- Site Map |
- Search Options |
- Help |
- Home |
| 
Chromosome XI History |
|
| |||||||
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
Date  | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2008-06-03 | YKL052C | 340150 | 340150 | Substitution | A | T |
Greg Prelich's lab demonstrated a sequence error at coordinate 340150 on Chromosome XI within ASK1/YKL052C: on Watson strand the A should be a T. This is nucleotide 41 of the Crick strand ASK1/YKL052C, and changes Val14 to Asp. The error was verified in S288C-derivative strain FY4.
New: 50 ATTTCTTGATCAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 1
||||||||| ||||||||||||||||||||||||||||||||||||||||
Old: 340141 ATTTCTTGAACAAGTTTTTCCAATGTTTCCTCTTTGCTTGCAGAATCCAT 340190Prelich G (2008)  | ||||||
| 2005-12-15 | ||||||
| YKL137W | ||||||
| 185988 | 185988 | Deletion | A | |||
| 185979 | 185979 | Deletion | A | |||
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the start site for YKL137W be moved 26 nt upstream. SGD has confirmed the deletion of the A at 185979 and the deletion of the A at 185988. As a consequence, YKL137W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 103 amino acids to 111 amino acids.New: ATGGAGCAAAACAAAGA-TCCGCAGA-TGATCTCGAAACATAGTTCTAGGCTACCTATATKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54     | ||||||
| 2005-12-15 | YKL099C | 255410 | 255410 | Insertion | A | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for YKL099C be moved 19 nt upstream. SGD has confirmed the insertion of an A after the A at 255410. As a consequence, YKL099C was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 256 amino acids to 250 amino acids.New: CTAACGTTTCCGTTGTTTCTTCCATTTAAATGAAATTTTTCCTGAAGAGTCTACGATTTTKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2005-12-14 | YKL039W | 363802 | 363802 | Insertion | G | |
Based on the automated comparison of closely related Saccharomyces species, Kellis et al. (2003) suggest that the stop site for PTM1/YKL039W be moved 25 nt upstream. SGD has confirmed the insertion of a G after the G at 363802. As a consequence, YKL039W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 531 amino acids to 523 amino acids.New: AGAAGGACACGATAATGTAAATAACCATAGCCAAGGCCACGGGCCAGTGTCTCCCTCTCCKellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2005-12-01 | ||||||
| YKR058W | ||||||
| 552522 | 552522 | Deletion | A | |||
| 552426 | 552426 | Insertion | G | |||
Based on the automated comparison of related fungi, Cliften et al. (2003) and Brachat et al. (2003) suggest that the start site for GLG1/YKR058W be moved 409 nt upstream. SGD has confirmed the insertion of a G after the G at 522426 and the deletion of the A at 552522. As a consequence, YKR058W was extended at the 5' end, altering the N-terminus and increasing the size the predicted protein from 480 amino acids to 616 amino acids.
New: GCGTACTAGTGTGATGGGAATGTATAAGAAGCTGGCTATTGCCACATTGCTCTATTCCGCand New: TAGAGGAAGCAGGCAAAAAA-GGCGACATTGAAACATGCBrachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | ||||||
| 2004-07-23 | YKR091W | 611279 | 611279 | Insertion | G | |
The works of Kellis et al. 2003 and Cliften et al. 2003 predicted a single nucleotide insertion upstream of SRL3/YKR091W. SGD resequenced this region and found that a single G nucleotide was necessary to correct the reference sequence. As a consequence of this change, SRL3/YKR091W was extended at the 5' end, altering the N-terminus without changing the translation frame, and increasing the size of the predicted protein from 152 to 246 amino acids. New: 611256 GATACTGAATCTAACAGCCTTCTGGCGACGCCGGCAAGGAAATATTTCAAAACTTCAATA 611315
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old: 611256 GATACTGAATCTAACAGCCTTCTG-CGACGCCGGCAAGGAAATATTTCAAAACTTCAATA 611314Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | ||||||
| 2004-07-23 | YKR087C | 603776 | 603776 | Insertion | T | |
The work of Kellis et al. 2003 predicted a single nucleotide insertion upstream of OMA1/YKR087C. SGD resequenced this region and found that a single T nucleotide after the G at chromosomal coordinate 603776 was necessary to correct the reference sequence. As a consequence of this change, OMA1/YKR087C was extended at the 5' end, altering the N-terminus without changing the translation frame for most of the protein, and increasing the size of the predicted protein from 314 to 345 amino acids. New: 603735 CCATTATTAAATCGACGATATGAAGGACCATTGTCATAGCGGTAACATCGCGTTAACTGA 603794
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old: 603735 CCATTATTAAATCGACGATATGAAGGACCATTGTCATAGCGG-AACATCGCGTTAACTGA 603793Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2004-02-13 | YKL207W | 48828 | 48828 | Insertion | G | |
Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at chromosomal coordinate 48828 in YKL207W. As a consequence of this sequence change, YKL207W was extended at the 3' end, increasing the size of the predicted protein from 260 amino acids to 282 amino acids. New: 48774 ATTGGGTTAAACGATCAGGACATGGGTATTCAGGCCGGGATAGGTGGCCCTCAGGGCCCC 48833
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Old: 48774 ATTGGGTTAAACGATCAGGACATGGGTATTCAGGCCGGGATAGGTGGCCCTCAGG-CCCC 48832Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2004-02-13 | YKL203C | 58941 | 58941 | Insertion | CCG | |
Insertion of three nucleotides was confirmed by sequencing genomic DNA from BY4743 (which is derived from S288C). This is in agreement with GenBank accession X71416, which is the sequence of YKL203C from JK9-3da. Personal communication from Vik Anand (vik@ucla.edu).
New: 58925 CCAAACCCCAGGCAGCGCCGGCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58984
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old: 58925 CCAAACCCCAGGCAGCG---GCAGCCAAAGGCGCCATTGCCTTCTTCACTTCGGGTTTTG 58981 | ||||||
| 2004-02-12 | YKL033W-A | 374308 | 374308 | Insertion | G | |
Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at chromosomal coordinate 374308 in YKL033W-A. As a consequence of this sequence change, YKL033W-A was extended at the 3' end, increasing the size of the predicted protein from 60 amino acids to 236 amino acids. New: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCGGAAGCAGGAAAAAGGGTGATCGAACACT 374336
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old: 374277 TGAAGATTAAATTGCAAGGGCTTCCGGGACCG-AAGCAGGAAAAAGGGTGATCGAACACT 374335Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2004-02-11 | YKR099C-A, YKR100C | 638899 | 638899 | Insertion | G | |
| Brachat et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the G at 638899 in YKR100C. As a consequence of this sequence change, YKR099C-A was merged into YKR100C. YKR100C was extended in the 3' end, increasing the size of the predicted protein from 241 amino acids to 355 amino acids.
New: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGGGTAATACGAACCAAAGTCCTG 638920
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old: 638861 AATGTTACCATTTAAAAACGAGGATGAAGCTCTCCTTGG-TAATACGAACCAAAGTCCTG 638919Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2004-02-11 | YKR056W | 550828 | 550828 | Insertion | A | |
Brachat et al. 2003 predicted and confirmed the insertion of a single A nucleotide after the A at chromosomal coordinate 550828 in YKR056W. As a consequence of this sequence change, YKR056W was extended in the 3' end, increasing the size of the predicted protein from 617 to 639 amino acids.
New: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATAATCCAGCCAAGATTATTTACATATCGTGT 550857
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old: 550798 GAATTATTCCTAAAGCAATTAGCCGCATATA-TCCAGCCAAGATTATTTACATATCGTGT 550856Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2003-01-10 | YKL049C | 346324 | 346324 | Substitution | G | C |
The G inserted after the G at 346324 three days ago was changed to a C.
Old: 346321 CTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 346321 CTGCAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAAC 346380 | ||||||
| 2003-01-08 | YKL198C, YKL199C | 69156 | 69156 | Deletion | G | |
Due to the deletion of the G at coordinate 69156 on Chromosome XI, YKL198C and YKL199C have been merged into one single ORF - PTK1/YKL198C - encoding a protein of 649 amino acids (1950 nucleotides). The new start and stop coordinates of PTK1/YKL198C are 70219 and 68270, respectively. The names YKT9 and YKL199C are being retained as aliases. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. We thank Gerard Manning (gerard-manning@sugen.com) for reporting this sequence error on Chromosome XI to SGD. Old: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTGGTGGTACCAGTCTGAGATACCAAAA 69180
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
New: 69121 TCTTGACAGGGCTGGACAGGTCGTGTGGATCCGTG-TGGTACCAGTCTGAGATACCAAAA 69179 | ||||||
| 2003-01-07 | YKL049C | 346324 | 346324 | Insertion | G | |
Due to the insertion of a G after the G at 346324, the coordinates of CSE4/YKL049C have been changed from 346130-345717 to 346406-345717, extending the ORF from 414 bp in length to 690 bp. This sequence change was verified in FY1679 (S288c derivative strain) background by SGD. Thanks to Sam Stoler, Judith Sharp, Vivian Measday, Sue Biggins, and Kelcy Newell for reporting this sequence error on Chromosome XI to SGD.
Old: 346321 CCTG-AAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
New: 346320 CCTGGAAGCCTGTTGACGTTACTGAGTGATCTTCCACTCGAATCACTTTGAATAGCAGAA 346379Stoler S, et al. (1995) A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev 9(5):573-86 | ||||||
| 2001-05-31 | YKL201C, YKL202W | 64287 | 64287 | Substitution | T | C |
SGD received a direct notification from MIPS about the following sequence change. The nucleotide at coordinate 64287 was changed from T to C, altering translation of YKL202W by changing amino acid 157 from a Phe (TTT) to a Ser (TCT). This change also affects overlapping ORF MNN4/YKL201C. Note that this is the exact reciprocal of the sequence change made to this nucleotide on 1998-11-10.Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320 | ||||||
| 1998-11-10 | ||||||
| YKL198C, YKL199C | ||||||
| 68863 | 68863 | Insertion | C | |||
| 69101 | 69101 | Insertion | G | |||
| MIPS made corrections in the area covering PTK1/YKL198C and YKT9/YKL199C.
Insertion of a C after the C at 68861 Old: 68819 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGC-GCGATTGCGGAATGCG 68877
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New: 68814 CTAGCCAAGTGATACTCCATTCCCGGCCCCGGGCGGTAATTGCCGCGATTGCGGAATGCG 68873
Insertion of a G after the G at 69100 Old: 69058 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCG-CGAGCCGATCATCCCT 69116
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
New: 69054 TTCTTGGAGTCGTAGAACATGACCTCCGGGGGAGCATACGGCGGCGAGCCGATCATCCCT 69113 | ||||||
| 1998-11-10 | YKL201C, YKL202W | 64287 | 64287 | Substitution | C | T |
MIPS made a correction to YKL202W, that also affects overlapping ORF MNN4/YKL201C: the C at chromosomal coordinate 64287 was changed to a T.
Old: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTCTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
New: 64261 TTTTTCTTTTCTTCTTCTTCCTTCTTTTTCTTTTCCTCTTCTTCCTTCTTCTTCTTCTCC 64320
| ||||||
| 1998-11-10 | ||||||
| YKL200C, YKL201C | ||||||
| 65922 | 65922 | Deletion | A | |||
| 66278 | 66278 | Deletion | T | |||
| 66298 | 66298 | Insertion | G | |||
| 66685 | 66685 | Deletion | T | |||
| 66715 | 66715 | Deletion | T | |||
| 66725 | 66725 | Deletion | T | |||
| MIPS made sequence corrections in the area covering YKL200C that resulted in its subsumption into MNN4/YKL201C, which now encompasses both ORFs plus additional sequence (coordinates 67463-63927). The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927.
Deletion of the A at 65922 Old: 65871 GGGCATTTGCAAGTCGAAATCGTTATCCCAAAGGGAAAGCCATTCCATTG 65940
||||||||||||||||||||||||||||||| ||||||||||||||||||
New: 65869 GGGCATTTGCAAGTCGAAATCGTTATCCCAA-GGGAAAGCCATTCCATTG 65937
Deletion of the T at 66278, insertion of a G after the G at 66298 Old: 66231 CTAACTCTTCAATTTTTTTGGAGGCATTCGAACTTGAAATCCGAAGGG-A 66299
||||||||||||||||||||||||||| |||||||||||||||||||| |
New: 66228 CTAACTCTTCAATTTTTTTGGAGGCAT-CGAACTTGAAATCCGAAGGGGA 66296
Deletion of the T at 66685, deletion of the T at 66715 Old: 66650 GTATTAAATCTTAAATCCCTTAGGAGAGCCATGCCCGTCTGGAGTTGAAT 66719
||||||||||||||| ||||||||||||||||||||||||||||| ||||
New: 66647 GTATTAAATCTTAAA-CCCTTAGGAGAGCCATGCCCGTCTGGAGT-GAAT 66714
Deletion of the T at 66725 Old: 66720 AGCTTTGGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66769
||||| ||||||||||||||||||||||||||||||||||||||||||||
New: 66715 AGCTT-GGAACAATGCTTTTTTAGTTCCTTTGAGTCTTTGATTCTGTCCT 66763Odani T, et al. (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10 Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America | ||||||
| 1998-11-10 | ||||||
| YKL201C | ||||||
| 65689 | 65689 | Deletion | A | |||
| 65761 | 65761 | Deletion | T | |||
| 67457 | 67457 | Insertion | T | |||
| MIPS made corrections in the area covering MNN4/YKL201C which resulted in the removal of YKL200C. MNN4/YKL201C now encompasses both ORFs plus additional sequence (coordinates 67463-63927). The old coordinates for YKL200C were 67113-65917, and for YKL201C were 65546-63927.
Deletion of the A at 65689
Old: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTGACTAGCTAGACC 65700
|||||||||||||||||||||||||||||||||||||| |||||||||||
New: 65651 TATAAGAATTCAAGTAATCCCTACTAGGGGCAGAAGTG-CTAGCTAGACC 65699
Deletion of the T at 65761
Old: 65751 TATTGTTTTTTACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65800
|||||||||| |||||||||||||||||||||||||||||||||||||||
New: 65750 TATTGTTTTT-ACCGTTACCGTTAATTCTTACTGTCAAGGAGTCGCTGAC 65798
Insertion of a T after the T at 67457
Old: 67440 GTGAAGTTTAGATGATAT-CGCTGAAGCATAACTAATTAGTTTATTTGTG 67488
|||||||||||||||||| |||||||||||||||||||||||||||||||
New: 67434 GTGAAGTTTAGATGATATTCGCTGAAGCATAACTAATTAGTTTATTTGTG 67483Odani T, et al. (1996) Cloning and analysis of the MNN4 gene required for phosphorylation of N-linked oligosaccharides in Saccharomyces cerevisiae. Glycobiology 6(8):805-10 Cherry JM, et al. (1998) "Genetic and Physical Maps of Saccharomyces cerevisiae (Edition 15)". Pp. 414-420 in 1998 Yeast Genetics and Molecular Biology Meeting Program and Abstracts. Bethesda, MD: The Genetics Society of America | ||||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2009-05-06 | ARS1102, ARS1104, ARS1115 |
| The following ARS elements on Chromosome XI were added to the genome annotation based on Raveendranathan et al. 2006: ARS1102, ARS1104, and ARS1115.Raveendranathan M, et al. (2006) Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J 25(15):3627-39 | |
| 2009-02-20 | YKR101W |
| The annotated translation start of SIR1/YKR101W was moved 24 aa (72 nt) downstream based on Gallagher et al. 2009. The old chromosomal coordinates were 640106-642142, and are now 640178-642142.Gallagher JE, et al. (2009) Elaboration, diversification and regulation of the sir1 family of silencing proteins in Saccharomyces. Genetics 181(4):1477-91 | |
| 2007-09-05 | YKR005C |
The start of ORF YKR005C was moved upstream 303 nt from 449507 to 449810, and an intron was added at new relative coordinates 148-216, based on Miura et al. 2006.Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51  | |
| 2007-04-04 | YKL186C |
| MTR2/YKL186C mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version.Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 | |
| 2007-04-04 | YKL150W |
| MCR1/YKL150W mRNA contains an intron in the 5' untranslated region (UTR); however, Miura et al. also detected an unspliced form that was more prevalent than the spliced version.Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 | |
| 2006-10-03 | ARS1125, ARS1126, ARS1127 |
| The following ARS elements on Chromosome XI were added to the genome annotation based on Nieduszynski et al. 2006: ARS1125/ARS1104.5, ARS1126/ARS1106.3, ARS1127/ARS1106.7.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 | |
| 2006-09-08 | ARS1103, ARS1106, ARS1109, ARS1112, ARS1113, ARS1114, ARS1116, ARS1118, ARS1120, ARS1123 |
| The following new ARS elements on Chromosome XI were added to SGD based on Nieduszynski et al. 2006: ARS1103, ARS1106, ARS1109, ARS1112, ARS1113, ARS1114, ARS1116, ARS1118, ARS1120, ARS1123.Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9 | |
| 2006-05-08 | YKL168C |
| The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., and so the start site for KKQ8/YKL168C was moved 30 nt (10 codons) downstream.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2006-05-08 | YKR036C |
| The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for CAF4/YKR036C was moved 48 nt (16 codons) downstream.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2006-05-08 | YKL207W |
| The proposal by Kellis et al. was re-examined in light of sequence data from S. kudriavzevii (another sensu stricto strain published by Cliften et al.). The S. kudriavzevii sequence supported the start codon suggested by Kellis et al., so the start site for YKL207W was moved 87 nt (29 codons) downstream.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2006-03-02 | snR87 |
| New snoRNA published by Davis and Ares.Davis CA and Ares M Jr (2006) Accumulation of unstable promoter-associated transcripts upon loss of the nuclear exosome subunit Rrp6p in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 103(9):3262-7 | |
| 2005-11-17 | YKL023C-A, YKL065W-A |
| Based on genome sequence comparisons among six Saccharomyces species, Cliften et al. 2003 suggested that the following ORFs be added to the annotation of Chromosome XI: YKL065W-A and YKL023C-A.Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2005-11-03 | YKR042W |
| The work of Zhang and Dietrich 2005 confirmed the suggestion from Kellis et al. 2003 that the start site of UTH1/YKR042W be moved 255 nt downstream from 518914 to 519169. This annotation change results in a predicted protein of 365 aa, as opposed to the previously annotated 450 aa.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Zhang Z and Dietrich FS (2005) Mapping of transcription start sites in Saccharomyces cerevisiae using 5' SAGE. Nucleic Acids Res 33(9):2838-51 | |
| 2004-10-12 | CEN11 |
| The orientation of this centromere was reversed (from Watson to Crick) and its coordinates expanded to accommodate annotation of the centromeric DNA elements CDEI, CDEII, and CDEIII based on Wieland et al. (2001) and Espelin et al. (2003).Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 | |
| 2004-03-08 | YKR004C, YKR004C-A |
| The small ORF YKR004C-A was added based on Kessler et al. 2003. However, Brachat et al. 2003 demonstrated that this ORF is actually an exon of YKR004C. Based on this information, YKR004C-A has been merged into YKR004C.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 | |
| 2004-02-09 | YKL157W, YKL158W |
| In July 2003, YKL158W was mistakenly added back to SGD as an independent ORF. This annotation mistake has been corrected, and YKL158W has again been "merged" into YKL157W.Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 | |
| 2004-01-29 | YKR095W-A |
| The coordinates for Exon1 and the intron have changed. The 5' end of Exon1 has been moved 210 bp downstream, and the size of the intron has been reduced from 300 bp to 75 bp. Note that there is no change to Exon2. | |
| 2003-09-27 | YKR004C |
| Based on the alignment of orthologs in related fungi, Cliften et al. and Brachat et al. both proposed an intron and new 5' exon for ECM9/YKR004C. Brachat et al. confirmed this intron using 5' RACE. The resulting ORF is in the same frame, but has an 85-residue extension at the N-terminus. This change was reviewed and accepted by SGD curators.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YKR038C |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR038C be moved 105 nt (35 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine; 3) Although there is an upstream ATG in S. paradoxus, an insertion causes a frame shift between this ATG and the predicted start site; 4) Sequence comparison to the nr dataset shows there is no sequence similarity between S. cerevisiae and other species between the first and second ATG; the sequence similarities begin after the 2nd ATG.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YKL195W |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKL195W be moved 72 nt (24 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-22 | YKR006C |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for MRPL13/YKR006C be moved 33 nt (11 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) The currently annotated ATG is not conserved in 3 related Saccharomyces species; 2) The frame is conserved only after the 2nd ATG; 3) Although the amino terminus contains a mitochondrial targeting sequence (Grohmann et al.), this protein is still predicted to be targeted to the mitochondrion even if it uses the proposed start methionine (http://www.mips.biochem.mpg.de/cgi-bin/proj/medgen/mitofilter)Grohmann L, et al. (1994) The yeast nuclear gene MRP-L13 codes for a protein of the large subunit of the mitochondrial ribosome. Curr Genet 26(1):8-14 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | |
| 2003-09-22 | YKR045C |
| Based on the automated comparison of closely related Saccharomyces species, Kellis et al. suggest that the start site for YKR045C be moved 24 nt (8 codons) downstream. This suggestion was reviewed and accepted by SGD curators. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been changed accordingly. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine.Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-09-09 | TEL11L, TEL11L-TR, TEL11L-XC, TEL11L-XR, TEL11R, TEL11R-TR, TEL11R-XC, TEL11R-XR |
| The chromosomal locations for TEL11R-TR, TEL11R-XR,
TEL11R-XC, TEL11R, TEL11L-TR, TEL11L-XR, TEL11L-XC,
and TEL11L were generously provided by Ed Louis and Dave Barton (University of Leicester, UK). | |
| 2003-08-07 | YKR099C-A |
| The chromosomal coordinates of ORF YKR099C-A were shifted 1 nucleotide downstream, from 638723-638532 to 638722-638531. Note that the sequence remains unchanged. | |
| 2003-07-29 | YKR095W-A |
| Thanks to Brachat et al and Cliften et al. for providing the coordinates of YKR095W-A.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | |
| 2003-07-29 | YKL068W-A |
| Thanks to Brachat et al. for providing the coordinates of YKL068W-A.Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | |
| 2003-07-29 | YKL183C-A, YKR004C-A |
| Thanks to Kessler et al. for providing the coordinates of the following Chromosome XI ORFs: YKL183C-A and YKR004C-A.Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 | |
| 2003-07-29 | YKL096C-B, YKL156C-A, YKR075W-A |
| Thanks to Kumar et al. for providing the coordinates of the following Chromosome XI ORFs: YKL096C-B, YKR075W-A, and YKL156C-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 | |
| 2003-07-29 | YKL158W |
| Thanks to MIPS for providing the coordinates of YKL158W. | |
| 2003-07-29 | YKL100W-A, YKL145W-A, YKR099C-A |
| Thanks to
Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following Chromosome XI ORFs: YKL100W-A, YKL145W-A, and YKR099C-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 | |
| 2001-03-14 | YKL003W-A |
| This ORF was initially added to SGD on 2001-02-26 based on homology (Blandin et al.), but was subsequently deleted because it is contained within DID4/YKL002W (Mark Hochstrasser, personal communication; Amerik et al.).Amerik AY, et al. (2000) The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol Biol Cell 11(10):3365-80 Blandin G, et al. (2000) Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett 487(1):31-6 | |
| 2001-03-09 | snR42 |
| Changed from W -> C: old start coord: 558652; old stop coord: 559002 new start coord: 559002; new stop coord: 558652 References: 1. Ni et al. (1996) Cell 86(5):823-834 2. snoRNA Database: http://www.bio.umass.edu/biochem/rna-sequence/Yeast_snoRNA_Database/snoRNA_DataB ase.html 3. Personal communication: Dr. Eric Steinmetz Dept. of Biomolecular Chemistry University of Wisconsin 1300 University Ave. Madison, WI 53706 | |
| 2000-12-01 | YKL199C |
| The start site of YKL199C was moved 276 nucleotides upstream, increasing the size of the ORF from 564 nt to 840 nt, and the size of the predicted protein from 187 amino acids to 279 aa. | |
| 2000-08-11 | YKL096W-A |
| Old name: YKL097W-A; new name: YKL096W-A; date: 11/1998; old coord: ChrXI 258895 259173; SGDID: S0001956; Name changed due to nomenclature | |
| 2000-07-22 | YKL002W |
| The start site of YKL002W was moved 243 bp upstream, and a 68-bp intron was added at relative coordinates 61-128. | |
| 2000-07-14 | YKL157W, YKL158W |
| YKL157W and YKL158W were merged into a single ORF, designated YKL157W, based on evidence published by Davis et al. 2000 demonstrating the presence of an intron between these two ORFs.Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |
 Return to SGD |
