- Site Map |
- Search Options |
- Help |
- Home |
| 
Chromosome VI History |
|
| |||||||
| SEQUENCE CHANGES, including any resulting annotation changes | Jump to: Annotation changes |
Date  | Affected Features | Start Coordinate of Change | End Coordinate of Change | Type of Change | Old Sequence | New Sequence |
|---|---|---|---|---|---|---|
| 2004-02-05 | YFR045W | 242181 | 242181 | Insertion | G | |
Based on the automated comparison of related Saccharomyces species, Kellis et al. and Brachat et al. suggested that the start site for YFR045W be moved 320 nt upstream.
Belenkiy R et al. demonstrated a G nt insertion in that region and this sequence change was confirmed in S288c, by SGD. As a consequence of this sequence change, YFR045W was extended 320 nt at the 5' end, altering the the N-terminus and increasing the size of the predicted protein from 537 to 858 amino acids. Note that Belenkiy et al. also demonstrated a silent G to C substitution 701 nts downstream from the new start site; however, SGD could not confirm this sequence change in S288c, so it has not been incorporated.
New: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGGGTACCGCTTTCGAAATCATTTTACCTCAGA 242211
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old: 242152 TAAAGACTGGTTTACAATTGCAACCGAAGG-TACCGCTTTCGAAATCATTTTACCTCAGA 242210
Belenkiy R, et al. (2000) The yeast mitochondrial transport proteins: new sequences and consensus residues, lack of direct relation between consensus residues and transmembrane helices, expression patterns of the transport protein genes, and protein-protein interactions with other proteins. Biochim Biophys Acta 1467(1):207-18   Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54  Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2004-02-05 | YFR038W | 231670 | 231670 | Deletion | G | |
Based on the automated comparison of related fungi, Kellis et al. and Brachat et al. suggested that the stop site for YFR038W be moved 226 nt downstream. Hui-fen Kuo and Eric Richards resequenced this portion of the genome and found that a G nt. should be deleted (personal communication to SGD). This sequence error was confirmed by SGD. As a consequence of this sequence change, YFR038W was extended 226 nt at the 3' end, altering the the C-terminus and increasing the size of the predicted protein from 778 to 853 amino acids.
New: 231648 AAAAATTGGCGTTAAATGAAGG-TTCTTTTTTGAAGGCAAA 231687
|||||||||||||||||||||| ||||||||||||||||||
Old: 231648 AAAAATTGGCGTTAAATGAAGGGTTCTTTTTTGAAGGCAAA 231688
Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 | ||||||
| 2003-09-26 | TEL06R, TEL06R-XC | 270023 | 270023 | Insertion | G | |
After sequence verification in AB972 (S288c derivative) by SGD, a single G nucleotide was inserted after chromosomal coordinate 270023. This change lies within TEL06R-XC, the X element core sequence of TEL06R, the right telomere of chromosome VI.
Old: 270000 TACTATTGATGGAAATGAGGACTG-GTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270058
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
New: 270000 TACTATTGATGGAAATGAGGACTGGGTCATGGGGCGCAATGGAGTGAAGTAATATATACT 270059Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702 | ||||||
| 2003-09-26 | YFR050C, YFR051C | 250082 | 250082 | Deletion | G | |
A single G nucleotide was deleted from the intergenic region between ORFs YFR050C and YFR051C.
Old: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAGGATACCTCGATTTTTATTTATTTAGTTT 250110
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
New: 250051 TAAACTATATATATAGAAGGACGAAAGAAAAG-ATACCTCGATTTTTATTTATTTAGTTT 250109Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702 | ||||||
| 2003-09-26 | YFL006W, YFL007W | 128870 | 128870 | Insertion | G | |
Due to the insertion of a G at 128870 on Chromosome VI, YFL006W has been merged with BLM10/YFL007W. YFL006W is now an alias of BLM10/YFL007W. Personal communication from Tim Formosa, University of Utah.
Old: 128841 TTTGATCACCCATACGATCAGGTTCGCCAG-CTGTCGCTAAACTATTGACGACCTTAGTT 128899
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
New: 128841 TTTGATCACCCATACGATCAGGTTCGCCAGGCTGTCGCTAAACTATTGACGACCTTAGTT 128900Robben J, et al. (2002) Revisiting the yeast chromosome VI DNA sequence reveals a correction merging YFL007w and YFL006w to a single ORF. Yeast 19(8):699-702 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 | ||||||
| 2003-09-26 | YFR040W | 234451 | 234451 | Deletion | G | |
| Due to the deletion of a G at 234450 on Chr VI, the coordinates of ORF YFR040W changed from 234521-237238 to 234229-237237. References: 1. Sequence verification in AB972 (S288c derivative strain) background by SGD. Old: 234421 CATGGTGATGAAGTGAAAACGGCACGTGGGAGATCAGAAGAGTCGATTTGAGAAGGATGA 234480
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
New: 234421 CATGGTGATGAAGTGAAAACGGCACGTGG-AGATCAGAAGAGTCGATTTGAGAAGGATGA 234479Luke MM, et al. (1996) The SAP, a new family of proteins, associate and function positively with the SIT4 phosphatase. Mol Cell Biol 16(6):2744-55 Jablonowski D, et al. (2001) Sit4p protein phosphatase is required for sensitivity of Saccharomyces cerevisiae to Kluyveromyces lactis zymocin. Genetics 159(4):1479-89 Kellis M, et al. (2003) Sequencing and comparison of yeast species to identify genes and regulatory elements. Nature 423(6937):241-54 Brachat S, et al. (2003) Reinvestigation of the Saccharomyces cerevisiae genome annotation by comparison to the genome of a related fungus: Ashbya gossypii. Genome Biol 4(7):R45 Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 | ||||||
| 2001-05-29 | YFL042C, YFL043C | 46151 | 46151 | Deletion | C | |
| Due to the deletion of G at chromosomal coordinate 46151, which was within the ORF YFL043C, YFL043C is now part of YFL042C. The new coordinates for YFL042C are 47744-45720. See Genbank file YSCCHRVIN. The old coordinates for YFL042C were 47745-46078, and for YFL043C were 46157-45720.
Old: 46141 CACGTTATTTCCGTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46200
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
New: 46141 CACGTTATTTC-GTCATTCCAACGGATTAGATACCTTGTCTTAGTTGAGAAACTACCACC 46199 | ||||||
| 2001-05-29 | YFL031W | 75751 | 75751 | Insertion | C | |
A single C was inserted after the C at chromosomal coordinate 75751 (see GenBank file YSCCHRVIN). In addition, a new intron was annotated at relative coordinates 662-913. As a result, the chromosomal coordinates for ORF YFL031W are now 75177-75837..76090-76145, with relative coordinates 1-661..914-969. The old chromosomal coordinates for YFL031W were 75178-75780, with old relative coordinates 1-603.
Old: 75721 AACAACAATTTGTTTGATGCGGTGGCCTCGC-GTTGGCAGACCCACTCTGCGACGATATA 75779
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
New: 75720 AACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGATATA 75779 | ||||||
| ANNOTATION CHANGES without sequence changes | Jump to: Sequence changes |
| Date | Affected Features |
|---|---|
| 2009-05-04 | RUF20, RUF21, RUF22, RUF23 |
| The following RNA features were added to the S. cerevisiae genome annotation based on Kavanaugh & Dietrich 2009: RUF20, RUF21, RUF22, and RUF23. Note that Kavanaugh & Dietrich state that the 3' ends of RUF22 and RUF23 are uncertain, meaning that these two RNAs may possibly be longer than currently annotated.Kavanaugh LA and Dietrich FS (2009) Non-Coding RNA Prediction and Verification in Saccharomyces cerevisiae. PLoS Genet 5(1):e1000321 | |
| 2008-06-02 | YFR024C-A |
| Based on the sequencing of the cloned cDNA, as the genomic DNA has an intron, Kathryn Ayscough and E.G. Allwood from the University of Sheffield conclude that the intron is not spliced at the predicted site, but rather 24 nt upstream. This annotation was updated in SGD, and as a result, the predicted protein product is 8 amino acids longer. The relative coding coordinates had been 1-47..166-1474, but are now 1-47..142-1474. Special thanks to Kathryn Ayscough and E.G. Allwood from the University of Sheffield for bringing this error to our attention.
This annotation change is also supported by RNA sequencing data from Yassour et al. 2009.Ayscough K and Allwood E (2008)  Yassour M, et al. (2009) Ab initio construction of a eukaryotic transcriptome by massively parallel mRNA sequencing. Proc Natl Acad Sci U S A 106(9):3264-9 | |
| 2007-04-04 | YFR032C-A |
| RPL29/YFR032C-A mRNA contains an intron in the 5' untranslated region (UTR).Cliften P, et al. (2003) Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 301(5629):71-6 Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51  Juneau K, et al. (2007) High-density yeast-tiling array reveals previously undiscovered introns and extensive regulation of meiotic splicing. Proc Natl Acad Sci U S A 104(5):1522-7 | |
| 2007-04-04 | YFR045W |
| Based on cDNA data from Miura et al. and sequence conservation among closely related fungal species, a new intron and 5' exon were added to YFR045W. This alters and extends the N-terminus, changing the size of the protein product from 285 to 309 amino acids. Special thanks to Michel Satre for bringing this update to our attention.Miura F, et al. (2006) A large-scale full-length cDNA analysis to explore the budding yeast transcriptome. Proc Natl Acad Sci U S A 103(47):17846-51 | |
| 2007-03-08 | ARS601, ARS602, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609 |
| ACS annotated based on Xu et al. 2006 and Shirahige et al. 1993.Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56 Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7:276 | |
| 2007-03-08 | ARS603.5 |
| ACS was annotated based on Xu et al. 2006 and Yamashita et al. 1997.Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7:276 Yamashita M, et al. (1997) The efficiency and timing of initiation of replication of multiple replicons of Saccharomyces cerevisiae chromosome VI. Genes Cells 2(11):655-65 | |
| 2007-03-08 | ARS603 |
| Both ACS's within ARS603 were annotated based on Xu et al. 2006 and Shirahige et al. 1993.Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56 Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7:276 | |
| 2007-03-08 | ARS610 |
| ARS610 was added to the genome annotation based on Xu et al. 2006.Xu W, et al. (2006) Genome-wide mapping of ORC and Mcm2p binding sites on tiling arrays and identification of essential ARS consensus sequences in S. cerevisiae. BMC Genomics 7:276 | |
| 2006-05-08 | CEN6 |
| The previously annotated 5' boundary of CEN6 was slightly adjusted to coincide with the 5' end of CDEI, to more accurately reflect current knowledge regarding centromere structure in Saccharomyces cerevisiae.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 | |
| 2006-03-02 | ARS600 |
| This ARS element ARS600 (originally published as ARS120) was added to the genome annotation based on Eisenberg et al. 1988 and Wyrick et al. 2001. ARS120 was originally added to SGD as "not in systematic sequence of S288C".Eisenberg S, et al. (1988) Specific interaction between a Saccharomyces cerevisiae protein and a DNA element associated with certain autonomously replicating sequences. Proc Natl Acad Sci U S A 85(3):743-6 Wyrick JJ, et al. (2001) Genome-wide distribution of ORC and MCM proteins in S. cerevisiae: high-resolution mapping of replication origins. Science 294(5550):2357-60 | |
| 2004-10-12 | CEN6 |
| Centromeric DNA elements CDEI, CDEII, and CDEIII were annotated based on Wieland et al. 2001 and Espelin et al. 2003.Wieland G, et al. (2001) Determination of the binding constants of the centromere protein Cbf1 to all 16 centromere DNAs of Saccharomyces cerevisiae. Nucleic Acids Res 29(5):1054-60 Espelin CW, et al. (2003) Binding of the essential Saccharomyces cerevisiae kinetochore protein Ndc10p to CDEII. Mol Biol Cell 14(11):4557-68 | |
| 2004-04-01 | RUF7 |
| Feature annotation removed per John McCutcheon and Sean Eddy.McCutcheon J and Eddy S (2004) Corrigendum: Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics Nucleic Acids Res 32 (15):4713 | |
| 2003-09-09 | TEL06L, TEL06L-TR, TEL06L-XC, TEL06L-XR, TEL06L-YP, TEL06R, TEL06R-TR, TEL06R-XC |
| The chromosomal locations for the following telomeric features on Chromosome VI were generously provided by Ed Louis and Dave Barton (University of Leicester, UK): TEL06L, TEL06L-XC, TEL06L-XR, TEL06L-TR, TEL06L-YP, TEL06R, TEL06R-XC, TEL06R-TR. | |
| 2003-07-29 | YFL013W-A, YFL031C-A, YFR032C-B, YFR034W-A |
| Thanks to Kumar et al. for providing the coordinates of the following ORFs on Chromosome VI: YFL013W-A, YFL031C-A, YFR032C-B, YFR034W-A.Kumar A, et al. (2002) An integrated approach for finding overlooked genes in yeast. Nat Biotechnol 20(1):58-63 | |
| 2003-07-29 | YFL015W-A, YFL021C-A, YFR036W-A, YFR052C-A |
| Thanks to MIPS for providing the coordinates of the following ORFs on Chromosome VI: YFL015W-A, YFL021C-A, YFR036W-A, YFR052C-A. | |
| 2003-07-29 | YFR009W-A, YFR010W-A |
| Thanks to Oshiro et al., Velculescu et al., and Basrai et al. for providing the coordinates of the following ORFs on Chromosome VI: YFR009W-A, YFR010W-A.Basrai MA, et al. (1999) NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol Cell Biol 19(10):7041-9 Velculescu VE, et al. (1997) Characterization of the yeast transcriptome. Cell 88(2):243-51 Oshiro G, et al. (2002) Parallel identification of new genes in Saccharomyces cerevisiae. Genome Res 12(8):1210-20 | |
| 2003-07-29 | YFL041W-A |
| Thanks to Kessler et al. for providing the coordinates of ORF YFL041W-A.Kessler MM, et al. (2003) Systematic discovery of new genes in the Saccharomyces cerevisiae genome. Genome Res 13(2):264-71 | |
| 2003-03-13 | YFR024C, YFR024C-A |
| YFR024C is not a genuine ORF, but is the C-terminus of LSB3/YFR024C-A. The LSB3 gene contains an intron that has been demonstrated to be spliced. The ORF YFR024C has been deleted and the name YFR024C has been made an alias for LSB3/YFR024C-A.Davis CA, et al. (2000) Test of intron predictions reveals novel splice sites, alternatively spliced mRNAs and new introns in meiotically regulated genes of yeast. Nucleic Acids Res 28(8):1700-6 | |
| 2003-03-06 | RUF7 |
Thanks to John McCutcheon and Sean Eddy for providing the coordinates for the following RNA features: SNR82, SNR83, SNR84, RUF4, RUF5-1, RUF5-2, RUF6, RUF7, and RUF8.McCutcheon JP and Eddy SR (2003) Computational identification of non-coding RNAs in Saccharomyces cerevisiae by comparative genomics. Nucleic Acids Res 31(14):4119-28  | |
| 2001-03-15 | ARS603.5 |
| Coordinates courtesy of Katsuhiro Shirahige - Personal communication | |
| 2001-03-02 | ARS601, ARS602, ARS603, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609 |
| The coordinates for the following ARS elements on Chromosome VI are courtesy of Katsuhiro Shirahige, based on Shirahige et al. 1993: ARS601, ARS602, ARS603, ARS604, ARS605, ARS606, ARS607, ARS608, ARS609.Shirahige K, et al. (1993) Location and characterization of autonomously replicating sequences from chromosome VI of Saccharomyces cerevisiae. Mol Cell Biol 13(8):5043-56 |
| Jump to: Sequence Changes | Annotation Changes without Sequence Changes |
 Return to SGD |
