---

• Site Map |
• Search Options |
• Help |
• Home |
•   |
•  

•  
• Community Info
• Submit Data
• BLAST
• Primers
• PatMatch
• Gene/Seq Resources
• Advanced Search
• Community Wiki

---

Chromosome I History

Summary Chromosome History

• The sequence of Chromosome I has been updated 28 times, affecting 17 features.
• The annotation of Chromosome I has been updated 22 times, affecting 42 features.
• Current and past versions can be obtained from SGD's FTP site.

Date	Affected Features	Start Coordinate of Change	End Coordinate of Change	Type of Change	Old Sequence	New Sequence
2008-03-05
	YAL044C
		58247	58247	Substitution	A	C
		58196	58196	Substitution	A	C
		58424	58424	Substitution	C	T
	Three single base substitutions were made within ORF YAL044C/GCV3 to correct errors in the systematic reference sequence for Chromosome I: Two separate A -> C transversions at 58196 and 58247, and a C -> T transition at 58424. These errors were verified by sequencing in 3 different strains, all of ResGen BY4741 (S288C) background. SGD thanks Michael E. Rice for bringing these errors to our attention, and for verifying the correct sequence. New: 58191 TTGGGCAATCTCAGTGCCCACTTCTGGCAACTCAACATAGGTAGCGTCCCCTAAGGCATC 58250 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| Old: 58191 TTGGGAAATCTCAGTGCCCACTTCTGGCAACTCAACATAGGTAGCGTCCCCTAAGGAATC 58250 New: 58251 AGTGGCGTATTTTGTAATTCCGACAAAGGCAGTCTTGTCCTGATGCACAGCTATCCACTC 58310 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 58251 AGTGGCGTATTTTGTAATTCCGACAAAGGCAGTCTTGTCCTGATGCACAGCTATCCACTC 58310 New: 58311 ATGTTGGGAAGTGTACCTCACGGCTTGAGGTCCTTGGGATGAGTACAAAAATGGTAGTTT 58370 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Old: 58311 ATGTTGGGAAGTGTACCTCACGGCTTGAGGTCCTTGGGATGAGTACAAAAATGGTAGTTT 58370 New: 58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGTGGGCAT 58430 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Old: 58371 ATTCTTGTTTAGGGCATTGCCGGAGCTGTTTCTCAAAAACAATTTGCTCACAGCGGGCAT 58430
2007-04-05
	YAL004W, YAL005C
		140169	140169	Substitution	A	G
		140182	140182	Substitution	A	G
		140811	140811	Substitution	A	G
	Three single nucleotide substitutions were made within the coding sequence of SSA1 (at nucleotide positions 623, 1252, and 1265 relative to the SSA1 coding sequence), based on the sequence reported by Slater and Craig (1989) and corresponding to GenBank entry X12926. These changes result in phenylalanine to serine changes at amino acid residues 208 and 422 and a change from serine to proline at amino acid residue 418. Thanks to Andreas Bracher for bringing these corrections to our attention. Note that the change at position 623 of SSA1 also affects the coding sequence of the Dubious ORF YAL004W. 638 ATACCGTCTTCAATGGACAACAAAGAGAC 610 new sequence, coordinates relative to SSA1 coding region ||||||||||||||| ||||||||||||| 140796 ATACCGTCTTCAATGAACAACAAAGAGAC 140824 old sequence, chromosomal coordinates 1279 TGGAAAAGATCTCGGACTTCTTTGTTGGAATGGTAGAGTTT 1239 new sequence, coordinates relative to SSA1 coding region |||||||||||||| |||||||||||| ||||||||||||| 140155 TGGAAAAGATCTCGAACTTCTTTGTTGAAATGGTAGAGTTT 140195 old sequence, chromosomal coordinates Slater MR and Craig EA (1989) The SSA1 and SSA2 genes of the yeast Saccharomyces cerevisiae. Nucleic Acids Res 17(2):805-6
2006-01-19	YAR042W	193355	193355	Substitution	G	A
	When confirming the G nucleotide insertion that resulted in the merger of SWH1/YAR042W and OSH1/YAR044W (see 2003-09-27), SGD detected an additional sequencing error. The substitution of an A nt for a G nt changes amino acid 248 from a serine to an asparagine. Substitute an A nt for the G nt at 193355 New: 193341 CGACACCGCCACCAACACCAAGATCGCCATC 193371 |||||||||||||| |||||||||||||||| Old: 193341 CGACACCGCCACCAGCACCAAGATCGCCATC 193371
2004-07-20
	YAL051W
		51688	51688	Deletion	G
		51694	51694	Deletion	G
	The work of Kellis et al. 2003 predicted the deletion of 2 separate G nucleotides in YAL051W at chromosomal coordinates 51688 and 51694, and these sequence errors were confirmed in S288C by SGD. As a consequence of these changes, YAL051W was shortened at the 3' end, altering the C-terminus and decreasing the size of the predicted protein from 1062 to 1047 amino acids. NEW: 51666 TTTATTTGATTATGACTTTTTG-TTTGG-CAATGACTTTGCTTAAAAATTTTCTTTCCAA 51723 |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| OLD: 51666 TTTATTTGATTATGACTTTTTGGTTTGGGCAATGACTTTGCTTAAAAATTTTCTTTCCAA 51725 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-01-27	YAR014C	166772	166772	Deletion	G
	Kellis et al. 2003 predicted and confirmed the deletion of a single G nucleotide at chromosomal coordinate 166772. As a consequence of this sequence change, YAR014C was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 702 to 707 amino acids. New: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTG-TTTCATCAACACA 166784 ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Old: 166731 TTGTAAGGACAATATCATTTACGAATAATTTCATCCAATTGGTTTCATCAACACA 166785 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2004-01-22	YAL002W	143848	143848	Insertion		C
	Kellis et al. 2003 and Cliften et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at chromosomal coordinate 143848. As a consequence of this sequence change, YAL002W was extended at the 5' end, altering the N-terminus and increasing the size of the predicted protein from 1176 to 1274 amino acids. New: 143826 ATCTAGTTCTTCATATACGGCACCTCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143885 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Old: 143826 ATCTAGTTCTTCATATACGGCAC-TCCCCTGAACGAAGATGGTCCTAAAGGGGTAGCTTC 143884 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2004-01-22	YAL056W	41778	41778	Insertion		G
	Kellis et al. 2003 predicted and confirmed the insertion of a single G nucleotide after the T at chromosomal coordinate 41778. As a consequence of this sequence change, YAL056W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein increasing from 847 to 880 amino acids. New: 41724 GCGAAAATGAAGATACAAATTCAAATATAGTAGTTGGTGTCGGTGGCACTTCTTTGCAAT 41783 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Old: 41724 GCGAAAATGAAGATACAAATTCAAATATAGTAGTTGGTGTCGGTGGCACTTCTTT-CAAT 41782 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54
2003-12-17
	YAL013W
		130246	130247	Substitution	CG	GC
		130239	130239	Insertion		C
	Kellis et al. 2003 and Brachat et al. 2003 predicted and confirmed the insertion of a single C nucleotide after the C at position 130239 on Chromosome I. As a consequence of this sequence change, YAL013W was extended at the 3' end, altering the C-terminus and increasing the size of the predicted protein from 362 to 420 amino acids. They also found an additional seqeuncing error: the CG at 130246-130247 should be GC. Old: 130201 ACTTGATAACAAGACGCTGAGCTGTATCACGGGCTACGC-AGCGCACGACAGCTGTGCTA 130259 ||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| New: 130201 ACTTGATAACAAGACGCTGAGCTGTATCACGGGCTACGCCAGCGCAGCACAGCTGTGCTA 130260 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45
2003-09-27	YAR042W, YAR044W	193300	193300	Insertion		G
	Insertion of a single G after the G at 193300 merged SWH1/YAR042W and OSH1/YAR044W. After merging YAR042W (coordinates 192613-193383 (1-771)) and YAR044W (coordinates 193599-196178 (1-2580)), the coordinates of the merged ORF, SWH1/YAR042W, are 192613-196179 (1-3567). OSH1 and YAR044W are now aliases of SWH1/YAR042W. This sequence change was predicted by several studies, then verified in S288c by SGD. Old: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGG-CAAACTGCCCATCGAGCTC 193319 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| New: 193261 CTTGAACACGGTGCTGACCCCTTCAAGAGAGACCGCAAGGGCAAACTGCCCATCGAGCTC 193320 Schmalix WA and Bandlow W (1994) SWH1 from yeast encodes a candidate nuclear factor containing ankyrin repeats and showing homology to mammalian oxysterol-binding protein. Biochim Biophys Acta 1219(1):205-10      Beh CT, et al. (2001) Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics 157(3):1117-40        Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45      Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2002-12-17
	YAL023C
		108143	108143	Insertion		G
		108137	108137	Insertion		CC
	Due to the insertion of CC after the C at 108137, and the insertion of a G after the G at 108143 in the systematic sequence of Chromosome I, the coordinates of PMT2/YAL023C have been changed. Thanks to Verena Girrbach (verena.girrbach@biologie.uni-regensburg.de) for reporting this sequence error in the systematic sequence of PMT2/FUN25/YAL023C to SGD. Old: 108121 AGTCTGGGTAAATTTCC--AGAAGG-AAGTCCCAAGAACCGTTGTAGCCTGCCAAATAAC 108177 ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| New: 108121 AGTCTGGGTAAATTTCCCCAGAAGGGAAGTCCCAAGAACCGTTGTAGCCTGCCAAATAAC 108180
2002-12-17	YAL014C	128441	128441	Insertion		T
	Due to the insertion of a single T nucleotide after the T at coordinate 128441 in the systematic sequence of Chromosome I, the ORF SUN8/YAL014C was extended 450 nucleotides in the 3' direction, making the protein product 150 amino acids longer at the C-terminus. Thanks to Lena Burri, Trevor Lithgow, and Hugh Pelham for reporting this sequence error in the systematic sequence of SYN8/UIP2/YAL014C to SGD. Old: 128398 TTCTAAATCAACCAGCAGCGAGTCGTTCTGAGAAACGATCTCAT-ATTAAGGTCCAGCGA 128456 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| New: 128401 TTCTAAATCAACCAGCAGCGAGTCGTTCTGAGAAACGATCTCATTATTAAGGTCCAGCGA 128460 Lewis MJ and Pelham HR (2002) A new yeast endosomal SNARE related to mammalian syntaxin 8. Traffic 3(12):922-9
1998-09-02
	YAL062W, YAL063C
		29254	29254	Deletion	A
		29290	29290	Deletion	A
		29291	29291	Deletion	T
		29307	29307	Deletion	A
		29301	29301	Substitution	T	A
		29289	29289	Deletion	A
	The following changes were made to the systematic sequence of Chromosome I in the region encompassing features FLO9/YAL063C and GDH3/YAL062W: deletion of the A at 29254, deletion of AAT at 29289-29291, transversion of T to A at 29301, and deletion of the A at 29307. Old: 29221 TGAAATCATACCTGCCAAGCTTGCTGCACTTGGAAAGGCAACTCCGTTTTTCAGAGATTA 29280 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| New: 29221 TGAAATCATACCTGCCAAGCTTGCTGCACTTGGAA-GGCAACTCCGTTTTTCAGAGATTA 29279 Old: 29281 GATCCTTTAATTTTTTTTGATGAAAAAGGCAGCCAAGTTACGTCATAGAGAAAACTCCCT 29340 |||||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||| New: 29280 GATCCTTT---TTTTTTTGAAGAAAA-GGCAGCCAAGTTACGTCATAGAGAAAACTCCCT 29335
1998-09-02
	YAR060C, YARCdelta8
		210804	210804	Deletion	T
		210810	210810	Substitution	T	A
		211011	211011	Substitution	C	T
	The following changes were made to the systematic sequence of Chromosome I in the region encompassing features YARCdelta8 and YAR060C: deletion of the T at 210804, transversion of T to A at 210810, and transition of C to T at 211011. Old: 210781 TTTCTCTTTGCTTGCATCTTTTTTCTTCCTTGCCAAAAAATAAAAGATACTCATTTTAAA 210840 ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| New: 210776 TTTCTCTTTGCTTGCATCTTTTT-CTTCCATGCCAAAAAATAAAAGATACTCATTTTAAA 210834 Old: 210961 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCCGAAAACCTT 211020 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| New: 210955 GCCCTTCTACGGCTTCTTCTAACCAATTGTTCCCCGTGAGTTGCTTTCTCTGAAAACCTT 211014
1998-09-02	YAR050W	203939	203939	Substitution	T	G
	The following sequence change was made to the systematic sequence of Chromosome I within the ORF YAR050W/FLO1: transversion of T to G at 203939. Old: 203881 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCTA 203940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | New: 203876 CAATTCTATCAGTAGGTGGTGCAACCGCGTTCAACTGTTGTGCTCAACAGCAACCGCCGA 203935

ANNOTATION CHANGES without sequence changes

Jump to: Sequence changes

Date	Affected Features
2007-05-08	snR18
	Updated coordinates of snR18 based on GenBank U12981. Hiraga K, et al. (1993) Cloning and characterization of the elongation factor EF-1 beta homologue of Saccharomyces cerevisiae. EF-1 beta is essential for growth. FEBS Lett 316(2):165-9
2007-05-08	HRA1
	Updated coordinates of HRA1 based on Yang & Altman 2007. Yang L and Altman S (2007) A noncoding RNA in Saccharomyces cerevisiae is an RNase P substrate. RNA 13(5):682-90
2007-03-07	ARS102, ARS103, ARS105, ARS108, ARS111, ARS112
	The following ARS elements were added to the genome annotation on Chromosome I based on Xu et al. 2006: ARS102, ARS103, ARS105, ARS108, ARS111, ARS112. Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
2007-03-07	ARS109
	The ACS within ARS101/ARS109 at coordinates 159946-159936 was added based on Xu et al. 2006 and Theis & Newlon 2001. Theis JF and Newlon CS (2001) Two compound replication origins in Saccharomyces cerevisiae contain redundant origin recognition complex binding sites. Mol Cell Biol 21(8):2790-801        Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7():276
2007-02-06	HRA1
	This RNA gene, HRA1, was described by Samanta et al. (2006). Approximate start and stop coordinates, which are accurate to within 25 nucleotides, have been specified for this non-coding RNA. Many thanks to Manoj Samanta for alerting us to this noncoding RNA. Samanta MP, et al. (2006) Global identification of noncoding RNAs in Saccharomyces cerevisiae by modulating an essential RNA processing pathway. Proc Natl Acad Sci U S A 103(11):4192-7
2006-10-02	ARS109
	An ARS Consensus Sequence (ACS) was added to ARS109 based on Nieduszynski et al. 2006. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-09-06	ARS104, ARS106, ARS107
	The following ARS elements on Chromosome I were added to SGD based on Nieduszynski et al. 2006: ARS104, ARS106, ARS107. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-09-06	ARS109, ARS110
	Updated coordinates of the following ARS elements on Chromosome I based on Nieduszynski et al. 2006: ARS101/109, ARS110. Nieduszynski CA, et al. (2006) Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14):1874-9
2006-05-08	CEN1
	The previously annotated boundaries of CEN1 were adjusted to coincide with the 5' end of CDEI and the 3' end of CDEIII, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60        Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2006-02-28	ARS110
	This ARS element ARS110 was added to the genome annotation based on Wyrick et al. 2001 and Dimock et al. 1984. Dimock K, et al. (1984) Molecular cloning of the ADE1 gene of Saccharomyces cerevisiae and stability of the transformants. Gene 27(2):233-7      Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2004-10-18	ARS109
	ARS101 was added to SGD based on Theis and Newlon 2001 and Wyrick et al. 2001. Theis JF and Newlon CS (2001) Two compound replication origins in Saccharomyces cerevisiae contain redundant origin recognition complex binding sites. Mol Cell Biol 21(8):2790-801        Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60
2004-10-12	CEN1
	Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003. Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60        Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68
2003-09-22	YAL044C
	The start site of GCV3/YAL044C was moved 21 nt (7 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YAL034C
	The start site of FUN19/YAL034C was moved 150 nt (50 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-22	YAL011W
	The start site of YAL011W was moved 39 nt (13 codons) downstream, based on the automated comparison of closely-related Saccharomyces species by Kellis et al. 2003. The numbering for both the nucleotides in the DNA coding sequence and the amino acids in the predicted protein have been updated. Evidence supporting this change includes: 1) This is the predicted start methionine in the majority of Saccharomyces species orthologs analyzed by Kellis et al. and/or Cliften et al.; 2) Significant sequence conservation begins abruptly at this predicted start methionine. Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54            Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6
2003-09-09	TEL01L, TEL01L-TR, TEL01L-XC, TEL01L-XR, TEL01R, TEL01R-TR, TEL01R-XC
	The chromosomal locations for the following telomeric features on Chromosome I were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL01L, TEL01L-TR, TEL01L-XC, TEL01L-XR, TEL01R, TEL01R-TR, and TEL01R-XC.
2003-07-29	YAL037C-B, YAL067W-A, YAL068W-A, YAR035C-A
	Thanks to Kumar et al. 2002 for providing the coordinates of the following ORFs on Chromosome I: YAL037C-B, YAL067W-A, YAL068W-A, YAR035C-A. Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63
2003-07-29	YAL063C-A
	Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of ORF YAL063C-A on Chromosome I. Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9        Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51          Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20
2003-07-29	YAL016C-A, YAL019W-A, YAL026C-A, YAL031W-A, YAL037C-A, YAL047W-A, YAL059C-A, YAR019W-A
	Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome I: YAL016C-A, YAL019W-A, YAL026C-A, YAL031W-A, YAL037C-A, YAL047W-A, YAL059C-A, and YAR019W-A.
2003-07-29	YAL016C-B
	Thanks to Kessler et al. 2003 for providing the coordinates of ORF YAL016C-B on Chromosome I. Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71
2001-01-30	YAL044W-A
	ORF added based on similarity to an S. pombe gene (information submitted by Valerie Wood).
1999-07-17	YAR043C, YAR052C, YAR074C
	Deleted ORF, does not encode a protein; this putative ORF was included in the original annotation of Chromosome I but was later withdrawn

Jump to: Sequence Changes | Annotation Changes without Sequence Changes

Return to SGD

Send a Message to the SGD Curators