- Site Map |
- Search Options |
- Help |
- Home |
| 
Chromosome XIV History |
|
| |||||||
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
Date  | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2010-01-05 | ||||||
| YNL083W | ||||||
| 472585 | 472585 | Substitution | C | GG | ||
| 472581 | 472581 | Substitution | T | G | ||
| SAL1 contains a frameshift mutation (the sal1-1 allele) in certain laboratory strains, including S288C. The sal1-1 frameshift mutation results in the encoding of missense amino acids starting with the 403rd codon, and truncates the protein to 494 amino acids from its "wild-type" length in other strains of 545 amino acids. The annotation of SAL1 was altered in SGD in February 2004 away from the sal1-1 allele after sequence comparisons to related fungi (Belenkiy et al. 2000; Brachat et al. 2003). Dimitrov et al. (2009) sequenced the SAL1 gene from strains BY4716 and S288C, and discovered that these strains do both indeed contain the sal1-1 allele despite the previous annotation change in SGD. The correct annotation of SAL1 has now been reinstated in SGD. Chen XJ (2004) Sal1p, a calcium-dependent carrier protein that suppresses an essential cellular function associated With the Aac2 isoform of ADP/ATP translocase in Saccharomyces cerevisiae. Genetics 167(2):607-17   Smith CP and Thorsness PE (2008) The Molecular Basis for Relative Physiological Functionality of the ADP/ATP Carrier Isoforms in Saccharomyces cerevisiae. Genetics 179(3):1285-99 Dimitrov LN, et al. (2009) Polymorphisms in multiple genes contribute to the spontaneous mitochondrial genome instability of Saccharomyces cerevisiae S288C strains. Genetics 183(1):365-83 | ||||||
| 2006-11-09 | ||||||
| YNL103W | ||||||
| 429057 | 429058 | Substitution | CG | GC | ||
| 429061 | 429061 | Substitution | G | C | ||
The systematic sequence is being updated within the ORF YNL103W with the following three transversions: C to G at chromosomal coordinate 429057, G to C at 429058, and G to C at 429061. These are nucleotide positions 1321, 1322, and 1325 within ORF YNL103W, changing amino acids 441 and 442 from Arg-Gly to Ala-Ala. Thanks to Phil Robinson in Roger Kornberg's lab for alerting SGD to these sequencing errors.
New: 1311 GGCTGAAACTGCTGCGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 1380
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old: 429047 GGCTGAAACTCGTGGGCCAACTACCTTATCAACGTCGCCTTCGTTCAATGAGCACGGTGTAGTAGCAGAG 429116 | ||||||
| 2005-11-07 | YNL304W | 60402 | 60402 | Insertion | C | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. and Cliften et al. suggested that the start site for YPT11/YNL304W be moved 185 nt upstream. This change required a sequencing error in the reference strain. SGD confirmed a sequencing error in this position, and the systematic sequence has been updated accordingly. As a consequence of this sequence change, YPT11/YN304W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 355 to 417 amino acids.
New: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTGCTTCGCCAGCGAGTGCTGCATCTT 60426
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old: 60367 CACCGATACGGACTAACGAATCCAATTGGGAAGCTG-TTCGCCAGCGAGTGCTGCATCTT 60425
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54  Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | ||||||
| 2005-11-03 | YNL299W | 68349 | 68349 | Insertion | C | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the stop site for TRF5/YNL299W be moved 50 nt downstream. The insertion of a single C nt was confirmed in S. cerevisiae strains BMA38, BY4741, LMA210 (Jon Houseley, personal communication) and S288C (SGD). The systematic sequence has been updated accordingly. As a consequence of this sequence change, TRF5/YNL299W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 625 to 642 amino acids.
New: 68328 GATCAAAAAGGAAGAGATACCCCTTCGGGACAAGATGAGAAATCACCACTGGAAACT 68384
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old: 68328 GATCAAAAAGGAAGAGATACCC-TTCGGGACAAGATGAGAAATCACCACTGGAAACT 68383
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2004-07-22 | YNL064C, YNL065W | 505515 | 505515 | Insertion | C | |
The work of Kellis et al. proposed an indel that would shorten the YNL065W reading frame. Sequencing of S288C by SGD confirmed the current sequence for YNL065W, but an error in the intergenic region between YNL065W and YNL064C was identified. This insertion does not affect any coding features. New: ATTAATTGGCATTCTTCAATTTGATAGACACTTATCCCTGCATATTTTTTTTATAAACAGKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2004-02-19 | ||||||
| YNL208W | ||||||
| 254767 | 254767 | Insertion | G | |||
| 254927 | 254927 | Insertion | G | |||
Kellis et al. predicted and confirmed the insertion of two nucleotides. As a consequence of this sequence change, YNL208W was shortened at the 3' end, altering the C-terminus and decreasing the predicted protein from 204 to 199 amino acids.New: AAGGTGGACACAACAACCATCACCGTCAGGACAATAACAACAATAACGGTGGATTTGGCG
New: AAGGATTCGGTGGTCCAAATCCTCAAGAATTCGGCGGGCCAGGTGGCCAAGGATTCGGTGKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2004-02-18 | ||||||
| YNL083W | ||||||
| 472581 | 472581 | Deletion | G | |||
| 472580 | 472580 | Substitution | G | C | ||
| 472576 | 472576 | Substitution | G | T | ||
| 471764 | 471764 | Substitution | G | A | ||
Brachat et al. 2003 predicted the extension of the 3' end of YNL083W based on the automated comparison of related fungi. Belenkiy et al. 2000 had previously confirmed the sequence change in strain CG379. The sequence is available in GenBank (accession number AF419344). As a consequence, YNL083W was extended in the 3' end, increasing the size of the predicted protein from 494 amino acids to 545 amino acids. This C-terminal extension is also conserved in S. bayanus, S. mikatae, S. paradoxus, and S. kluyveri.New: GAACTTAATCATGAACTTTCAAATGAAAAGATGAACAAATTCTCGAGGTTTTTTGAATGG
New: GTGGGC-TCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA
| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 472574 GGGGGGGTCAGATTATTTTACAGAGGTGTCACAGTCGGTATAGTGGGCATATTTCCCTA 472633Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2004-02-18 | YNL195C | 271649 | 271649 | Insertion | G | |
Kellis et al. predicted and confirmed the insertion of a single G nt. As a consequence of this sequence change, YNL195C was extended at the 3' end, altering the C-terminus and increasing the predicted protein from 243 to 261 amino acids.New: TTGTGCCGATCACCCACACCGTAGGCGTAGGTTTCCTTTTCCTCAGTTTCCTGATTGAATKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 1998-11-10 | YNL180C | 299726 | 299727 | Deletion | AT | |
| An AT dinucleotide at chromosomal coordinates 299726-299727 within YNL180C was removed. This corresponds to relative coordinates 171-172, and causes a frameshift. The protein is now annotated as 331 amino acids in length.
Old: 299701 TTGGTTTAGCTTGCTTGTTGTGATGATATTATTTGAGGCAATTTTACTACCTTTGCTTTT 299760
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
New: 299701 TTGGTTTAGCTTGCTTGTTGTGATGAT--TATTTGAGGCAATTTTACTACCTTTGCTTTT 299758 | ||||||
| 1997-07-27 | YNL059C, YNL061W | 512412 | 512412 | Insertion | G | |
A single G was inserted after the G at 512412 in the intergenic region between NOP2/YNL061W and ARP5/YNL059C.
New: 512401 ACAAACGTAGTGGCATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512460
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old: 512401 ACAAACGTAGTG-CATCATGTTAGCATAGTTTTCTCTCTCTAATCTTTCTCTGTCTACAT 512459 | ||||||
| 1997-07-27 | YNL051W, YNL052W | 532300 | 532300 | Insertion | G | |
A single G was inserted after the G at 532300 in the intergenic region between COX5A/YNL052W and COG5/YNL051W.
New: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGGGCATCCGCCCAATACAATG 532319
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Old: 532260 ACGAAAGTGAATATCTTATTACATTATAAGTGTATCCATGG-CATCCGCCCAATACAATG 532318 | ||||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2009-05-06 | ARS1409, ARS1410, ARS1416, ARS1423, ARS1425 |
| The following ARS elements on Chromosome XIV were added to the genome annotation based on Raveendranathan et al. 2006: ARS1409, ARS1410, ARS1416, ARS1423, and ARS1425.Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 | |
| 2007-09-06 | YNL147W |
The 3' end of the intron within LSM7/YNL147W was moved 24 nt upstream, from chromosomal coordinate 351079 to 351055, based on Miura et al. 2006.Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51  | |
| 2007-07-09 | YNL004W |
| The start of ORF HRB1/YNL004W was moved 417 nt upstream and an intron was added at relative coordinates 31..372 based on GenBank EF123128, Juneau et al. 2007, and Zhang et al. 2007. The ORF had been annotated as 1290 nt long, but is now 1707 nt in length.Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 Zhang Z, et al. (2007) Genome-wide identification of spliced introns using a tiling microarray. Genome Res 17(4):503-9 | |
| 2007-04-04 | YNL066W |
| SUN4/YNL066W mRNA contains an intron in the 5' untranslated region (UTR).Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 | |
| 2006-09-07 | ARS1405, ARS1406, ARS1407, ARS1415, ARS1417, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427 |
| The following new ARS elements on Chromosome XIV were added to SGD based on Nieduszynski et al. 2006: ARS1405, ARS1406, ARS1407, ARS1415, ARS1417, ARS1419, ARS1420, ARS1421, ARS1422, ARS1424, ARS1426, ARS1427.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 | |
| 2006-09-07 | ARS1411, ARS1412, ARS1414 |
| The coordinates of the following ARS elements on Chromosome XIV were updated based on Nieduszynski et al. 2006: ARS1411, ARS1412, ARS1414.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 | |
| 2006-05-10 | YNL310C |
| The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for ZIM17/YNL310C be moved 93 nt (31 amino acids) downstream.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2006-05-10 | YNL202W |
| The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for SPS19/YNL202W was moved 9 nt (3 amino acids) downstream.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2004-10-18 | ARS1411, ARS1412, ARS1413, ARS1414 |
| ARS1411, ARS1412, ARS1413, and ARS1414 were added to SGD based on Friedman et al., and Raghuraman et al.Friedman KL, et al. (1996) Multiple determinants controlling activation of yeast replication origins late in S phase. Genes Dev 10(13):1595-607 Raghuraman MK, et al. (2001) Replication dynamics of the yeast genome. Science 294(5540):115-21 | |
| 2004-10-12 | CEN14 |
| The coordinates of this centromere were updated to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. 2001, and Espelin et al. 2003.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 | |
| 2004-04-21 | YNL082W |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PMS1/YNL082W be moved 93 nt downstream. This suggestion was reviewed by SGD curators and incorporated. Evidence supporting this change includes: 1) This is the predicted start methionine in S. bayanus, S. paradoxus and S. mikatae; 2) The proposed start methionine is conserved in the S. kluyveri, S. castellii, and S. kudriavzevii sequences published by Cliften et al. 3) DNA sequence conservation begins abruptly at this ATG.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2004-02-04 | snR19 |
| Start moved 100 bp downstream from 230771 to 230671. See GenBank M17205, Z71497, and Z71498. | |
| 2004-02-03 | YNL130C |
| Start moved 328 bp downstream based on sequence conservation in other Saccharomyces species. In addition, the 5' splice site for the existing intron moved 349 bp downstream. There is no change to Exon 2.Hjelmstad RH and Bell RM (1990) The sn-1,2-diacylglycerol cholinephosphotransferase of Saccharomyces cerevisiae. Nucleotide sequence, transcriptional mapping, and gene product analysis of the CPT1 gene. J Biol Chem 265(3):1755-64 Hjelmstad RH and Bell RM (1991) sn-1,2-diacylglycerol choline- and ethanolaminephosphotransferases in Saccharomyces cerevisiae. Mixed micellar analysis of the CPT1 and EPT1 gene products. J Biol Chem 266(7):4357-65 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | |
| 2003-09-27 | YNL038W |
| Based on the alignment of orthologs in related Saccharomyces species, Cliften et al. proposed an intron and new 3' exon for GPI15/YNL038W. The resulting ORF is 17 residues longer and has an altered C-terminus. This change was reviewed and accepted by SGD curators.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YNL223W |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for ATG4/YNL223W be moved 36 nt (12 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG is not conserved in S. paradoxus, S. mikatae, and S. bayanus; 4) In an independent Genbank record also uses the second ATG for the protein translation (Version AAA86498.1 GI:1173491).Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YNL309W |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for STB1/YNL309W be moved 117 nt (39 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YNL316C |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for PHA2/YNL316C be moved 102 nt (34 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YNL256W |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for FOL1/YNL256W be moved 120 nt (40 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) The first ATG is not conserved in the other Saccharomyces species; 4) Protein sequence comparisons against the nr dataset show there is no sequence similarity between S. cerevisiae and other species between the first and the second ATG; sequence similarity begins after the second methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-09 | TEL14L, TEL14L-TR, TEL14L-XC, TEL14L-XR, TEL14L-YP, TEL14R, TEL14R-TR, TEL14R-XC, TEL14R-XR |
| The chromosomal locations for TEL14L, TEL14L-TR, TEL14L-XC, TEL14L-XR, TEL14L-YP, TEL14R, TEL14R-TR, TEL14R-XC, and TEL14R-XR were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). | |
| 2003-07-29 | YNL024C-A, YNL097C-B, YNL097W-A, YNL103W-A, YNL144W-A, YNL339W-A, YNL339W-B, YNR003W-A, YNR075C-A |
| Thanks to Kumar et al. for providing the coordinates of the following Chromosome XIV ORFs: YNL097C-B, YNL103W-A, YNL339W-A, YNR003W-A, YNR075C-A, YNL339W-B, YNL144W-A, YNL097W-A, and YNL024C-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 | |
| 2003-07-29 | YNL138W-A |
| Thanks to Brachat et al. and Cliften et al.for providing the coordinates of YNL138W-A.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-07-29 | YNL067W-B |
| Thanks to MIPS for providing the coordinates of YNL067W-B. | |
| 2003-07-29 | YNL042W-B, YNL146C-A, YNL277W-A |
| Thanks to
Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XIV ORFs: YNL042W-B, YNL146C-A, and YNL277W-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 | |
| 2003-07-29 | YNL130C-A |
| Thanks to Kessler et al. for providing the coordinates of YNL130C-A.Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 | |
| 2003-02-03 | snR191 |
| Previously unmapped small nucleolar RNA feature snR191 was added. | |
| 2003-01-07 | YNL239W |
| Gal6p purified from yeast indicates that native Gal6p is translated from the second translation start codon (454 aa and not 483 aa). Therefore, the start site of LAP3/GAL6/YNL239W has been moved 87 nt downstream from 200481 to 200568.Zheng W, et al. (1997) The cysteine-peptidase bleomycin hydrolase is a member of the galactose regulon in yeast. J Biol Chem 272(48):30350-5 | |
| 2000-12-01 | YNL162W |
| The boundary between the intron and the downstream exon of YNL162W was moved 30 base pairs downstream, so that the relative coding coordinates change from 1-4..487-833 to 1-4..517-833. | |
| 2000-07-14 | YNL012W |
| The start site of YNL012W was moved 369 base pairs upstream and at the same time an intron was added at new relative coordinates 106-189.Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 | |
| 1999-11-17 | YNL044W |
| The start site of YNL044W was moved 133 base pairs upstream and at the same time an intron was added at new relative coordinates 25-103. |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |
 Return to SGD |
