Chromosome XVI History

Summary

Chromosome History

This page lists all sequence and annotation changes that have been made to the Chromosome XVI systematic reference sequence since its intial release on 1996-07-31.

The sequence of Chromosome XVI has been updated 5 times, affecting 3 features.
The annotation of Chromosome XVI has been updated 35 times, affecting 75 features.
Current and past versions can be obtained from SGD's FTP site.

SEQUENCE CHANGES, including any resulting annotation changes

Jump to: Annotation changes

Date Affected Features Start Coordinate
of Change End Coordinate
of Change Type of Change Old Sequence New Sequence
2004-07-21
YPL109C
347273 347273 Insertion T
347375 347375 Insertion T
347285 347285 Insertion A
347265 347265 Deletion T
The works of Kellis et al. 2003 and Cliften et al. 2003 predicted multiple insertions and deletions in YPL109C, and the sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YPL109C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 590 to 657 amino acids.
New: TGTTTTGGAAACGAATTTT-GTGTCAAATAAAAAGCAATTGACGTAGGTATTATGAACTG ||||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||| Old: 347246 TGTTTTGGAAACGAATTTTTGTGTCAAA-AAAAAGCAATTG-CGTAGGTATTATGAACTG 347303
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-29 YPR089W, YPR090W 713683 713683 Deletion T
Due to deletion of a T at position 713683, YPR089W and YPR090W were merged. After merging YPR089W (713271 - 713738 (1-468)) and YPR090W (713728 - 715938 (1-2211)), the coordinates of the merged ORF, YPR089W, are 713271 - 715937 (1-2667). YPR090W is now an alias of YPR089W.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence
2004-07-21
YPL109C
347273	347273	Insertion		T
347375	347375	Insertion		T
347285	347285	Insertion		A
347265	347265	Deletion	T
	The works of Kellis et al. 2003 and Cliften et al. 2003 predicted multiple insertions and deletions in YPL109C, and the sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YPL109C was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 590 to 657 amino acids. New: TGTTTTGGAAACGAATTTT-GTGTCAAATAAAAAGCAATTGACGTAGGTATTATGAACTG \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| Old: 347246 TGTTTTGGAAACGAATTTTTGTGTCAAA-AAAAAGCAATTG-CGTAGGTATTATGAACTG 347303 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-29	YPR089W, YPR090W	713683	713683	Deletion	T
	Due to deletion of a T at position 713683, YPR089W and YPR090W were merged. After merging YPR089W (713271 - 713738 (1-468)) and YPR090W (713728 - 715938 (1-2211)), the coordinates of the merged ORF, YPR089W, are 713271 - 715937 (1-2667). YPR090W is now an alias of YPR089W. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

ANNOTATION CHANGES without sequence changes Jump to: Sequence changes

Date Affected Features
2009-05-08 ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, ARS1632
The following ARS elements on Chromosome 16 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, and ARS1632.
Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39

2007-07-10 YPR153W
The start of ORF YPR153W was moved 122 nt upstream and an intron was added at relative coordinates 6..139 based on GenBank EF123126, Juneau et al. 2007, Zhang et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 50%). The ORF had been annotated as 435 nt long (144 aa), but is now 557 nt long with a 134-nt intron (140 aa).
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51

Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7

Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9

2007-05-09 YPR010C-A
YPR010C-A added as a new ORF on ChrXVI between tRNA-Lys and YPR011C. Contains an intron and is conserved among all the Saccharomyces sensu stricto species. Ken Wolfe's lab found a conserved homolog in Kluyveromyces polysporus, without an intron.
Note: Miura et al. refer to this as "transcription unit no. 633".
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51

2007-05-09 snR70
Updated coordinates of snR70 based on GenBank AF064282. Removed 1 nt from 5' end.
2007-04-04 YPL230W
YPL230W mRNA contains an intron in the 5' untranslated region (UTR).
Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51

2006-10-04 ARS1633, ARS1634, ARS1635
The following ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1633/1620.5, ARS1634/1622.5, ARS1635/1626.5.
Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9

2006-09-08 ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631
The following new ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631.
Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9

2006-05-09 CEN16
The previously annotated 3' boundary of CEN16 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.
Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60

Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68

2005-12-14 YPL052W, YPL052W-A
Palanimurugan et al. 2004 have shown that the translation start site of OAZ1/YPL052W is located at chromosomal coordinate 458796, 274 bp upstream from the originally annotated start site. This change results in a merge of upstream ORF YPL052W-A into OAZ1/YPL052W. The full translation product is generated by translational frameshifting to skip the first base of what was previously annotated as the stop codon of YPL052W-A.
Palanimurugan R, et al. (2004) Polyamines regulate their synthesis by inducing expression and blocking degradation of ODC antizyme. EMBO J 23(24):4857-67

2005-12-13 YPL052W-A
Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPL052W-A, be added to the S. cerevisiae genome annotation.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2005-12-01 YPR169W
The work of Zhang & Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of YPR169W be moved 66 nt downstream from 878620 to 878686. This annotation change results in a predicted protein of 492 aa, as opposed to the previously annotated 514 aa.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51

2005-11-21 YPR145C-A
Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPR145C-A, be added to the S. cerevisiae genome annotation.
Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2004-10-12 CEN16
Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.
Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60

Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68

2004-04-01 RUF6
Feature annotation removed per John McCutcheon and Sean Eddy.
McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713

2004-01-09 YPL094C
Start moved 27 bp downstream; protein is actually 274 aa rather than the previously annotated 283 aa. This is an annotation change only; no sequence change. See Willer et al. This change was also suggested by Kellis et al. based on the automated comparison of closely related Saccharomyces species.
Willer M, et al. (2003) Identification of novel protein-protein interactions at the cytosolic surface of the Sec63 complex in the yeast ER membrane. Yeast 20(2):133-48

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

2003-09-27 YPR098C
Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YPR098C. The resulting ORF is in the same frame, but has a 53-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-27 YPL109C
Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 3' exon for YPL109C. The resulting ORF is 47 residues longer and has an altered C-terminus. This proposal was reviewed and accepted by SGD curators.
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YPR085C
The automated comparison of closely related Saccharomyces species suggests that the start site for YPR085C be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YPR175W
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for DPB2/YPR175W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 888960 is not conserved in S. paradoxus, S. mikatae, and S. bayanus.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YPR047W
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MSF1/YPR047W be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This protein is predicted to have a function in mitochondria and using the new 5' coordinate in prediction programs (MITOP and Predator) still results in a strong prediction that Msf1p will be targeted to the mitochondria.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YPL210C
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SRP72/YPL210C be moved 18 nt (6 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 156229 is not conserved in the other Saccharomyces species; 4) Protein sequence comparisons against the nr dataset show that sequence similarity begins after 156211 between S. cerevisiae YPL210C and related proteins.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YPL270W
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MDL2/YPL270W be moved 141 nt (47 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although a corresponding ATG is found at the original start (30341) in S. paradoxus, S. mikatae, and S. bayanus, there are indels between this ATG and the predicted start site which lead to frameshifts in the predicted mRNAs in non S. cerevisiae sequences. 4) the protein is found in mitochondria (Young et al.) and the MITPROT prediction program predicts a signal cleavage site for the new shorter protein suggesting this protein would be targeted to the mitochondria. In contrast, mitochondrial targeting is not predicted with the protein's original start at 30341.
Young L, et al. (2001) Role of the ABC transporter Mdl1 in peptide export from mitochondria. Science 291(5511):2135-8

Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YPR093C
The automated comparison of closely related Saccharomyces species suggests that the start site for YPR093C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-22 YPL148C
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PPT2/YPL148C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al. 2) Significant sequence conservation begins abruptly at this predicted start methionine.
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-09-09 TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, TEL16R-YP
The chromosomal locations for TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, and TEL16R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2003-07-29 YPL119C-A, YPR160W-A, YPR170W-A
Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR170W-A, YPL119C-A and YPR160W-A.
Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9

Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51

Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20

2003-07-29 YPL135C-A, YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A
Thanks to Kumar et al. for providing the coordinates of the following Chromosome XVI ORFs: YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A, and YPL135C-A.
Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63

2003-07-29 YPL038W-A, YPL250W-A, YPR108W-A, YPR169W-A
Thanks to Kessler et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR169W-A, YPR108W-A, YPL038W-A, and YPL250W-A.
Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71

2003-07-29 YPL189C-A
Thanks to Brachat et al. for providing the coordinates of YPL189C-A.
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

2003-07-29 YPR170W-B
Thanks to Brachat et al and Cliften et al. for providing the coordinates of YPR170W-B.
Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45

Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6

2003-05-23 YPR131C
The start site of NAT3/YPR131C has been moved 168 nt downstream from 794661 to 794493 based on experimental evidence as well as sequence comparisons in other species published by Polevoda et al. Also, the downstream ATG codon is clearly conserved in the closely related sensu stricto Saccharomyces species.
Polevoda B, et al. (2003) Nat3p and Mdm20p are required for function of yeast NatB Nalpha-terminal acetyltransferase and of actin and tropomyosin. J Biol Chem 278(33):30686-97

2003-03-06 RUF6
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.
McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28

2002-07-25 YPR036W-A
Based on the work of Miura et al. (2001), the new ORF YPR036W-A was added to Chromosome XV.
Miura F, et al. (2001) Differential display analysis of mutants for the transcription factor Pdr1p regulating multidrug resistance in the budding yeast. FEBS Lett 505(1):103-8

1999-07-17 YPR111W
The intron in ORF YPR111W was removed. The start, stop, and frame were left as is, so that the sequence that was previously annotated as the intron is now part of the translation. The chromosomal coordinates of the coding region change from 747303-747593..748014-748997 to 747303-748997. The relative coordinates of the coding region change from 1-291..712-1695 to 1-1695.
1997-10-20 YPL075W
Edition 14: The GCR1 gene was modified in October 1997 to include an intron reported by Tornow and Santangelo (1994).
Tornow J and Santangelo G (1994) The GCR1 gene of Saccharomyces cerevisiae is a split gene with an unusually long intron. Genetics 138(3):973-4

Cherry JM, et al. (1997) Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73

Date	Affected Features
2009-05-08	ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, ARS1632
	The following ARS elements on Chromosome 16 were added to the genome annotation based on Raveendranathan et al. 2006: ARS1603, ARS1608, ARS1611, ARS1612, ARS1617, ARS1620, ARS1629, and ARS1632. *Raveendranathan M, et al.* (2006)** Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39
2007-07-10	YPR153W
	The start of ORF YPR153W was moved 122 nt upstream and an intron was added at relative coordinates 6..139 based on GenBank EF123126, Juneau et al. 2007, Zhang et al. 2007, and Miura et al. 2006. According to Juneau et al. 2007, the intron is "inefficiently spliced" (splicing rate 50%). The ORF had been annotated as 435 nt long (144 aa), but is now 557 nt long with a 134-nt intron (140 aa). *Miura F, et al.* (2006)** A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 *Juneau K, et al.* (2007)** High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 *Zhang Z, et al.* (2007)** Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9
2007-05-09	YPR010C-A
	YPR010C-A added as a new ORF on ChrXVI between tRNA-Lys and YPR011C. Contains an intron and is conserved among all the Saccharomyces sensu stricto species. Ken Wolfe's lab found a conserved homolog in Kluyveromyces polysporus, without an intron. Note: Miura et al. refer to this as "transcription unit no. 633". *Miura F, et al.* (2006)** A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
2007-05-09	snR70
	Updated coordinates of snR70 based on GenBank AF064282. Removed 1 nt from 5' end.
2007-04-04	YPL230W
	YPL230W mRNA contains an intron in the 5' untranslated region (UTR). *Miura F, et al.* (2006)** A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51
2006-10-04	ARS1633, ARS1634, ARS1635
	The following ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1633/1620.5, ARS1634/1622.5, ARS1635/1626.5. *Nieduszynski CA, et al.* (2006)** Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-09-08	ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631
	The following new ARS elements on Chromosome XVI were added to SGD based on Nieduszynski et al. 2006: ARS1604, ARS1605, ARS1607, ARS1614, ARS1618, ARS1619, ARS1621, ARS1622, ARS1623, ARS1624, ARS1625, ARS1626, ARS1627, ARS1628, ARS1630, ARS1631. *Nieduszynski CA, et al.* (2006)** Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-05-09	CEN16
	The previously annotated 3' boundary of CEN16 was moved 1 bp upstream to coincide with the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. *Wieland G, et al.* (2001)** Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 *Espelin CW, et al.* (2003)** Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2005-12-14	YPL052W, YPL052W-A
	Palanimurugan et al. 2004 have shown that the translation start site of OAZ1/YPL052W is located at chromosomal coordinate 458796, 274 bp upstream from the originally annotated start site. This change results in a merge of upstream ORF YPL052W-A into OAZ1/YPL052W. The full translation product is generated by translational frameshifting to skip the first base of what was previously annotated as the stop codon of YPL052W-A. *Palanimurugan R, et al.* (2004)** Polyamines regulate their synthesis by inducing expression and blocking degradation of ODC antizyme. EMBO J 23(24):4857-67
2005-12-13	YPL052W-A
	Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPL052W-A, be added to the S. cerevisiae genome annotation. *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2005-12-01	YPR169W
	The work of Zhang & Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of YPR169W be moved 66 nt downstream from 878620 to 878686. This annotation change results in a predicted protein of 492 aa, as opposed to the previously annotated 514 aa. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51
2005-11-21	YPR145C-A
	Based on comparisons of the genome sequences of six Saccharomyces species, Cliften et al. 2003 suggested that this new ORF, YPR145C-A, be added to the S. cerevisiae genome annotation. *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2004-10-12	CEN16
	Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. *Wieland G, et al.* (2001)** Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 *Espelin CW, et al.* (2003)** Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2004-04-01	RUF6
	Feature annotation removed per John McCutcheon and Sean Eddy. McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713
2004-01-09	YPL094C
	Start moved 27 bp downstream; protein is actually 274 aa rather than the previously annotated 283 aa. This is an annotation change only; no sequence change. See Willer et al. This change was also suggested by Kellis et al. based on the automated comparison of closely related Saccharomyces species. *Willer M, et al.* (2003)** Identification of novel protein-protein interactions at the cytosolic surface of the Sec63 complex in the yeast ER membrane. Yeast 20(2):133-48 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2003-09-27	YPR098C
	Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for YPR098C. The resulting ORF is in the same frame, but has a 53-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators. *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-27	YPL109C
	Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 3' exon for YPL109C. The resulting ORF is 47 residues longer and has an altered C-terminus. This proposal was reviewed and accepted by SGD curators. *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YPR085C
	The automated comparison of closely related Saccharomyces species suggests that the start site for YPR085C be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YPR175W
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for DPB2/YPR175W be moved 9 nt (3 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 888960 is not conserved in S. paradoxus, S. mikatae, and S. bayanus. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YPR047W
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MSF1/YPR047W be moved 15 nt (5 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) This protein is predicted to have a function in mitochondria and using the new 5' coordinate in prediction programs (MITOP and Predator) still results in a strong prediction that Msf1p will be targeted to the mitochondria. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YPL210C
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for SRP72/YPL210C be moved 18 nt (6 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG at 156229 is not conserved in the other Saccharomyces species; 4) Protein sequence comparisons against the nr dataset show that sequence similarity begins after 156211 between S. cerevisiae YPL210C and related proteins. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YPL270W
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MDL2/YPL270W be moved 141 nt (47 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although a corresponding ATG is found at the original start (30341) in S. paradoxus, S. mikatae, and S. bayanus, there are indels between this ATG and the predicted start site which lead to frameshifts in the predicted mRNAs in non S. cerevisiae sequences. 4) the protein is found in mitochondria (Young et al.) and the MITPROT prediction program predicts a signal cleavage site for the new shorter protein suggesting this protein would be targeted to the mitochondria. In contrast, mitochondrial targeting is not predicted with the protein's original start at 30341. *Young L, et al.* (2001)** Role of the ABC transporter Mdl1 in peptide export from mitochondria. Science 291(5511):2135-8 *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YPR093C
	The automated comparison of closely related Saccharomyces species suggests that the start site for YPR093C be moved 66 nt (22 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YPL148C
	Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PPT2/YPL148C be moved 12 nt (4 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al. 2) Significant sequence conservation begins abruptly at this predicted start methionine. *Kellis M, et al.* (2003)** Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-09	TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, TEL16R-YP
	The chromosomal locations for TEL16L, TEL16L-XC, TEL16L-XR, TEL16L-YP, TEL16R, TEL16R-XC, and TEL16R-YP were generously provided by Ed Louis and Dave Barton (University of Leicester, UK).
2003-07-29	YPL119C-A, YPR160W-A, YPR170W-A
	Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR170W-A, YPL119C-A and YPR160W-A. *Basrai MA, et al.* (1999)** NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 *Velculescu VE, et al.* (1997)** Characterization of the yeast transcriptome. Cell 88(2):243-51 *Oshiro G, et al.* (2002)** Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
2003-07-29	YPL135C-A, YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A
	Thanks to Kumar et al. for providing the coordinates of the following Chromosome XVI ORFs: YPL152W-A, YPL222C-A, YPL283W-A, YPL283W-B, YPR159C-A, YPR160C-A, YPR204C-A, and YPL135C-A. *Kumar A, et al.* (2002)** An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
2003-07-29	YPL038W-A, YPL250W-A, YPR108W-A, YPR169W-A
	Thanks to Kessler et al. for providing the coordinates of the following Chromosome XVI ORFs: YPR169W-A, YPR108W-A, YPL038W-A, and YPL250W-A. *Kessler MM, et al.* (2003)** Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
2003-07-29	YPL189C-A
	Thanks to Brachat et al. for providing the coordinates of YPL189C-A. *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2003-07-29	YPR170W-B
	Thanks to Brachat et al and Cliften et al. for providing the coordinates of YPR170W-B. *Brachat S, et al.* (2003)** Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 *Cliften P, et al.* (2003)** Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-05-23	YPR131C
	The start site of NAT3/YPR131C has been moved 168 nt downstream from 794661 to 794493 based on experimental evidence as well as sequence comparisons in other species published by Polevoda et al. Also, the downstream ATG codon is clearly conserved in the closely related sensu stricto Saccharomyces species. *Polevoda B, et al.* (2003)** Nat3p and Mdm20p are required for function of yeast NatB Nalpha-terminal acetyltransferase and of actin and tropomyosin. J Biol Chem 278(33):30686-97
2003-03-06	RUF6
	Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8. McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28
2002-07-25	YPR036W-A
	Based on the work of Miura et al. (2001), the new ORF YPR036W-A was added to Chromosome XV. *Miura F, et al.* (2001)** Differential display analysis of mutants for the transcription factor Pdr1p regulating multidrug resistance in the budding yeast. FEBS Lett 505(1):103-8
1999-07-17	YPR111W
	The intron in ORF YPR111W was removed. The start, stop, and frame were left as is, so that the sequence that was previously annotated as the intron is now part of the translation. The chromosomal coordinates of the coding region change from 747303-747593..748014-748997 to 747303-748997. The relative coordinates of the coding region change from 1-291..712-1695 to 1-1695.
1997-10-20	YPL075W
	Edition 14: The GCR1 gene was modified in October 1997 to include an intron reported by Tornow and Santangelo (1994). Tornow J and Santangelo G (1994) The GCR1 gene of Saccharomyces cerevisiae is a split gene with an unusually long intron. Genetics 138(3):973-4 *Cherry JM, et al.* (1997)** Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl):67-73

Jump to: Sequence Changes | Annotation Changes without Sequence Changes

Return to SGD

SGD^tm pages Database Copyright © 1997-2010 The Board of Trustees of Leland Stanford Junior University. Permission to use the information contained in this database was given by the researchers/institutes who contributed or published the information. Users of the database are solely responsible for compliance with any copyright restrictions, including those applying to the author abstracts. Documents from this server are provided "AS-IS" without any warranty, expressed or implied. The SGD project at Stanford University is supported by a Genome Research Resource Grant from the US National Human Genome Research Institute, part of the US National Institutes of Health.