YBL004W. The C at chromosomal coordinate 234918 was changed to an A:
Old: 234901 CAGACCGTATTAGAAAGCAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| New: 234901 CAGACCGTATTAGAAAGAAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960
2001-05-29 YBL069W 91711 91711 Deletion C
A change was made to the systematic sequence of Chromosome II within the ORF AST1/YBL069W. The C at chromosomal coordinate 91711 was deleted, shifting the reading frame and moving the stop from 91722 to 92025:
Old: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACCCACTGTAGGTGATTACGTTGCCAATTATAA 91740 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| New: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACC-ACTGTAGGTGATTACGTTGCCAATTATAA 91739
1999-04-26 YBR201W 623651 623651 Deletion A
A change was made to the systematic sequence of Chromosome II in the region upstream of the ORF DER1/YBR201W. The A at chromosomal coordinate 623651 was deleted. As a result, the start of YBR201W was moved upstream 210 nucleotides, increasing the size of the predicted protein from 141 to 211 amino acids.
Old: 623640 GATCCAGGGAAAGGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623699 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| New: 623640 GATCCAGGGAA-GGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623698
1999-04-26 YBR294W 791709 791709 Substitution T C
A change was made to the systematic sequence of Chromosome II within the ORF SUL1/YBR294W. The T at chromosomal coordinate 791709 was changed to a C:
Old: 791700 TATGTGCTGTAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| New: 791700 TATGTGCTGCAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759
1999-04-26
YBR069C, YBR070C
378815 378815 Deletion C
378810 378810 Insertion T
378824 378824 Insertion C
Three changes were made to the systematic sequence of Chromosome II in the intergenic region between the ORFs TAT1/YBR069C and ALG14/YBR070C. A single T was inserted after the T at chromosomal coordinate 378810, the C at 378815 was deleted, and a C was inserted after the G at 378824:
Old: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTT-GGCCCGTCCCGGCG-GGCGAAGAGTGAGAC 378839 |||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||| New: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTTTGGCC-GTCCCGGCGCGGCGAAGAGTGAGAC 378840
1999-04-26
YBR266C, YBR267W
739912 739912 Deletion A
739866 739866 Deletion G
Two changes were made to the systematic sequence of Chromosome II within the ORF REI1/YBR267W. The G at chromosomal coordinate 739866 was deleted, and the A at 739912 was deleted; as a result, the start of YBR267W was moved 294 nt upstream.
Note that the deletion at 739912 also affects the overlapping ORF SLM6/YBR266C; as a result, the stop of YBR266C was moved 111 nt upstream:
Old: 739860 GAGCAGGCGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGAACGTGTTG 739919 |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| New: 739860 GAGCAG-CGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGA-CGTGTTG 739917
1999-04-23 YBL066C 97484 97485 Substitution TG GC
A change was made to the systematic sequence of Chromosome II within the ORF SEF1/YBL066C. The two nucleotides TG at positions 575 and 576 (chromosomal coordinates 97484-97485) were changed to GC, altering translation by changing amino acid 192 from Gln (CAA) to Ala (GCA). Note that this ORF is on the Crick strand.
Old: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTTGCTGCTTTAAGGCATT 97500 ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| New: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTGCCTGCTTTAAGGCATT 97500
Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America

1999-04-23 YBL067C 94040 94040 Substitution G C
A change was made to the systematic sequence of Chromosome II within the ORF UBP13/YBL067C. The G at chromosomal coordinate 94040 was changed to a C:
Old: 94021 CATAATGGCCGTGTTGTGGGCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| New: 94021 CATAATGGCCGTGTTGTGGCCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080
1999-04-23
YBR006W
248539 248539 Substitution A T
248278 248278 Substitution A T
247367 247367 Substitution C T
247262 247262 Substitution C G
Three single nucleotide (nt) substitutions were made to the systematic sequence of Chromosome II within the ORF UGA2/YBR006W, and one substitution was made in the adjacent intergenic region. The C at chromosomal coordinate 247262 was changed to a G, the C at 247367 was changed to a T, the A at 248278 was changed to a T (destroying the stop codon), and the A at 248539 was changed to a T. As a result, the stop was moved 186 nucleotides downstream, increasing the size of the coding sequence from 1308 nt to 1494 nt.
Old: 247261 TCGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| New: 247261 TGGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320

Old: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGCTTATATGGTGCTA 247380 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| New: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGTTTATATGGTGCTA 247380

AND Old: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTAAT 248280 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || New: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTTAT 248280

AND Old: 248521 GTATATATCTATTGCATGAATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| New: 248521 GTATATATCTATTGCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580
1999-04-22 YBL033C 159114 159114 Substitution C G
The C at chromosomal coordinate 159114 within the ORF RIB1/YBL033C was changed to a G, altering translation by changing amino acid 181 from Lys (AAG) to Asn (AAC). Note that this ORF is on the Crick strand:
Old: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATCTTGCTT 159120 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| New: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATGTTGCTT 159120
Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America

1998-09-13
YBL101C
28296 28296 Insertion C
28302 28302 Insertion GG
28306 28306 Substitution A G
28272 28272 Insertion G
25408 25408 Insertion C
25394 25394 Deletion T
Six changes were made to the systematic sequence of Chromosome II within the ORF ECM21/YBL101C and in the adjacent intergenic region. Within the ORF, the T at chromosomal coordinate 25394 was deleted, and a single C was inserted after the C at 25408:
Old: 25381 CGGCATCATCGCTTGTATCCGGATGGCC-ACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439 ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| New: 25381 CGGCATCATCGCT-GTATCCGGATGGCCCACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439
Upstream of the ORF, a single G was inserted after the G at 28272, a single C was inserted after the C at 28296, two nucleotides (nt) GG were inserted after the G at 28302, and the A at 28306 was changed to a G:
Old: 28260 TTTTTCGCCACCG-TCTTGATGTTATAAACGGCATGCC-AATAGG--TAGAGAAAAATCT 28315 ||||||||||||| |||||||||||||||||||||||| |||||| ||| ||||||||| New: 28260 TTTTTCGCCACCGGTCTTGATGTTATAAACGGCATGCCCAATAGGGGTAGGGAAAAATCT 28319
The start site of YBL101C was then moved upstream, extending the size of the coding region from 3234 nt to 3354 nt, and the size of the predicted protein from 728 amino acids (aa) to 754 aa.
1997-07-27 YBL103C 22603 22603 Insertion G
A single G was inserted after the G at chromosomal coordinate 22603 within the ORF RTG3/YBL103C, shifting the frame and extending the 3' end by 510 nucleotides:
New: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTGGCCGAGTTCTTTTATCT 22620 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Old: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTG-CCGAGTTCTTTTATCT 22619
1997-07-27 YBL091C 48615 48615 Substitution A C
The A at chromosomal coordinate 48615 (upstream of the Crick strand ORF MAP2/YBL091C at coordinates 48402-47353) was changed to a C, and the start site of YBL091C was then moved 216 nucleotides (nt) upstream to the newly-created start codon, extending the size of the coding sequence from 1050 nt to 1266 nt, the size of the predicted protein from 349 amino acids (aa) to 421 aa. Note that the sequence presented below is from the Watson strand:
New: 48600 TATTTCAGCGTCTGTCATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Old: 48600 TATTTCAGCGTCTGTAATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2004-07-16	YBL066C	96812	96962	Substitution	GTGGTTGGATAGAGAACAGTGTTAG TCCCGTAGAATCGTGGTCGTTGTTC TATGATATCAACTTTGGAACAACTC AGAGGTGGATATCCCGTCTTTTAGA GGACCGGGGTCGGACGCGGAATCCA ACTGTCATATATTGACCGAAACAAA G	GATGGTTTGGAAGTTAGAAGAAGTT ACAGTGTTAGTGCCCGTAGAAAATC GTTGGTTCGTTTTGTTGCTATTGAT ATCATTACTTTTGGAAAACAAGCTC AGAGGTGGATATGCCGTGCTTTTAG AGGAGCCGGGGTCGGAAACGACGGA ATGCAAATCTGTCATATTATTTGAC TTCGAAGCAATCG
	SGD re-sequenced this region in S288C and found that 37 nucleotide insertions and 4 nucleotide changes were necessary to correct the reference sequence. As a consequence of these changes, SEF1/YBL066C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 1,057 to 1,148 amino acids. New: 1 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCGATGGTTTGGAAGTTAGAAGAAGTTA 60 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\| \|\|\| \|\|\|\| Current: 96777 TGTTTCCAGGAGTCTTCACGTTGTTTTCATTATCG-TGGTT-GGA---TAG-AGAA---- 96826 New: 61 CAGTGTTAGTGCCCGTAGAAAATCGTTGGTTCGTTTTGTTGCTATTGATATCATTACTTT 120 \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\| \|\|\|\| \|\| \|\|\|\|\| \|\|\| \|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\| Current: 96827 CAGTGTTAGT-CCCGTAGAA--TCGT-GG-TCGTT--GTT-CTA-TGATATCA--ACTTT 96875 New: 121 TGGAAAACAAGCTCAGAGGTGGATATGCCGTGCTTTTAGAGGAGCCGGGGTCGGAAACGA 180 \|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\| Current: 96876 -GGAA--CAA-CTCAGAGGTGGATATCCCGT-CTTTTAGAGGA-CCGGGGTCGGA--CG- 96926 New: 181 CGGAATGCAAATCTGTCATATTATTTGACTTCGAAGCAATCGGTGTACGTGAATGGGACA 240 \|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\| \| \|\|\|\|\| \|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Current: 96927 CGGAATCCAA--CTGTCATAT-A-TTGAC--CGAAACAAA-GGTGTACGTGAATGGGACA 96979
2004-07-13	YBL067C	93899	93899	Insertion		A
	The work of Kellis et al. 2003 predicted the insertion of a single nucleotide; this sequence error was confirmed in S288C by SGD. As a consequence of this sequence change, UBP13/YBL067C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 688 to 747 amino acids. New: 93883 TCGCTTTATAAAACAAAACATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93942 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old: 93883 TCGCTTTATAAAACAAA-CATATGCTGTTGCCATATTTGGAGATTCACCTGTGAATTCTA 93941 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-07-12	YBR062C	366383	366383	Deletion	T
	The work of Cliften et al. 2003 predicted that there is a sequencing error in YBR062C: an single nucleotide should be deleted 100 nt upstream of the currently annotated start site. Assuming this sequence change, Cliften et al. further propose a new intron and 5' exon, and a framechange for this ORF. When spliced, this ORF would now encode a predicted protein of 180 amino acids. This sequence error was confirmed in S288C by SGD and the coordinates have been changed accordingly (start was moved upstream 195 nt and an intron was added at relative coordinates 17-98). New: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCT-GACCTGTCTTCTCTGCTCCTCCTGTG \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old: AAAGTTTTGAAATAGACCTTGCAGTTGGGATCTTGACCTGTCTTCTCTGCTCCTCCTGTG *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2004-07-09	YBR108W	457298	457298	Insertion		G
	The work of Kellis et al. 2003 predicted the insertion of a single G after the G at chromosomal coordinate 457298. This sequence error was confirmed in strain S288C by SGD. As a consequence of this sequence change which caused a frameshift, YBR108W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 848 to 947 amino acids. New: CGGTTCGAAAAAAGTGAAGGACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old: CGGTTCGAAAAAAGTGAAG-ACTCTAGCCCTGTTCCCTCAGATCTAGATGAAAAATATGT *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-01-29	YBL097W	40900	40901	Deletion	GA
	Kellis et al. 2003 predicted and confirmed the deletion of two nucleotides (GA) at chromosomal coordinates 40900-40901. As a consequence of this deletion, YBL097W was extended at the 5' end, altering the N-terminus and increasing the predicted protein from 728 to 754 amino acids. New 61 TTTACCAATAGA--TCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG 118 \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old 40888 TTTACCAATAGAGATCCACCATGATGGCAAATTTTGAAGAATGGATCAAAATGGCTACAG 40947 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-01-29	YBL013W	203180	203180	Insertion		C
	A single C nucleotide insertion was confirmed by sequencing genomic DNA from FY23 (S288C) and a D273-10B related strain; GenBank accession number for FY23 is AY490279. The stop codon of ORF YBL013W has been moved downstream, so that the ORF is now 1206 nucleotides long as opposed to the previously annotated 1182 nt. New 1141 GGCCAGTTCATGGCGCGCCTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC 1200 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old 203163 GGCCAGTTCATGGCGCG-CTGCGGAAAAGATGCGGCGCCCTGAGTGAAAAGTTAGTTTTC 203221
2004-01-28	YBL006C, YBL006W-A	216785	216785	Deletion	G
	Kellis et al. 2003 predicted and confirmed the deletion of a single nucleotide at 216785. As a consequence of this sequence change, YBL006C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 145 to 180 amino acids. In addition, YBL006W-A was extended at the 3' end, altering the C-terminus and increasing size of the predicted protein from 39 to 49 amino acids. New 301 TCAAGTGTCGA-CTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA 359 \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old TCAAGTGTCGACCTTTTCGCACCATTTCCACCGCACATTAGAATGCAAAGCTGCTCTAGA *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-01-26
YBL103C-A, YBL104C
21347	21347	Insertion		A
21345	21345	Insertion		A
21288	21288	Insertion		C
21279	21279	Insertion		T
18364	18364	Insertion		G
	Brachat et al. 2003 and Kellis et al. 2003 predicted and confirmed DIFFERENT sequence changes for YBL104C. Brachat et al. demonstrated the insertion of a single G nt, which extended the 3' end by 141 nt and altered the C-terminus, resulting in overlapping ORF YBL103C-A becoming part of YBL104C (Cliften et al. also predicted this change). New: CTTCTGTCTGCATTGGATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Previous: 18350 CTTCTGTCTGCATTG-ATCGCGTGATTGCGTCCCATTTATTACAAAAGGTAAGTTTGACG 18408 Kellis et al. demonstrated the insertion of four separate nucleotides (a single T, a single C, and two separate As), which extended at the 5' end by 198 nt and altered the N-terminus. The inserted C (G on the opposite, coding strand) is the third nucleotide of the new ATG start codon. New: ATTATCATATGACCAATGGGTCACTTTTTTGATGAGACCCATGTTTATTCTTCTATACGT \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Previous: 21251 ATTATCATATGACCAATGGGTCACTTTTT-GATGAGACC-ATGTTTATTCTTCTATACGT 21308 New: TCGTGATACTGCACTTACGACTACCAGTAACATCAGAATAACCATAGAGC \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\| \|\|\|\|\|\|\|\|\| Previous: 21309 TCGTGATACTGCACTTACGACTACCAGTAACATCAGA-TA-CCATAGAGC 21356 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2004-01-21	YBR041W	320081	320082	Deletion	CC
	Kellis et al. 2003 and Brachat et al. 2003 independently predicted and confirmed the deletion of two C nucleotides from YBR041W. As a consequence of this change, YBR041W was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 623 to 669 amino acids. New: TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAA--TC \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\| Previous: 320025 TCTTATGCTATGCCCCTATTTGTTAAATTTGTTGATGAAATTAAAATGACAGATAACCTC 320084 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2004-01-20	YBR157C	553996	553996	Insertion		G
	Kellis et al. 2003 predicted and confirmed the insertion of a single G nt after the C at chromosomal coordinate 553996. As a consequence of this sequence change, YBR157C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 106 to 255 amino acids. New: TATGGAGGAATTTCTCCTCGTTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Previous: 553978 TATGGAGGAATTTCTCCTC-TTTTCACACCATCCTTGTCTCCAGGGAAAGAGTAGGTCTT 554036 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-01-09
YBR269C
742175	742175	Insertion		G
742165	742165	Insertion		G
	Kellis et al. 2003 predicted and confirmed the insertion of G after the G at chromosomal coordinate 742165, and the insertion of another G after the G at 742175. As a consequence of these sequence changes, YBR269C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 130 to 138 amino acids. This sequence change was incorporated at MIPS prior to SGD, and was verified in strain S288C. New: ACGAATAATCGCCGTGTCTCAACGGGTCCTGCTTGGGACCCCCAACTTCACCAGTCTTGG \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Previous: 742141 ACGAATAATCGCCGTGTCTCAACGG-TCCTGCTTGG-ACCCCCAACTTCACCAGTCTTGG *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2003-09-29
YBR074W, YBR075W
387625	387625	Deletion	G
387430	387430	Deletion	C
	Due to deletion of a C after the C at position 387430 and a deletion of G after the G at position 387625, YBR074W and YBR075W were merged. After merging YBR074W (386243 - 387484 (1-1242)) and YBR075W (387793 - 389175 (1-1383)), the coordinates of the merged ORF, YBR074W, are 386243 - 389173 (1 - 2931). YBR075W is now an alias of YBR074W. These sequence changes were verified in S288c strain by SGD. Query: 1141 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGAC-ACGCTTTCCTCT 1199 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| Sbjct: 387383 TCTCGTGATAGAATGACTTGGAAATCTTATTCATGGCTATCGTGGACCACGCTTTCCTCT 387442 Query: 1380 AAG-CCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 1438 \|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Sbjct: 387623 AAGGCCTATCAATTATCGAATTGTTCATTATTTTATGGACCATTTTACTTTTTACGTCGA 387682 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2003-01-03	YBR098W, YBR100W	442868	442868	Deletion	C
	Due to a change to the systematic sequence of chromosome II (C deletion at 442868), YBR098W and YBR100W have been merged to one single ORF of 691 aa. MMS4 is the standard name for the new, elongated ORF after merging; YBR100W and SLX2 are its aliases. The new coordinates of MMS4/YBR098W are 441473-443548, for a coding sequence of 2076 nt. We thank Jim Brown (james.brown@stanford.edu), and Kirk Ehmsen (ktehmsen@ucdavis.edu) for reporting this sequence error on Chr II, which was verified in the FY1679 (S288c derivative) strain background by SGD. Old: 442861 AGAAAACCGTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442920 \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 442861 AGAAAAC-GTTTTGATTCTATATTATGATGCGCAAGAATTTTTTGAACAATACACTTCAC 442919 *Xiao W, et al.* (1998)** Mms4, a putative transcriptional (co)activator, protects Saccharomyces cerevisiae cells from endogenous and environmental DNA damage. Mol Gen Genet 257(6):614-23 *Kaliraman V, et al.* (2001)** Functional overlap between Sgs1-Top3 and the Mms4-Mus81 endonuclease. Genes Dev 15(20):2730-40 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2003-01-02	YBR086C	422272	422273	Substitution	TA	AT
	We received a direct notification from MIPS about the following sequence changes; we did not have this change in SGD, so the sequence was edited: The T at 422272 was changed to an A, and the A at 422273 was changed to a T. These differences changed amino acid residue 243 of IST2/YBR086C from Tyr (TAC) -> Ile (ATC). The coordinates of YBR086C are not changed due to this sequence update. References: (1) Sequence verification in FY1679 (S288c derivative strain) background by SGD, (2) Personal communication from Anna Kurlandzka (ania218@poczta.ibb.waw.pl). Old: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGTAGAAAATT 422280 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| New: 422221 GTAGGCAAAAAAGACAAGATGGAAATCATTGGGCCGTTATAAATTTGCTTGATGAAAATT 422280
2001-05-29	YBL004W	234918	234918	Substitution	C	A
	A change was made to the systematic sequence of Chromosome II within the ORF UTP20/YBL004W. The C at chromosomal coordinate 234918 was changed to an A: Old: 234901 CAGACCGTATTAGAAAGCAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 234901 CAGACCGTATTAGAAAGAAGAAAGGAAAGGAGATCTAAAAGGGCAATTCTGGCTGTTAAC 234960
2001-05-29	YBL069W	91711	91711	Deletion	C
	A change was made to the systematic sequence of Chromosome II within the ORF AST1/YBL069W. The C at chromosomal coordinate 91711 was deleted, shifting the reading frame and moving the stop from 91722 to 92025: Old: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACCCACTGTAGGTGATTACGTTGCCAATTATAA 91740 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 91681 TTGATTCACGGCGGTGGTGCGTACGTAACC-ACTGTAGGTGATTACGTTGCCAATTATAA 91739
1999-04-26	YBR201W	623651	623651	Deletion	A
	A change was made to the systematic sequence of Chromosome II in the region upstream of the ORF DER1/YBR201W. The A at chromosomal coordinate 623651 was deleted. As a result, the start of YBR201W was moved upstream 210 nucleotides, increasing the size of the predicted protein from 141 to 211 amino acids. Old: 623640 GATCCAGGGAAAGGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623699 \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 623640 GATCCAGGGAA-GGTAGTGTACAGTTATGATTTAGTATTCAAAAAGGGACAATATGGAAG 623698
1999-04-26	YBR294W	791709	791709	Substitution	T	C
	A change was made to the systematic sequence of Chromosome II within the ORF SUL1/YBR294W. The T at chromosomal coordinate 791709 was changed to a C: Old: 791700 TATGTGCTGTAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759 \|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 791700 TATGTGCTGCAACTGGGACAAATTTACCGTTTTTTCATATCGATATACCCGATTTTTCTA 791759
1999-04-26
YBR069C, YBR070C
378815	378815	Deletion	C
378810	378810	Insertion		T
378824	378824	Insertion		C
	Three changes were made to the systematic sequence of Chromosome II in the intergenic region between the ORFs TAT1/YBR069C and ALG14/YBR070C. A single T was inserted after the T at chromosomal coordinate 378810, the C at 378815 was deleted, and a C was inserted after the G at 378824: Old: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTT-GGCCCGTCCCGGCG-GGCGAAGAGTGAGAC 378839 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\| \|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 378781 GCCGGCCCTGACTGACCTTTTTTGTATTTTTGGCC-GTCCCGGCGCGGCGAAGAGTGAGAC 378840
1999-04-26
YBR266C, YBR267W
739912	739912	Deletion	A
739866	739866	Deletion	G
	Two changes were made to the systematic sequence of Chromosome II within the ORF REI1/YBR267W. The G at chromosomal coordinate 739866 was deleted, and the A at 739912 was deleted; as a result, the start of YBR267W was moved 294 nt upstream. Note that the deletion at 739912 also affects the overlapping ORF SLM6/YBR266C; as a result, the stop of YBR266C was moved 111 nt upstream: Old: 739860 GAGCAGGCGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGAACGTGTTG 739919 \|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| New: 739860 GAGCAG-CGGGCCCACATGAAGTCCGATTGGCATCGCTACAATTTGAAAAGA-CGTGTTG 739917
1999-04-23	YBL066C	97484	97485	Substitution	TG	GC
	A change was made to the systematic sequence of Chromosome II within the ORF SEF1/YBL066C. The two nucleotides TG at positions 575 and 576 (chromosomal coordinates 97484-97485) were changed to GC, altering translation by changing amino acid 192 from Gln (CAA) to Ala (GCA). Note that this ORF is on the Crick strand. Old: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTTGCTGCTTTAAGGCATT 97500 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 97441 AGAACCGTCAGAATCTCCGTTATTTGTCTTGGCTAGCTTTTCTGCCTGCTTTAAGGCATT 97500 *Cherry JM, et al.* (1998)** "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
1999-04-23	YBL067C	94040	94040	Substitution	G	C
	A change was made to the systematic sequence of Chromosome II within the ORF UBP13/YBL067C. The G at chromosomal coordinate 94040 was changed to a C: Old: 94021 CATAATGGCCGTGTTGTGGGCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 94021 CATAATGGCCGTGTTGTGGCCCACCGCCCATATGAACGACAATCCCAGCCAATTCATACT 94080
1999-04-23
YBR006W
248539	248539	Substitution	A	T
248278	248278	Substitution	A	T
247367	247367	Substitution	C	T
247262	247262	Substitution	C	G
	Three single nucleotide (nt) substitutions were made to the systematic sequence of Chromosome II within the ORF UGA2/YBR006W, and one substitution was made in the adjacent intergenic region. The C at chromosomal coordinate 247262 was changed to a G, the C at 247367 was changed to a T, the A at 248278 was changed to a T (destroying the stop codon), and the A at 248539 was changed to a T. As a result, the stop was moved 186 nucleotides downstream, increasing the size of the coding sequence from 1308 nt to 1494 nt. Old: 247261 TCGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320 \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 247261 TGGCAACCATCATTACTTTAGAAAATGGTAAAGCTCTAGGGGAAGCTAAAGGAGAAATCA 247320 Old: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGCTTATATGGTGCTA 247380 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\| New: 247321 AATACGCGGCTTCGTATTTTGAGTGGTACGCCGAGGAAGCACCCCGTTTATATGGTGCTA 247380 AND Old: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTAAT 248280 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\| New: 248221 CTAATGATACTGAGTTTGGTTTAGCAGCATATGTCTTTTCTAAAAATGTCAACACTTTAT 248280 AND Old: 248521 GTATATATCTATTGCATGAATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 248521 GTATATATCTATTGCATGTATAAATACTCTACTCCTCGTATATAGAAAGTTAAGTAAATT 248580
1999-04-22	YBL033C	159114	159114	Substitution	C	G
	The C at chromosomal coordinate 159114 within the ORF RIB1/YBL033C was changed to a G, altering translation by changing amino acid 181 from Lys (AAG) to Asn (AAC). Note that this ORF is on the Crick strand: Old: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATCTTGCTT 159120 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| New: 159061 CGACCCTCTTGTCTTAGATACACGATAACACCATGGCCGTTTCCACCTTTGATGTTGCTT 159120 *Cherry JM, et al.* (1998)** "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America
1998-09-13
YBL101C
28296	28296	Insertion		C
28302	28302	Insertion		GG
28306	28306	Substitution	A	G
28272	28272	Insertion		G
25408	25408	Insertion		C
25394	25394	Deletion	T
	Six changes were made to the systematic sequence of Chromosome II within the ORF ECM21/YBL101C and in the adjacent intergenic region. Within the ORF, the T at chromosomal coordinate 25394 was deleted, and a single C was inserted after the C at 25408: Old: 25381 CGGCATCATCGCTTGTATCCGGATGGCC-ACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439 \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| New: 25381 CGGCATCATCGCT-GTATCCGGATGGCCCACTAACTGACGTAGTTCTTGATAAGTTCAAT 25439 Upstream of the ORF, a single G was inserted after the G at 28272, a single C was inserted after the C at 28296, two nucleotides (nt) GG were inserted after the G at 28302, and the A at 28306 was changed to a G: Old: 28260 TTTTTCGCCACCG-TCTTGATGTTATAAACGGCATGCC-AATAGG--TAGAGAAAAATCT 28315 \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\| New: 28260 TTTTTCGCCACCGGTCTTGATGTTATAAACGGCATGCCCAATAGGGGTAGGGAAAAATCT 28319 The start site of YBL101C was then moved upstream, extending the size of the coding region from 3234 nt to 3354 nt, and the size of the predicted protein from 728 amino acids (aa) to 754 aa.
1997-07-27	YBL103C	22603	22603	Insertion		G
	A single G was inserted after the G at chromosomal coordinate 22603 within the ORF RTG3/YBL103C, shifting the frame and extending the 3' end by 510 nucleotides: New: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTGGCCGAGTTCTTTTATCT 22620 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old: 22561 TACCTAGGTCATCGTAATTCAATAAAGATGGTGGAACCAACTG-CCGAGTTCTTTTATCT 22619
1997-07-27	YBL091C	48615	48615	Substitution	A	C
	The A at chromosomal coordinate 48615 (upstream of the Crick strand ORF MAP2/YBL091C at coordinates 48402-47353) was changed to a C, and the start site of YBL091C was then moved 216 nucleotides (nt) upstream to the newly-created start codon, extending the size of the coding sequence from 1050 nt to 1266 nt, the size of the predicted protein from 349 amino acids (aa) to 421 aa. Note that the sequence presented below is from the Watson strand: New: 48600 TATTTCAGCGTCTGTCATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659 \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old: 48600 TATTTCAGCGTCTGTAATTTTTCAATACGGTAGAGCTTCTACAGTACTTGTTGATGTAAA 48659

ANNOTATION CHANGES without sequence changes Jump to: Sequence changes

Date Affected Features
2009-05-07 YBR073W
The start site for RDH54/YBR073W was reinstated 102 nt (34 codons) upstream. This is a reversal of the start site change made to this ORF on 2003-09-22. Thank you to Nancy Hollingsworth for bringing this issue to our attention.
Shinohara M, et al. (1997) Characterization of the roles of the Saccharomyces cerevisiae RAD54 gene and a homologue of RAD54, RDH54/TID1, in mitosis and meiosis. Genetics 147(4):1545-56

Petukhova G, et al. (2000) Promotion of Rad51-dependent D-loop formation by yeast recombination factor Rdh54/Tid1. Genes Dev 14(17):2206-15

Chi P, et al. (2006) Yeast recombination factor Rdh54 functionally interacts with the Rad51 recombinase and catalyzes Rad51 removal from DNA. J Biol Chem 281(36):26268-79

Kwon Y, et al. (2008) ATP-dependent Chromatin Remodeling by the Saccharomyces cerevisiae Homologous Recombination Factor Rdh54. J Biol Chem 283(16):10445-52

2009-05-07 ARS212, ARS213, ARS221
The following ARS elements on Chromosome 2 were added to the genome annotation based on Raveendranathan et al. 2006: ARS212, ARS213, and ARS221.
Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39

2007-07-09 YBR215W
The start of ORF HPC2/YBR215W was moved 90 nt upstream and an intron was added at relative coordinates 14..97 based on GenBank EF123149 and Juneau et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 85%). The ORF had been annotated as 1872 nt long, but is now 1962 nt in length.
Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7

2007-04-05 YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19
The following Ty1 LTRs on Chromosome II were mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick); the error has now been corrected, so that the LTRs are annotated on the Crick strand: YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19.
2007-04-05 YBRCtau2
YBRWtau2, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBRCtau2 and is annotated on the Crick strand. The name YBRWtau2 is being retained as an alias.
2007-04-05 YBLCtau1
YBLWtau1, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBLCtau1 and is annotated on the Crick strand. The name YBLWtau1 is being retained as an alias.
2007-04-04 YBR089C-A
NHP6B/YBR089C-A mRNA contains an intron in the 5' untranslated region (UTR).
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7

2007-04-04 YBL092W
RPL32/YBL092W mRNA contains an intron in the 5' untranslated region (UTR).
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7

2007-04-04 YBL072C
RPS8A/YBL072C mRNA contains an intron in the 5' untranslated region (UTR).
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7

2006-10-04 LSR1
The start site and the stop site for LSR1/snR20 (aka U2 snRNA) were each moved 4 nt upstream, to the positions determined by Ares M. Jr. (1986). Thanks to Wayne Decatur for bringing this update to our attention.
Ares M Jr (1986) U2 RNA from yeast is unexpectedly large and contains homology to vertebrate U4, U5, and U6 small nuclear RNAs. Cell 47(1):49-59

2006-10-02 ARS230, ARS231
ARS230 (also known as ARS201.5) and ARS231 (also known as ARS207.5) were added to the genome annotation based on Nieduszynski et al. 2006.
Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9

2006-09-07 ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228
The following ARS elements on Chromosome II were added to SGD based on Nieduszynski et al. 2006: ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228.
Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9

2006-03-02 ARS209
This new ARS element ARS209 was added to the genome annotation based on Bouton & Smith 1986 and Wyrick et al. 2001.
Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60

Bouton AH and Smith MM (1986) Fine-structure analysis of the DNA sequence requirements for autonomous replication of Saccharomyces cerevisiae plasmids. Mol Cell Biol 6(7):2354-63

2005-11-10 snR161
New snoRNA, snR161, added based on the work of Olivas et al. 1997 and Schattner et al. 2004. Note that Olivas et al. refer to this snoRNA as RNA161.
Olivas WM, et al. (1997) Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25

Schattner P, et al. (2004) Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96

2005-11-08 YBR056C-B, YBR201C-A
Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that two new ORFs, YBR056C-B and YBR201C-A, be added to the S. cerevisiae genome annotation.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2005-11-07 YBR286W
After consultation with MIPS, SGD will incorporate the annotation change suggested by Kellis et al. 2003 for APE3/YBR286W. The start site is being moved 78 nt downstream from chromosomal coordinate 774618 to 774696, resulting in a predicted protein of 537 aa, as opposed to the previously annotated 563 aa. The 1692-nt ORF is now 1614 nt.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2004-10-12 CEN2
Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.
Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60

Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68

2004-04-01 RUF8
Feature annotation removed per John McCutcheon and Sean Eddy.
McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713

2004-04-01 YBR230W-A
ORF identified by John McCutcheon and Sean Eddy.
McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28

2004-01-07 YBL091C-A
Based on comparison to related fungi, Brachat et al., Blandin et al., and Cliften et al. all proposed an intron and 5' extension for YBL091C-A. The resulting ORF is in the same frame with the start codon shifted 316 bp upstream; the protein has a 76-residue extension at the N-terminus.
Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6

Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-12-17 YBR255C-A
The boundaries of the intron in ORF YBR255C-A were shifted by 1 bp on 5' end and 2 bp on 3' end on basis of conserved splice sites in other fungal species as predicted by Blandin et al. 2000.
Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6

2003-12-17 YBR111W-A
The size of the first intron of YBR111W-A was increased and a second intron was added on the basis of conserved splice sites predicted by Cliften et al. 2003, as well as subsequent experimental evidence (GenBank AY278445). The chromosomal coordinates of the coding sequence have changed from 462094-462172..462175-462392 to 462094-462164..462245-462384..462455-462534.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR073W
The start site for RDH54/YBR073W was moved 102 nt (34 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR095C
The start site for YBR095C was moved 69 nt (23 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBL068W
The start site for PRS4/YBL068W was moved 84 nt (28 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR172C
The start site for SMY2/YBR172C was moved 150 nt (50 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBL089W
The start site for AVT5/YBL089W was moved 150 nt (50 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR263W
The start site for SHM1/YBR263W was moved 225 nt (75 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR264C
The start site for YPT10/YBR264C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR122C
The start site for MRPL36/YBR122C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The predicted protein translated from the conserved methionine contains a predicted mitochondrial targeting signal sequence (using both MitoProt (MIPS) and Predotar), while the predicted protein translated from the previously annotated S. cerevisiae start codon does not.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR058C
The start site for UBP14/YBR058C was moved 66 nt (22 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YBR280C
The start site for YBR280C was moved 15 nt (5 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-09 TEL02L, TEL02L-XC, TEL02L-XR, TEL02L-YP, TEL02R, TEL02R-TR, TEL02R-XC, TEL02R-XR
The chromosomal locations for the following telomeric elements on Chromosome 2 were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL02L, TEL02L-XC, TEL02L-XR, TEL02L-YP, TEL02R, TEL02R-XC, TEL02R-XR, TEL02R-TR.
2003-07-29 YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following four ORFs on Chromosome 2: YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A.
Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51

Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20

2003-07-29 YBR056W-A, YBR109W-A, YBR126W-B
Thanks to MIPS for providing the coordinates of the following three ORFs on Chromosome 2: YBR056W-A, YBR109W-A, YBR126W-B.
2003-07-29 YBL006W-A, YBL071C-B, YBL100W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A
Thanks to Kumar et al. for providing the coordinates of the following 11 ORFs on Chromosome 2: YBL006W-A, YBL071C-B, YBL101W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A.
Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63

2003-07-29 YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A
Thanks to Kessler et al. for providing the coordinates of the following seven ORFs on Chromosome 2: YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A.
Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71

2003-07-29 YBL039W-B, YBR111W-A
Thanks to Brachat et al. for providing the coordinates of the following two ORFs on Chromosome 2 based on homology to Ashbya gossypii: YBL039W-B, YBR111W-A.
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

2003-03-06 RUF8
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.
McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28

2001-01-30 YBL071W-A
ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
2000-08-11 YBR089C-A
old name: YBR090C-A; new name: YBR089C-A; date: 11/1998; old coord: ChrII 426447 426148; SGDID: S0002157; Name changed due to nomenclature
2000-07-14 YBR186W
Davis et al. demonstrated an intron and 3' exon in PCH2/YBR186W that were not previously annotated. The addition of this intron and exon alters the C-terminus of the protein product and increases the protein size from 537 to 564 amino acids.
Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6

1999-11-17 YBL059C-A
A new ORF, YBL059C-A, was identified from EST analysis (Evan Hurowitz in Pat Brown's lab).

Date	Affected Features
2009-05-07	YBR073W
	The start site for RDH54/YBR073W was reinstated 102 nt (34 codons) upstream. This is a reversal of the start site change made to this ORF on 2003-09-22. Thank you to Nancy Hollingsworth for bringing this issue to our attention. *Shinohara M, et al.* (1997)** Characterization of the roles of the Saccharomyces cerevisiae RAD54 gene and a homologue of RAD54, RDH54/TID1, in mitosis and meiosis. Genetics 147(4):1545-56 *Petukhova G, et al.* (2000)** Promotion of Rad51-dependent D-loop formation by yeast recombination factor Rdh54/Tid1. Genes Dev 14(17):2206-15 *Chi P, et al.* (2006)** Yeast recombination factor Rdh54 functionally interacts with the Rad51 recombinase and catalyzes Rad51 removal from DNA. J Biol Chem 281(36):26268-79 *Kwon Y, et al.* (2008)** ATP-dependent Chromatin Remodeling by the Saccharomyces cerevisiae Homologous Recombination Factor Rdh54. J Biol Chem 283(16):10445-52
2009-05-07	ARS212, ARS213, ARS221
	The following ARS elements on Chromosome 2 were added to the genome annotation based on Raveendranathan et al. 2006: ARS212, ARS213, and ARS221. *Raveendranathan M, et al.* (2006)** Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
2007-07-09	YBR215W
	The start of ORF HPC2/YBR215W was moved 90 nt upstream and an intron was added at relative coordinates 14..97 based on GenBank EF123149 and Juneau et al. 2007. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 85%). The ORF had been annotated as 1872 nt long, but is now 1962 nt in length. *Juneau K, et al.* (2007)** High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2007-04-05	YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19
	The following Ty1 LTRs on Chromosome II were mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick); the error has now been corrected, so that the LTRs are annotated on the Crick strand: YBLCdelta7, YBRCdelta11, YBRCdelta14, YBRCdelta19.
2007-04-05	YBRCtau2
	YBRWtau2, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBRCtau2 and is annotated on the Crick strand. The name YBRWtau2 is being retained as an alias.
2007-04-05	YBLCtau1
	YBLWtau1, a Ty4 LTR on Chromosome II, was mistakenly annotated on the wrong strand (i.e., on Watson instead of Crick). Both the orientation and the feature name have been corrected, so that the LTR now has the systematic name YBLCtau1 and is annotated on the Crick strand. The name YBLWtau1 is being retained as an alias.
2007-04-04	YBR089C-A
	NHP6B/YBR089C-A mRNA contains an intron in the 5' untranslated region (UTR). *Miura F, et al.* (2006)** A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 *Juneau K, et al.* (2007)** High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2007-04-04	YBL092W
	RPL32/YBL092W mRNA contains an intron in the 5' untranslated region (UTR). *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 *Miura F, et al.* (2006)** A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 *Juneau K, et al.* (2007)** High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2007-04-04	YBL072C
	RPS8A/YBL072C mRNA contains an intron in the 5' untranslated region (UTR). *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 *Miura F, et al.* (2006)** A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 *Juneau K, et al.* (2007)** High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7
2006-10-04	LSR1
	The start site and the stop site for LSR1/snR20 (aka U2 snRNA) were each moved 4 nt upstream, to the positions determined by Ares M. Jr. (1986). Thanks to Wayne Decatur for bringing this update to our attention. Ares M Jr (1986) U2 RNA from yeast is unexpectedly large and contains homology to vertebrate U4, U5, and U6 small nuclear RNAs. Cell 47(1):49-59
2006-10-02	ARS230, ARS231
	ARS230 (also known as ARS201.5) and ARS231 (also known as ARS207.5) were added to the genome annotation based on Nieduszynski et al. 2006. *Nieduszynski CA, et al.* (2006)** Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-09-07	ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228
	The following ARS elements on Chromosome II were added to SGD based on Nieduszynski et al. 2006: ARS202, ARS207, ARS208, ARS211, ARS214, ARS215, ARS216, ARS220, ARS222, ARS224, ARS225, ARS228. *Nieduszynski CA, et al.* (2006)** Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-03-02	ARS209
	This new ARS element ARS209 was added to the genome annotation based on Bouton & Smith 1986 and Wyrick et al. 2001. *Wyrick JJ, et al.* (2001)** Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 Bouton AH and Smith MM (1986) Fine-structure analysis of the DNA sequence requirements for autonomous replication of Saccharomyces cerevisiae plasmids. Mol Cell Biol 6(7):2354-63
2005-11-10	snR161
	New snoRNA, snR161, added based on the work of Olivas et al. 1997 and Schattner et al. 2004. Note that Olivas et al. refer to this snoRNA as RNA161. *Olivas WM, et al.* (1997)** Analysis of the yeast genome: identification of new non-coding and small ORF-containing RNAs. Nucleic Acids Res 25(22):4619-25 *Schattner P, et al.* (2004)** Genome-wide searching for pseudouridylation guide snoRNAs: analysis of the Saccharomyces cerevisiae genome. Nucleic Acids Res 32(14):4281-96
2005-11-08	YBR056C-B, YBR201C-A
	Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that two new ORFs, YBR056C-B and YBR201C-A, be added to the S. cerevisiae genome annotation. *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2005-11-07	YBR286W
	After consultation with MIPS, SGD will incorporate the annotation change suggested by Kellis et al. 2003 for APE3/YBR286W. The start site is being moved 78 nt downstream from chromosomal coordinate 774618 to 774696, resulting in a predicted protein of 537 aa, as opposed to the previously annotated 563 aa. The 1692-nt ORF is now 1614 nt. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-10-12	CEN2
	Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. *Wieland G, et al.* (2001)** Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 *Espelin CW, et al.* (2003)** Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2004-04-01	RUF8
	Feature annotation removed per John McCutcheon and Sean Eddy. McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713
2004-04-01	YBR230W-A
	ORF identified by John McCutcheon and Sean Eddy. McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
2004-01-07	YBL091C-A
	Based on comparison to related fungi, Brachat et al., Blandin et al., and Cliften et al. all proposed an intron and 5' extension for YBL091C-A. The resulting ORF is in the same frame with the start codon shifted 316 bp upstream; the protein has a 76-residue extension at the N-terminus. *Blandin G, et al.* (2000)** Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-12-17	YBR255C-A
	The boundaries of the intron in ORF YBR255C-A were shifted by 1 bp on 5' end and 2 bp on 3' end on basis of conserved splice sites in other fungal species as predicted by Blandin et al. 2000. *Blandin G, et al.* (2000)** Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6
2003-12-17	YBR111W-A
	The size of the first intron of YBR111W-A was increased and a second intron was added on the basis of conserved splice sites predicted by Cliften et al. 2003, as well as subsequent experimental evidence (GenBank AY278445). The chromosomal coordinates of the coding sequence have changed from 462094-462172..462175-462392 to 462094-462164..462245-462384..462455-462534. *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR073W
	The start site for RDH54/YBR073W was moved 102 nt (34 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR095C
	The start site for YBR095C was moved 69 nt (23 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBL068W
	The start site for PRS4/YBL068W was moved 84 nt (28 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR172C
	The start site for SMY2/YBR172C was moved 150 nt (50 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBL089W
	The start site for AVT5/YBL089W was moved 150 nt (50 codons) downstream based on the automated comparison of closely related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR263W
	The start site for SHM1/YBR263W was moved 225 nt (75 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR264C
	The start site for YPT10/YBR264C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species by Kellis et al. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR122C
	The start site for MRPL36/YBR122C was moved 57 nt (19 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The predicted protein translated from the conserved methionine contains a predicted mitochondrial targeting signal sequence (using both MitoProt (MIPS) and Predotar), while the predicted protein translated from the previously annotated S. cerevisiae start codon does not. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR058C
	The start site for UBP14/YBR058C was moved 66 nt (22 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YBR280C
	The start site for YBR280C was moved 15 nt (5 codons) downstream based on the automated comparison of closely-related Saccharomyces species. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-09	TEL02L, TEL02L-XC, TEL02L-XR, TEL02L-YP, TEL02R, TEL02R-TR, TEL02R-XC, TEL02R-XR
	The chromosomal locations for the following telomeric elements on Chromosome 2 were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL02L, TEL02L-XC, TEL02L-XR, TEL02L-YP, TEL02R, TEL02R-XC, TEL02R-XR, TEL02R-TR.
2003-07-29	YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A
	Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following four ORFs on Chromosome 2: YBL039C-A, YBR121C-A, YBR196C-B, YBR221W-A. *Basrai MA, et al.* (1999)** NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 *Velculescu VE, et al.* (1997)** Characterization of the yeast transcriptome. Cell 88(2):243-51 *Oshiro G, et al.* (2002)** Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
2003-07-29	YBR056W-A, YBR109W-A, YBR126W-B
	Thanks to MIPS for providing the coordinates of the following three ORFs on Chromosome 2: YBR056W-A, YBR109W-A, YBR126W-B.
2003-07-29	YBL006W-A, YBL071C-B, YBL100W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A
	Thanks to Kumar et al. for providing the coordinates of the following 11 ORFs on Chromosome 2: YBL006W-A, YBL071C-B, YBL101W-C, YBL113W-A, YBR126W-A, YBR131C-A, YBR141W-A, YBR182C-A, YBR223W-A, YBR296C-A, YBR298C-A. *Kumar A, et al.* (2002)** An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
2003-07-29	YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A
	Thanks to Kessler et al. for providing the coordinates of the following seven ORFs on Chromosome 2: YBL008W-A, YBL068W-A, YBL103C-A, YBR072C-A, YBR076C-A, YBR196C-A, YBR200W-A. *Kessler MM, et al.* (2003)** Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
2003-07-29	YBL039W-B, YBR111W-A
	Thanks to Brachat et al. for providing the coordinates of the following two ORFs on Chromosome 2 based on homology to Ashbya gossypii: YBL039W-B, YBR111W-A. *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2003-03-06	RUF8
	Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
2001-01-30	YBL071W-A
	ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
2000-08-11	YBR089C-A
	old name: YBR090C-A; new name: YBR089C-A; date: 11/1998; old coord: ChrII 426447 426148; SGDID: S0002157; Name changed due to nomenclature
2000-07-14	YBR186W
	Davis et al. demonstrated an intron and 3' exon in PCH2/YBR186W that were not previously annotated. The addition of this intron and exon alters the C-terminus of the protein product and increases the protein size from 537 to 564 amino acids. *Davis CA, et al.* (2000)** Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6
1999-11-17	YBL059C-A
	A new ORF, YBL059C-A, was identified from EST analysis (Evan Hurowitz in Pat Brown's lab).

Jump to: Sequence Changes | Annotation Changes without Sequence Changes

Return to SGD

SGD^tm pages Database Copyright © 1997-2010 The Board of Trustees of Leland Stanford Junior University. Permission to use the information contained in this database was given by the researchers/institutes who contributed or published the information. Users of the database are solely responsible for compliance with any copyright restrictions, including those applying to the author abstracts. Documents from this server are provided "AS-IS" without any warranty, expressed or implied. The SGD project at Stanford University is supported by a Genome Research Resource Grant from the US National Human Genome Research Institute, part of the US National Institutes of Health.