Details of 2011 Reference Sequence Update

The table lists all the proteins that were altered by the Feb. 2011 reference sequence update.

ORFDescription of change
MDM10/YAL010CNucleotide change(s) in the coding region of MDM10/YAL010C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 272 is now Asparagine rather than Glutamine.
New    781   ACAGGACGACCACTAACTTTGACATTATCTTGGAATCCATTATTCGGCCATATATCCTCC  840
             ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||
Old    781   ACAGGACGACCACTAACTTTGACATTATCTTGGCAACCATTATTCGGCCATATATCCTCC  840
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
DEP1/YAL013WTwo nucleotides were deleted near the 3' end of ORF DEP1/YAL013W, altering its coding sequence.The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 15 amino acids shorter.
New: 1201 CACCAGTGGGCCCAGTG--ACCGCCACACTGGACCCCATACCAC 1242
          |||||||||||||||||  ||||||||||||||||||||||||| 
Old: 1201 CACCAGTGGGCCCAGTGTGACCGCCACACTGGACCCCATACCAC 1244
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PSK1/YAL017WNucleotide change(s) in the coding region of PSK1/YAL017W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 73 is now Glutamic Acid rather than Glutamine.
New    181   GTTTCAACCCCGAATAAAAAGGAAGGTGATGAGTTCGAGCAAAGTTTAAGAGATACATTT  240
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    181   GTTTCAACCCCGAATAAAAAGGAAGGTGATGAGTTCCAGCAAAGTTTAAGAGATACATTT  240
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ATS1/YAL020CNucleotide change(s) in the coding region of ATS1/YAL020C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 305 is now Glycine rather than Alanine.

New    901   GGCCCGCAAAAGGGCTCCCAGCCTGGACTGCAGCTCGTGGGCCAATACTCTGGAAAACCT  960
             |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||
Old    901   GGCCCGCAAAAGGCGTCCCAGCCTGGACTGCAGCTCGTGGGCCAATACTCTGGAAAACCT  960
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MAK16/YAL025CNucleotide change(s) in the coding region of MAK16/YAL025C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 250 is now Glutamic Acid rather than Glutamine.
New    721  TCTGACAGAGAAGCTTCCAGCGCCAGTGAAAGCGAAAGCGACAGTGAAAGCGAGAGCGAC  780
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    721  TCTGACAGAGAAGCTTCCAGCGCCAGTCAAAGCGAAAGCGACAGTGAAAGCGAGAGCGAC  780
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
DRS2/YAL026CNucleotide change(s) in the coding region of DRS2/YAL026C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 45-46 are now AN rather than GY, residue 450 is now Alanine rather than Arginine, residue 674 is now Proline rather than Glycine, residues 891-892 are now NT rather than KS, residues 953-954 are now GD rather than AS, and residue 987 is now Valine rather than Leucine.
New    121   TCACATGCGAACGCGAATTATATACCACCAAGTCATGTACTTCCCGAAGAGACTATCGAC  180
             |||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||
Old    121   TCACATGCGAACGGATATTATATACCACCAAGTCATGTACTTCCCGAAGAGACTATCGAC  180
New    1321  GAGAAAATTATCAACAGACAGATTATTGCATTGTTCACAGTTTTAATCGTGCTAATTTTA  1380
             |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
Old    1321  GAGAAAATTATCAACAGACAGATTATTCGATTGTTCACAGTTTTAATCGTGCTAATTTTA  1380
New    1981  GGTGGTGCAGATTTAGGGTATAAGTTTATCATCCGTAAACCAAACTCTGTAACTGTTTTA  2040
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
Old    1981  GGTGGTGCAGATTTAGGGTATAAGTTTATCATCCGTAAAGGAAACTCTGTAACTGTTTTA  2040
New    2641  AACGAGCATCAATTGTCAACACATGATATGAATACCTTAGCGCTCGTCATTGATGGGAAG  2700
             ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||
Old    2641  AACGAGCATCAATTGTCAACACATGATATGAAATCCTTAGCGCTCGTCATTGATGGGAAG  2700
New    2821  GTAAAAAGAAAGTCGTCTTCACTACTGCTAGCCATTGGCGA-TGGTGCCAACGATGTTAG  2879
             |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||
Old    2821  GTAAAAAGAAAGTCGTCTTCACTACTGCTAGCCATT-GCGAGTGGTGCCAACGATGTTAG  2879
New    2940  TCGTTCAGCTGATATAGCTGTTGGCCAATTTAAATTTTTaaaaaaaCTATTACTTGTCCA  2999
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old    2940  TCGTTCAGCTGATATAGCTCTTGGCCAATTTAAATTTTTAAAAAAACTATTACTTGTCCA  2999
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SPC72/YAL047CNucleotide change(s) in the coding region of SPC72/YAL047C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 302 is now Asparagine rather than Isoleucine.
New    901   GAAAATTTGCACAAAGAATATGATCAATTTATAAATTCCATTAGATTGAAATTCGAGAAA  960
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    901   GAAATTTTGCACAAAGAATATGATCAATTTATAAATTCCATTAGATTGAAATTCGAGAAA  960
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
OAF1/YAL051WNucleotide change(s) in the coding region of OAF1/YAL051W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 70 is now Arginine rather than Tryptophan, residue 447 is now Glutamine rather than Proline, and residue 588 is now Lysine rather than Threonine.
New    181   AGAATATTGTTTGTCTGCCAGGCTTGTAGGAAGTCAAAAACAAAGTGTGATAGAGAAAAA  240
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    181   AGAATATTGTTTGTCTGCCAGGCTTGTTGGAAGTCAAAAACAAAGTGTGATAGAGAAAAA  240
New    1321  GATTTTATTTTATTGAGTCAAAGATGTCTAGCATCGGAAAATTGGTGTGCATGCGCTAAT  1380
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Old    1321  GATTTTATTTTATTGAGTCCAAGATGTCTAGCATCGGAAAATTGGTGTGCATGCGCTAAT  1380
New    1741  CTAAGCGATATCAATAATCACAAACTTTTGAGAATTCATAAATTTACATTCAAGAGAGCC  1800
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    1741  CTAAGCGATATCAATAATCACACACTTTTGAGAATTCATAAATTTACATTCAAGAGAGCC  1800
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
FLC2/YAL053WNucleotide change(s) in the coding region of FLC2/YAL053W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 111 is now Cysteine rather than Serine, residue 312 is now Asparagine rather than Aspartic Acid, and residues 641-643 are now NDS rather than IDP.
New    301   GATTTATGTTCCTTGGGCCAAGTATCGCTTTGCCCCCTAAGTGCTGGGCGTATTGATGTC  360
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    301   GATTTATGTTCCTTGGGCCAAGTATCGCTTTCCCCCCTAAGTGCTGGGCGTATTGATGTC  360
New    901   GATTACAATTTTGACACCATTTTAGACGATTCGAATCTGTACACCACTTCTGAGAAGGAT  960
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    901   GATTACAATTTTGACACCATTTTAGACGATTCGGATCTGTACACCACTTCTGAGAAGGAT  960
New    1921  AATGATTCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAATGAAAATGAGGAA  1980
             | |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1921  ATTGATCCTGAACTGTTTGAATTGAGAAAAGCTGTTATGGACACCAATGAAAATGAGGAA  1980
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
GPB2/YAL056WNucleotide change(s) in the coding region of GPB2/YAL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 661 is now Valine rather than Isoleucine, residue 802 is now Cysteine rather than Phenylalanine, and residues 814-815 are now ED rather than AA.
New    1981  GTCAATCCAGGGAGAAAATCGTCATCTATTCCAATGACTGCGATAGGGAGACAGAGATTA  2040
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1981  ATCAATCCAGGGAGAAAATCGTCATCTATTCCAATGACTGCGATAGGGAGACAGAGATTA  2040
New    2401  CAGTGTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGAAGACGATGAGGACAGACAA  2460
             |||| ||||||||||||||||||||||||||||||||||| || ||||||||||||||||
Old    2401  CAGTTTTGGGAAGAACATAAAATTACTCTGTCCAAGAAGGCAGCCGATGAGGACAGACAA  2460
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YAL059C-ANucleotide change(s) in the coding region of YAL059C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 36 is now Alanine rather than Serine.

New    61   AAGGCCTTCACTAAACGATCCCTGTCCATGGATGAAATAGAGTTGGCCAGTTTGTCTTCC  120
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    61   AAGGCCTTCACTAAACGATCCCTGTCCATGGATGAAATAGAGTTGTCCAGTTTGTCTTCC  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ECM1/YAL059WNucleotide change(s) in the coding region of ECM1/YAL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Alanine rather than Aspartic Acid.
New    301  CTGGCCAACTCTATTTCATCCATGGACAGGGATCGTTTAGTGAAGGCCTTGAATTTTACC  360
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    301  CTGGACAACTCTATTTCATCCATGGACAGGGATCGTTTAGTGAAGGCCTTGAATTTTACC  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BDH1/YAL060WNucleotide change(s) in the coding region of BDH1/YAL060W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 322 is now Aspartic Acid rather than Alanine.
New    961   GAAGACTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATGGAAGATTGT  1020
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    961   GAAGCCTTCGAAGAAGTTGTTCGTGCCATCCACAACGGAGACATCGCCATGGAAGATTGT  1020
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YAL064WA single A nucleotide was inserted within ORF YAL064W, near its 5' end, moving the start codon out of frame with the rest of the protein. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 14 amino acids shorter.
New: 1  ATGCGAATATACTGCAACTTTTCGGCCTTTG 31
        |||||| |||||||||||||||||||||||| 
Old: 1  ATGCGA-TATACTGCAACTTTTCGGCCTTTG 30
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BUD14/YAR014CSix separate single nucleotides were inserted within ORF BUD14/YAR014C, and three single nucleotide substitutions were also made, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now two amino acids longer and a small section of the protein sequence is now different.
New:   1830   ATTTGCCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTGCCCCTCTGTGTTTTCCAC 1771
              ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| 
Old:   167043 ATTTGGCATTCCTCCACTAGACCCCAAGCTGGCTTGAATTTGCCC-TCTGTGTTTTCCAC 167101
New:   1770   GTTTGTTGTCTCTTCAATTTTCGATTTTGCATGAATATATTGTGAAATGTCCTTTATTGC 1711
              ||||||||||||| |||||||||||||||||||| ||||| ||||| ||||||| ||||| 
Old:   167102 GTTTGTTGTCTCT-CAATTTTCGATTTTGCATGA-TATAT-GTGAA-TGTCCTT-ATTGC 167156
New:   1350   CACTACATCGCTCGTATCATCATCCTGGAATTTGCCAAAATTTAACTTCGCTTCAGTGTA 1291
              |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| 
Old:   167517 CACTACATCGCTCGTATCATCATCCTGGAATTTGGCAAAATTTAACTTCGCTTCAGTGTA 167576

New:   1110   ATATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTTTGATTCTTGTTACC 1051
              ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| 
Old:   167757 ATATCCATTCAGTGCAGGTGTCGGAATTATACTCTCTGCATCACTCTGATTCTTGTTACC 167816
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CDC15/YAR019CNucleotide change(s) in the coding region of CDC15/YAR019C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 316 is now Alanine rather than Arginine, residue 321 is now Alanine rather than Proline, and 900-902 are now KDV rather than NGC.
New    901   TTTCAAGAAGAGAAACTAAATATATCACCCTCTAAATTCAGTCTTGCAGCGGCTCCCGCT  960
             |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||
Old    901   TTTCAAGAAGAGAAACTAAATATATCACCCTCTAAATTCAGTCTTCGAGCGGCTCCCGCT  960
New    961   GCCTGGGCAGAAAACAATCAAGAACTAGATTTAATGCCCCCCACTGAAAGTCAATTGCTG  1020
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    961   CCCTGGGCAGAAAACAATCAAGAACTAGATTTAATGCCCCCCACTGAAAGTCAATTGCTG  1020
New    2641  TTCAAACTTCGTGCCATTTTAGTACAAATAACGGAGTTTTTAAACAACAACTGGAACAA-  2699
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old    2641  TTCAAACTTCGTGCCATTTTAGTACAAATAACGGAGTTTTTAAACAACAACTGGAACAAC  2700
New    2700  GGATGTCCCAAAAAGGAATTCAAATCAAGTTgggggggACTCAGTTTTGATCTGTCAGCT  2759
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    2701  GGATGT-CCAAAAAGGAATTCAAATCAAGTTGGGGGGGACTCAGTTTTGATCTGTCAGCT  2759
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YAR019W-AA single C nucleotide was inserted very near the 3' end of ORF YAR019W-A, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 4 amino acids shorter.
New: 301 ACAGCAAAGTCCGCACAGAGCACTACAGTATAG 333
         ||||||||||| ||||||||||||||||||||| 
Old: 301 ACAGCAAAGTC-GCACAGAGCACTACAGTATAG 332
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YAR023CNucleotide change(s) in the coding region of YAR023C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 20 is now Phenylalanine rather than Valine, and residue 46 is now Phenylalanine rather than Isoleucine.
New    1    ATGATCAATTTCCTCCTTTTTGTCTTGACGATTTTGGCGACTTTAACAAACATTTGGTTT  60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old    1    ATGATCAATTTCCTCCTTTTTGTCTTGACGATTTTGGCGACTTTAACAAACATTTGGGTT  60
New    61   TCTGGTGTTCTCTCCCCTGCCATGGTGATCCGGATATGTTTAGGTGGCTCTATGGTAGTC  120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    61   TCTGGTGTTCTCTCCCCTGCCATGGTGATCCGGATATGTTTAGGTGGCTCTATGGTAGTC  120
New    121  CTTCAGATATGGTCATTCAGTAGACCAATAAGTAATGAAACATTCCGTACAAAACTTCTA  180
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    121  CTTCAGATATGGTCAATCAGTAGACCAATAAGTAATGAAACATTCCGTACAAAACTTCTA  180
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
HIR1/YBL008WNucleotide change(s) in the coding region of HIR1/YBL008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 260 is now Valine rather than Methionine.
New    721   TCTCCCGATGGGCAACATATTGCAGTTCCGAACGCCACTAATGGGCCCGTAAGTTCTGTG  780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old    721   TCTCCCGATGGGCAACATATTGCAGTTCCGAACGCCACTAATGGGCCCGTAAGTTCTATG  780
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RRN6/YBL014CNucleotide change(s) in the coding region of RRN6/YBL014C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 39 is now Lysine rather than Asparagine.
New    61    CAAGGCGCCAGTCTTTACTGTCCGCAAGAAAATTACACTACGAAGAAGCAAGAAAAGCCA  120
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Old    61    CAAGGCGCCAGTCTTTACTGTCCGCAAGAAAATTACACTACGAAGAAGCAAGAAAACCCA  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PTC3/YBL056WNucleotide change(s) in the coding region of PTC3/YBL056W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 369 is now Glycine rather than Aspartic Acid.
New    1081  ATTGATGATCTTGATACCGAATTAGGCAGCAGTGCTACTCCCTCAAAGTTATCAGGTGAG  1140
             ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||
Old    1081  ATTGATGATCTTGATACCGAATTGGACAGCAGTGCTACTCCCTCAAAGTTATCAGGTGAG  1140
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PTH2/YBL057COne nucleotide was deleted within ORF PTH2/YBL057C, near its 5' end, altering its coding sequence. The stop and reading frame remain the same, but the start has been moved 18 nucleotides downstream and the annotated protein sequence is now six amino acids shorter.
New: ATTCGAAGAAACTGTCATCTTTTCCATTAAAAAG-ACGTTATCATGTTACTCCGCTGTCA 
     |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| 
Old: ATTCGAAGAAACTGTCATCTTTTCCATTAAAAAGGACGTTATCATGTTACTCCGCTGTCA
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
UBP13/YBL067CNucleotide change(s) in the coding region of UBP13/YBL067C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glutamine rather than Histidine.

New    481   CTGTCCTCATTACGTGAAAATATATTGCAATTTCCaaaaaaaTCAAGAGAATCTGATCAA  540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old    481   CTGTCCTCATTACGTGAAAATATATTGCAATTTCCAAAAAAATCAAGAGAATCTGATCAC  540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PRS4/YBL068WOne nucleotide substitution and one trinucleotide deletion were made with the ORF PRS4/YBL068W, altering its coding sequence. The start, stop, and reading frame remain the same, but the annotated protein is now one amino acid shorter.
New  481  CCAAGTGTTTTAAATTATATTAGAAC---GAAAACAGATTTCGACAATGCTATTTTGGTG  537
          |||||||||||||||||||||||| |   |||||||||||||||||||||||||||||||
Old  481  CCAAGTGTTTTAAATTATATTAGAGCCCGGAAAACAGATTTCGACAATGCTATTTTGGTG  540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PET112/YBL080CNucleotide change(s) in the coding region of PET112/YBL080C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 415 is now Proline rather than Alanine.
New    1201  AACAAGCTACAAATTCCATTGGCCAAAGCAAAAGAAATTTTGCCTCCTCCGGTTTTCGCC  1260
             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    1201  AACAAGCTACAAATTCCATTGGCCAAAGCAAAAGAAATTTTGGCTCCTCCGGTTTTCGCC  1260
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CDC27/YBL084CNucleotide change(s) in the coding region of CDC27/YBL084C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 430 is now Serine rather than Glutamine.

New    1261  AGTAACTCAATACTAACGAGTGATTATTCAATTACGCTGCCTGAAATCATGTATAATTTC  1320
             |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
Old    1261  AGTAACTCAATACTAACGAGTGATTATCAAATTACGCTGCCTGAAATCATGTATAATTTC  1320
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
TEL1/YBL088CNucleotide change(s) in the coding region of TEL1/YBL088C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1412 is now Cysteine rather than Phenylalanine.
New    4201  CGGGATCTCATCAAAATAAAAACTTGGAAATACTGCCTTGATGCAATATTCGGAAATATA  4260
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    4201  CGGGATCTCATCAAAATAAAAACTTGGAAATACTTCCTTGATGCAATATTCGGAAATATA  4260
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MAP2/YBL091CNucleotide change(s) in the coding region of MAP2/YBL091C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 86 is now Aspartic Acid rather than Valine.
New    241   CTGCAAAGAACCACGGATGAAGAATCACGTTATTTGAAAAGGGATCTGGAAAGGGCCGAA  300
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    241   CTGCAAAGAACCACGGTTGAAGAATCACGTTATTTGAAAAGGGATCTGGAAAGGGCCGAA  300
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BRN1/YBL097WNucleotide change(s) in the coding region of BRN1/YBL097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 517 is now Glycine rather than Alanine.

New    1501  GACTTCCATTTTTCCACTGATAGAATAACAAGATTGTTCATTAAACCGGGGCAGAAAATG  1560
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    1501  GACTTCCATTTTTCCACTGATAGAATAACAAGATTGTTCATTAAACCGGCGCAGAAAATG  1560
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ATP1/YBL099WNucleotide change(s) in the coding region of ATP1/YBL099W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 340 is now Serine rather than Proline.
New    961   TTGTTGAGACGTCCTCCTGGTCGTGAAGCCTACCCTGGTGATGTCTTTTACTTGCATTCA  1020
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old    961   TTGTTGAGACGTCCTCCTGGTCGTGAAGCCTACCCTGGTGATGTCTTTTACTTGCATCCA  1020
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PKC1/YBL105CNucleotide change(s) in the coding region of PKC1/YBL105C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 81 is now Cysteine rather than Phenylalanine, residue 621 is now Arginine rather than Lysine, and residue 789 is now Alanine rather than Proline.
New    241   TGCAATTCGAAGGAATACGGGTTTCTTTCTACCAAATCGCCAAATGAACACATATTTTCT  300
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    241   TTCAATTCGAAGGAATACGGGTTTCTTTCTACCAAATCGCCAAATGAACACATATTTTCT  300
New    1861  AGAATTTCACTACAAACGCACGGGCGTGAGAAACTAAATAAATTTATCGATGAAAATGAG  1920
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1861  AAAATTTCACTACAAACGCACGGGCGTGAGAAACTAAATAAATTTATCGATGAAAATGAG  1920
New    2341  TCCTTGGCTCCTACAAGTACTCATGCCTCCAGAACCACTGATCAACAATCTCCGCAGAAA  2400
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    2341  TCCTTGGCTCCTACAAGTACTCATCCCTCCAGAACCACTGATCAACAATCTCCGCAGAAA  2400
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SRO77/YBL106CNucleotide change(s) in the coding region of SRO77/YBL106C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 130 is now Isoleucine rather than Phenylalanine, residue 135 is now Serine rather than Proline, residue 260 is now Serine rather than Alanine, residue 834 is now Glycine rather than Valine, residue 858 is now Threonine rather than Serine, and 943 is now Glutamic Acid rather than Lysine.
New    361   GTTTTCTGTCCAAACAGCATCACTTGTATTGAGACTGATCCGTCCTTGGATTGGATGCTG  420
             ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||
Old    361   GTTTTCTGTCCAAACAGCATCACTTGTTTTGAGACTGATCCGCCCTTGGATTGGATGCTG  420
New    721   ATTCAGTCACTTTATCACCCAAATTCCTTACATATATTAACTGTCCATGAAGATAATTCC  780
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Old    721   ATTCAGTCACTTTATCACCCAAATTCCTTACATATATTAACTGTCCATGAAGATAATGCC  780
New    2461  AGCGCTCAATACGTTGAAAATTCATCTATATTAGAAAATGGTGACATTGTCATTCGCACA  2520
             |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    2461  AGCGCTCAATACGTTGAAAATTCATCTATATTAGAAAATGTTGACATTGTCATTCGCACA  2520
New    2521  GGGAAATTCCAAGCCTCTTTGATTTCAGTACTTAATGAAAGTGCCACCGGAACGAATCAT  2580
             |||||||||||||| |||||||||||||||||||||||||||||||||||  ||||||||
Old    2521  GGGAAATTCCAAGCTTCTTTGATTTCAGTACTTAATGAAAGTGCCACCGGTTCGAATCAT  2580
New    2821  GGTACGGAAGATCACAGGTATGCCAGACCTGTAAGAAGCTCTGGAAGAAGTAATGGATAT  2880
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    2821  GGTACGAAAGATCACAGGTATGCCAGACCTGTAAGAAGCTCTGGAAGAAGTAATGGATAT  2880
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
GPI18/YBR004CNucleotide change(s) in the coding region of GPI18/YBR004C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 187 is now Serine rather than Threonine.
New    541   ATTTGGAGTCGTGAATGCTCCATTTCCGTGCCCGTATTGGGTCAATTCGATATTTCGTGG  600
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    541   ATTTGGAGTCGTGAATGCACCATTTCCGTGCCCGTATTGGGTCAATTCGATATTTCGTGG  600
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
DSF2/YBR007CNucleotide change(s) in the coding region of DSF2/YBR007C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 205 is now Serine rather than Arginine, and residue 327 is now Proline rather than Threonine.
New    601   AGAAGCACAAATAGCCCTAATCCTTTCAACTTCGAGAAATATAGGATTGAAAATACTAGA  660
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    601   AGAAGCACAAATAGGCCTAATCCTTTCAACTTCGAGAAATATAGGATTGAAAATACTAGA  660

New    961   ACTAAGAGTGATACAACACCCATCAAACCATCTCCTAAACGGTCTAATTCCTCTACCTCG  1020
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    961   ACTAAGAGTGATACAACAACCATCAAACCATCTCCTAAACGGTCTAATTCCTCTACCTCG  1020
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
QDR3/YBR043CNucleotide change(s) in the coding region of QDR3/YBR043C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 37 is now Serine rather than Threonine.
New    61    TCACTACCGAACAATCATGTTATGATGCACTGCGATGAAAGCAGCGGCAGCCCGCACAGC  120
             |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||
Old    61    TCACTACCGAACAATCATGTTATGATGCACTGCGATGAAAGCAGCGGCACGCCGCACAGC  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
TCM62/YBR044COne nucleotide was deleted within ORF TCM62/YBR044C, very near its 3' end, altering its coding sequence. The start, stop, and majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now one amino acid shorter.
New  1681  ACATGTGTATACAAAAAGCCTGAACGGCACAAAGCCTAG      1719
           |||||||||||| ||||||||||||||||||||||||||
Old  1681  ACATGTGTATAC-AAAAGCCTGAACGGCACAAAGCCTAGATAA  1722
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
GIP1/YBR045CA single nucleotide was inserted within ORF GIP1/YBR045C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 66 amino acids longer.
New:   1740   GCTTAGTTGCTCTCCTCTCAGTCTATAATTTTCTGCTTCATTTCTCTGCCTTTTATACTC 1681
              ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| 
Old:   328352 GCTTAGTTGCTCTCCTCTCAGTCTATAATTT-CTGCTTCATTTCTCTGCCTTTTATACTC 328410
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BAP2/YBR068CNucleotide change(s) in the coding region of BAP2/YBR068C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 139 is now Valine rather than Glutamic Acid, and residue 203 is now Tryptophan rather than Glycine.
New    361   CTACATTACGGTGGTCCTGCTGCGCTAATAATTGGTTACATCTTGGTTTCTTTCGTGACG  420
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Old    361   CTACATTACGGTGGTCCTGCTGCGCTAATAATTGGTTACATCTTGGTTTCTTTCGAGACG  420
New    601   CAATTTTGGAATGATAAAATAAATCCGGACATTTATATTCTTATTTTCTATGTTTTCTTA  660
             |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    601   CAATTTGGGAATGATAAAATAAATCCGGACATTTATATTCTTATTTTCTATGTTTTCTTA  660
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RDH54/YBR073WNucleotide change(s) in the coding region of RDH54/YBR073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 752 is now Alanine rather than Arginine.
New    2221  AAATCGGGAGGTGTAGGATTGAATCTAGTCGGTGCTTCGCGACTTATTTTATTTGATAAT  2280
             |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
Old    2221  AAATCGGGAGGTGTAGGATTGAATCTAGTCGGTCGTTCGCGACTTATTTTATTTGATAAT  2280
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YBR074WNucleotide change(s) in the coding region of YBR074W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 832 is now Asparagine rather than Phenylalanine.
New    2461  ATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGAACAGGGCTTGCACTTTAACTTTTGAA  2520
             |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
Old    2461  ATAGTTGCAGAGTTACTTTTGGAGGTGAAGGAGTTCAGGGCTTGCACTTTAACTTTTGAA  2520
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ECM8/YBR076WA single G nucleotide was deleted near the 3' end, and a single A nucleotide was inserted near the 5' end of ORF ECM8/YBR076W, altering its coding sequence. The ORF was extended 49 amino acids at the N-terminus and shortened 34 amino acids at the C-terminus, resulting in a protein that is 15 amino acids larger. Although this protein is altered at both ends, the central portion of the protein remains the same.
New: 1  AAAGGAAAATATT-CAACGATAGCGAAAATTT 31
        ||||||||||||| |||||||||||||||||| 
Old: 61 AAAGGAAAATATTGCAACGATAGCGAAAATTT 92
New: 1   ATAACAAAAAGCAATTGATTGTGTAC 26
         ||||||||| |||||||||||||||| 
Old: 901 ATAACAAAA-GCAATTGATTGTGTAC 925
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ECM33/YBR078WOne nucleotide was inserted within ORF ECM33/YBR078W, very near its 3' end, altering its coding sequence. The start, stop, and vast majority of reading frame remain the same, but the C-terminus is different and the annotated protein sequence is now 39 amino acids shorter.
New  1561  CTTGTTCCAGCCACTTCATTCATGGGTGTCGTTGCTGCTGTTGGCGTTGCCTTACTATAA  1620
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old  1561  CTTGTTCCAGCCACTTCATTCATGGGTGTCGTTGCTGCTGTTGGCGTTG-CTTACTATAA  1619
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
NHP6B/YBR089C-ANucleotide change(s) in the coding region of NHP6B/YBR089C-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 30 is now Glycine rather than Arginine.
New    61   AAGAAGGATCCTAACGCCCCTAAGAGGGGCTTGTCAGCTTATATGTTCTTTGCTAATGAA  120
            ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||
Old    61   AAGAAGGATCCTAACGCCCCTAAGAGGCGGTTGTCAGCTTATATGTTCTTTGCTAATGAA  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YBR090CNucleotide change(s) in the coding region of YBR090C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 101 is now Alanine rather than Glycine.
New    241  CAAAGGAACCAAAGAAGAGGACCACCAGGAGAAAGAAGGATCCTAACGCCCCTAAGAGGG  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old    241  CAAAGGAACCAAAGAAGAGGACCACCAGGAGAAAGAAGGATCCTAACGCCCCTAAGAGGC  300
New    301  GCTTGTCAGCTTATATGTTCTTTGCTAATGAAAACAGAGACATTGTCCGTTCCGAGAATC  360
            | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    301  GGTTGTCAGCTTATATGTTCTTTGCTAATGAAAACAGAGACATTGTCCGTTCCGAGAATC  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PBY1/YBR094WNucleotide change(s) in the coding region of PBY1/YBR094W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 450 is now Alanine rather than Arginine.

New    1321  GAATCATTCACTATTGATTTAGATTATGCTGAATTTCTAGACGACGCATTAGATGAAAAT  1380
             |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
Old    1321  GAATCATTCACTATTGATTTAGATTATCGTGAATTTCTAGACGACGCATTAGATGAAAAT  1380
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
VPS15/YBR097WNucleotide change(s) in the coding region of VPS15/YBR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 134 is now Alanine rather than Threonine, and residue 851 is now Arginine rather than Isoleucine.
New    361   GACATTGAACTGAAATTCATTGCTTTCCAGTTGTTAAATGCATTAAAGGACATTCATAAT  420
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Old    361   GACATTGAACTGAAATTCATTGCTTTCCAGTTGTTAAATACATTAAAGGACATTCATAAT  420
New    2521  AACAAGGAAATTCCCTTAACTGCTGAAGACAGAAATTGGATTGATAAGTTCCACATTATT  2580
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    2521  AACAAGGAAATTCCCTTAACTGCTGAAGACATAAATTGGATTGATAAGTTCCACATTATT  2580
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
AIM3/YBR108WNucleotide change(s) in the coding region of AIM3/YBR108W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 515 is now Valine rather than Alanine.
New    1501  AGTACCTCCAAGTCGTCCATTTTAGGACATTATGATGTAGATGTCAACATCATGCCACCT  1560
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    1501  AGTACCTCCAAGTCGTCCATTTTAGGACATTATGATGTAGATGCCAACATCATGCCACCT  1560
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
GRS1/YBR121CNucleotide change(s) in the coding region of GRS1/YBR121C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 563-564 are now TT rather than HH.
New    1681  CCTGTTACTACTGAAGTCGCCAAAATCTTAAGAAAGTCTCAAATCCCATTTAAGATTGAT  1740
             ||||||  |  |||||||||||||||||||||||||||||||||||||||||||||||||
Old    1681  CCTGTTCATCATGAAGTCGCCAAAATCTTAAGAAAGTCTCAAATCCCATTTAAGATTGAT  1740
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YBR137WNucleotide change(s) in the coding region of YBR137W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 110 is now Glycine rather than Serine.
New    301  TCAAGTTTCTATATGGGCTGCAAGAAAGGTGACAAAACACCGGAGGAAAAGTTTTTTGTG  360
            ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    301  TCAAGTTTCTATATGGGCTGCAAGAAAAGTGACAAAACACCGGAGGAAAAGTTTTTTGTG  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YBR138CNucleotide change(s) in the coding region of YBR138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Cysteine.
New    361   CAATTGATAGGTGCCAAGCCTAAAATTCCATCCAAATTGTACCAATCTGTTTCCAAATTA  420
             ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    361   CAATGTATAGGTGCCAAGCCTAAAATTCCATCCAAATTGTACCAATCTGTTTCCAAATTA  420
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YBR141CNucleotide change(s) in the coding region of YBR141C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 312 is now Proline rather than Serine.
New    901   TTGTACTATTGTTTGTATCAATTGCAGGTAGTTCCACCGCAGCCGAGTAGCTTTTCCAAA  960
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    901   TTGTACTATTGTTTGTATCAATTGCAGGTAGTTTCACCGCAGCCGAGTAGCTTTTCCAAA  960
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MCM7/YBR202WNucleotide change(s) in the coding region of MCM7/YBR202W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 552-558 is now GINTTLN rather than VINTNPG, and residue 574 is now Tyrosine rather than Isoleucine.
New    1621  ATGGAACAACAAACAATTTCGATATCCAAGGCGGGTATCAATACAACTTTGAACGCCAGA  1680
             |||||||||||||||||||||||||||||||||| ||||||||||| |  |  |||||||
Old    1621  ATGGAACAACAAACAATTTCGATATCCAAGGCGGTTATCAATACAAATCCGGGCGCCAGA  1680
New    1681  ACCTCAATCTTAGCGGCAGCAAATCCGTTGTATGGTAGATATAATCCTAGATTATCACCT  1740
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
Old    1681  ACCTCAATCTTAGCGGCAGCAAATCCGTTGTATGGTAGAATTAATCCTAGATTATCACCT  1740
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
COS111/YBR203WNucleotide change(s) in the coding region of COS111/YBR203W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 727-731 are now TFRQH rather than SWRND, residue 917 is now Asparagine rather than Serine, and residue 921 is now Glutamic Acid rather than Glycine.
New    2161  AAGTATTTTGTAATGAGGACGTTTCGCCAGCATTTGGATTATAAATCCATGGAAAACAAC  2220
             |||||||||||||||||||  |  ||  |  |||||||||||||||||||||||||||||
Old    2161  AAGTATTTTGTAATGAGGAGCTGGCGAAACGATTTGGATTATAAATCCATGGAAAACAAC  2220
New    2701  TTAAAGGAGTTGAGGAGAGTTGATCTAAGGAGAAATGTTGGCGAAAATAACTACTATGCT  2760
             |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||
Old    2701  TTAAAGGAGTTGAGGAGAGTTGATCTAAGGAGAAATGTTGGCGAGAATAGCTACTATGCT  2760
New    2761  GAAAGCATCATAT  2773
             | |||||||||||
Old    2761  GGAAGCATCATAT  2773
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YBR204CNucleotide change(s) in the coding region of YBR204C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 63 is now Valine rather than Glutamic Acid.
New    181   TTTAATGTACAACTATCGGATCGAAATTCAAGAATAAGGACGTGTCACAACTTGAGCGAT  240
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    181   TTTAATGAACAACTATCGGATCGAAATTCAAGAATAAGGACGTGTCACAACTTGAGCGAT  240
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
FTH1/YBR207WNucleotide change(s) in the coding region of FTH1/YBR207W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 18 is now Glutamic Acid rather than Lysine, residue 36 is now Glycine rather than Aspartic Acid, residue 228 is now Glutamic Acid rather than Glutamine, residues249-250 are now VF rather than YS, residue 334 is now Glycine rather than Glutamic Acid, residues 389-390 are now IC rather than KY, and residues 399-401 are now EKY rather than GKC.
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
TSC10/YBR265WNucleotide change(s) in the coding region of TSC10/YBR265W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 255 is now Aspartic Acid rather than Glutamic Acid.

New    721  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGATGACGTTTTTACAGAT  780
            |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    721  CAAGCATGTGATATCATTGCCAAGTCGCTGGCCAGAGGTGATGAAGACGTTTTTACAGAT  780
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SLM6/YBR266CNucleotide change(s) in the coding region of SLM6/YBR266C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 31 is now Serine rather than Threonine.
New    61   TGTTCCAGTGGAATATCGACTCTGTTGCGTAGCTTTTCTTGCATTACTCTTTCCGCCATT  120
            |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||
Old    61   TGTTCCAGTGGAATATCGACTCTGTTGCGTACGTTTTCTTGCATTACTCTTTCCGCCATT  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
REI1/YBR267WNucleotide change(s) in the coding region of REI1/YBR267W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now KL rather than NV.
New    421   GAGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAAGCTACGCAACAGAGTCGATATTCCA  480
             |||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||
Old    421   GAGGAAGAAATGGCGGAAAGAGTAATGCAAGAAAACGTACGCAACAGAGTCGATATTCCA  480
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BIT2/YBR270CNucleotide change(s) in the coding region of BIT2/YBR270C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 152-153 are now SG rather than RA.

New    421   AATTCAAAAGATAATATGAGAAATCGAAGCAGGAGCGGGTCAAAAAACTACGGCACTGTT  480
             ||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||
Old    421   AATTCAAAAGATAATATGAGAAATCGAAGCAGGAGGGCGTCAAAAAACTACGGCACTGTT  480
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RIF1/YBR275CNucleotide change(s) in the coding region of RIF1/YBR275C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 732 is now Alanine rather than Threonine.
New    2161  GAATACGATAAAATCATGAAAGTTGTGTTCCAGGCTGTTGAAGTAGCCATTTCTAACGTT  2220
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    2161  GAATACGATAAAATCATGAAAGTTGTGTTCCAGACTGTTGAAGTAGCCATTTCTAACGTT  2220
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YBR285WNucleotide change(s) in the coding region of YBR285W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 55 is now Aspartic Acid rather than Histidine.
New    121  TTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCAGATAGAGAAATGGCTACA  180
            |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    121  TTAGAAAGCCCCACTGACGATAGCATGGAGGCGGACATTTCACATAGAGAAATGGCTACA  180
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
APM3/YBR288CNucleotide change(s) in the coding region of APM3/YBR288C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 35-36 are now QS rather than RT.

New    61    GGTGCAACAGCTCCCTCCTTCAAGCACCTGTGGACCCGCGTTCAGTCCACATGTCCTCAA  120
             |||||||||||||||||||||||||||||||||||||||||||   ||||||||||||||
Old    61    GGTGCAACAGCTCCCTCCTTCAAGCACCTGTGGACCCGCGTTCGTACCACATGTCCTCAA  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SNF5/YBR289WNucleotide change(s) in the coding region of SNF5/YBR289W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 564 is now Aspartic Acid rather than Glutamic Acid.
New    1681  TTTGAGTGGGACATCTCTAATAGTGATAACTGTCCAGAAGAGTTTGCAGAGTCCATGTGT  1740
             ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old    1681  TTTGAGTGGGAGATCTCTAATAGTGATAACTGTCCAGAAGAGTTTGCAGAGTCCATGTGT  1740
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PCA1/YBR295WNucleotide change(s) in the coding region of PCA1/YBR295W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 382 is now Histidine rather than Threonine.
New    1141  GGACACTCTTCGAGTGAAATTTCAAGAATCGTATCAATGGAACCAATTGAAAATCATCTT  1200
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1141  GGAACCTCTTCGAGTGAAATTTCAAGAATCGTATCAATGGAACCAATTGAAAATCATCTT  1200
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YCL002CA single T nucleotide was inserted within ORF YCL002C, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 12 amino acids longer.
New:  661  ATACAATTTGTCACCTTATTGGTCATACTTTGTCAAGTTCAGTATGTTTACGTAG  715
           ||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old:  779  ATACAATTTGTCACC-TATTGGTCATACTTTGTCAAGTTCAGTATGTTTACGTAG  832
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PAT1/YCR077CNucleotide change(s) in the coding region of PAT1/YCR077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Aspartic Acid rather than Valine.
New    2041  TTCCCTCCAAGGGAATATAACGACCACATCATGCGTTTACAAAATGACAAGTTTATGGAT  2100
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    2041  TTCCCTCCAAGGGAATATAACGTCCACATCATGCGTTTACAAAATGACAAGTTTATGGAT  2100
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
KIN82/YCR091WNucleotide change(s) in the coding region of KIN82/YCR091W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Valine rather than Methionine.
New    1021  GTGAGGGAACGCGATACCAACCAGATATTCGCCCTGAAAGTTTTGAATAAACATGAGATG  1080
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1021  ATGAGGGAACGCGATACCAACCAGATATTCGCCCTGAAAGTTTTGAATAAACATGAGATG  1080
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MPS1/YDL028CNucleotide change(s) in the coding region of MPS1/YDL028C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 211-213 are now TKR rather than RRE.

New    601   GAGGATTCTCACCAAACAAACTTTAAAGAAACGAAGAGA-AATACGGATTATGATTCAAT  659
             |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||
Old    601   GAGGATTCTCACCAAACAAACTTTAAAGAA-CGAAGAGAGAATACGGATTATGATTCAAT  659
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
DBP10/YDL031WNucleotide change(s) in the coding region of DBP10/YDL031W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 733-741 are now SHSIEDEIL rather than HILSKMKFW, residue 746 is now Glycine rather than Valine, and residue 764 is now Aspartic Acid rather than Histidine.
New    2161  AGGGAACTATTAGAAAAGGAAAGAATGGCTGGTCTTTCACATTCTATCGAAGATGAAATT  2220
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Old    2161  AGGGAACTATTAGAAAAGGAAAGAATGGCTGGTC-TTCACATTCTATCGAAGATGAAATT  2219
New    2221  TT-GAAAGGTGACGATGGTGAGACAGGTTACACCGTGTCAGAGGATGCCTTAAAAGAATT  2279
             || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    2220  TTGGAAAGGTGACGATGTTGAGACAGGTTACACCGTGTCAGAGGATGCCTTAAAAGAATT  2279
New    2280  TGAAGATGCGGACCAATTATTAGAAGCACAGgaaaacgaaaacaaaaagaaaaagaaaCC  2339
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    2280  TGAAGATGCGCACCAATTATTAGAAGCACAGGAAAACGAAAACAAAAAGAAAAAGAAACC  2339
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
POL3/YDL102WNucleotide change(s) in the coding region of POL3/YDL102W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 78-79 are now EL rather than DV.
New    181   GCAAAGGATACAGATTTAATGGGTACGCAATTAGAGTCTACTTTTGAACAAGAGCTATCG  240
             |||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||
Old    181   GCAAAGGATACAGATTTAATGGGTACGCAATTAGAGTCTACTTTTGAACAAGACGTATCG  240
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
UFD2/YDL190CNucleotide change(s) in the coding region of UFD2/YDL190C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 102 is now Leucine rather than Serine, and residue 677 is now Valine rather than Aspartic Acid.

New    301   GCCTTACAAATAGAAAACTTTTGCATGAATGGTGCTTTCATCAATTATATCACTGGAATT  360
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    301   GCCTCACAAATAGAAAACTTTTGCATGAATGGTGCTTTCATCAATTATATCACTGGAATT  360
New    1981  CAATTGATCTGGCAGTCTCAAAACAATGCTGACTTTTTTGTGAGGTTCGTTGCTCGTATG  2040
             ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    1981  CAATTGATCTGGCAGTCTCAAAACAATGCTGACTTTTTTGTGAGGTTCGATGCTCGTATG  2040
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SEC31/YDL195WNucleotide change(s) in the coding region of SEC31/YDL195W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Threonine rather than Serine.
New    1081  GAATCAAAAGAGAAGCCAACTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCA  1140
             |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Old    1081  GAATCAAAAGAGAAGCCATCTGTTTTCCATTTACAAGCCCCAACTTGGTATGGGGAACCA  1140
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
AIM6/YDL237WNucleotide change(s) in the coding region of AIM6/YDL237W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 44 is now Asparagine rather than Aspartic Acid.
New    121   AAAATATCGAATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAG  180
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Old    121   AAAATATCGGATATTGATAACTTTGGGTTGACCGGTCAACATCTTTTAGAATTTTTCCAG  180
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ADY3/YDL239CNucleotide change(s) in the coding region of ADY3/YDL239C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 569 is now Glutamic Acid rather than Glycine.
New    1681  caaaaactgaagagcgagttaaaagaaaaattaatactaagtgaaaaaattcagaaaaat  1740
             ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Old    1681  CAAAAACTGAAGAGCGAGTTAAAAGGAAAATTAATACTAAGTGAAAAAATTCAGAAAAAT  1740
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
LRG1/YDL240WNucleotide change(s) in the coding region of LRG1/YDL240W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 531 is now Glutamine rather than Histidine.
New    1561  AACTCTTTACAGAGTACTATGCTAAAGGAACAAACTTACATTAGGACACTGAATGATATT  1620
             |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    1561  AACTCTTTACAGAGTACTATGCTAAAGGAACACACTTACATTAGGACACTGAATGATATT  1620
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YDR215CA single C nucleotide was inserted within ORF YDR215C, altering its coding sequence. The start and first half of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 10 amino acids longer.

New:  181  ACTAGGGCCCGCCCTTTCGGCAATCATTCTAGCATGTTCCGCATGTTCCTTGACGCCATG  240
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Old:  181  ACTAGGGCCCG-CCTTTCGGCAATCATTCTAGCATGTTCCGCATGTTCCTTGACGCCATG  239
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ATP22/YDR350CA single nucleotide was inserted within ORF ATP22/YDR350C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 73 amino acids longer.
New:   1815    AAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTCCTTTTTCGTCTCTCATTTT 1756
               ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| 
Old:   1176355 AAAGCCCCCGAAGAGTATCTTATTGTACCAGGAGCGTGCTC-TTTTTCGTCTCTCATTTT 1176413
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
OPI7/YDR360WA single C nucleotide was inserted within ORF OPI7/YDR360W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
New:  361  ACGCCTACGGGTAATAGCCGGCCTTTGA  388
           ||| ||||||||||||||||||||||||
Old:  361  ACG-CTACGGGTAATAGCCGGCCTTTGA  387
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ERD1/YDR414CNucleotide change(s) in the coding region of ERD1/YDR414C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 168 is now Alanine rather than Glycine.

New    481   TCTGACACGTTGACATCGTTTGCAAAACCATTGATAGACTTCACATTGTTTACCTCTCTA  540
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    481   TCTGACACGTTGACATCGTTTGGAAAACCATTGATAGACTTCACATTGTTTACCTCTCTA  540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
UGO1/YDR470CNucleotide change(s) in the coding region of UGO1/YDR470C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 114 is now Glutamic Acid rather than Glycine.
New    301   GCGGAATTGGTTAACATCCAGAAATGGCGAAAAATATTTGAACAACTGCTGGATATGTTT  360
             |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    301   GCGGAATTGGTTAACATCCAGAAATGGCGAAAAATATTTGGACAACTGCTGGATATGTTT  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PSP1/YDR505CNucleotide change(s) in the coding region of PSP1/YDR505C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 532 is now Lysine rather than Glutamic Acid.
New    2161  ATTTTAAACGCAGAATTCCAATTTGATAGAAAGAAATTAACGTTTTACTACGTTTGTGAG  2220
             ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Old    2161  ATTTTAAACGCAGAATTCCAATTTGATAGAAAGGAATTAACGTTTTACTACGTTTGTGAG  2220
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RBA50/YDR527WNucleotide change(s) in the coding region of RBA50/YDR527W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 192-194 are now EEA rather than GEG.

New    541   TTTgaagaagcaggaaaagaaaaagacgtggaagaagaagcaaaaaCTAATGATGACGTC  600
             |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||
Old    541   TTTGAAGAAGCAGGAAAAGAAAAAGACGTGGAAGGAGAAGGAAAAACTAATGATGACGTC  600
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YDR541CNucleotide change(s) in the coding region of YDR541C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 341 is now Glutamine rather than Glutamic Acid.
New    1021  CAGAACAGATTATGA  1035
              ||||||||||||||
Old    1021  GAGAACAGATTATGA  1035
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YEN1/YER041WNucleotide change(s) in the coding region of YEN1/YER041W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 59 is now Alanine rather than Proline.
New    121   GACGCATATGGATGGCTATTTGAGTGTGGATTTATCCAAAATATAGATATAAGCGCCAGA  180
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old    121   GACGCATATGGATGGCTATTTGAGTGTGGATTTATCCAAAATATAGATATAAGCCCCAGA  180
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CEM1/YER061CNucleotide change(s) in the coding region of CEM1/YER061C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 367 is now Alanine rather than Arginine.

New    1081  GGCCATCTTTTAGGTGCAGCTGGCGCCGTAGAAAGTATATTTACAATTTGTTCCTTGAAG  1140
             ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||
Old    1081  GGCCATCTTTTAGGTGCACGTGGCGCCGTAGAAAGTATATTTACAATTTGTTCCTTGAAG  1140
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ALD5/YER073WNucleotide change(s) in the coding region of ALD5/YER073W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 411 is now Glutamic Acid rather than Glycine.
New    1201  GTCAAGCCAACAGTGTTTGCTGATGTCAAAGAAGATATGAGAATTGTTAAGGAGGAAGTG  1260
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    1201  GTCAAGCCAACAGTGTTTGCTGATGTCAAAGGAGATATGAGAATTGTTAAGGAGGAAGTG  1260
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PTP3/YER075CNucleotide change(s) in the coding region of PTP3/YER075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 717 is now Alanine rather than Proline, and residue 738 is now Lysine rather than Q, and residue 857 is now Glutamine rather than Glutamic Acid.
New    2101  gataatgataatgacaacaataataataacaataacaatagtaataTTGCTGTTACTGCT  2160
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    2101  GATAATGATAATGACAACAATAATAATAACAATAACAATAGTAATATTCCTGTTACTGCT  2160
New    2161  GCTGCTTGtgatgatgatgatgatgatgatgatgaCGCAATTCTCATAAGAAAAATTCTG  2220
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    2161  GCTGCTTGTGATGATGATGATGATGATGATGATGACGCAATTCTCATAAGACAAATTCTG  2220
New    2521  GCAAAGTTATTCGATCCAATTTCATGGACAATTAATATTTTTAGAAAGCAACGAATATCC  2580
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    2521  GCAAAGTTATTCGATCCAATTTCATGGACAATTAATATTTTTAGAAAGGAACGAATATCC  2580
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RAD4/YER162CNucleotide change(s) in the coding region of RAD4/YER162C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Valine rather than Glutamic Acid.
New    661   GATAATGTGGGACTTTATATGAGAACCTGGAAAGAAATTGAAATGAGCGCCAATAACAAA  720
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    661   GATAATGAGGGACTTTATATGAGAACCTGGAAAGAAATTGAAATGAGCGCCAATAACAAA  720
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
STE2/YFL026WNucleotide change(s) in the coding region of STE2/YFL026W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 269 is now Lysine rather than Glutamic Acid.
New    781   ATATTCATCCTCGCATACAGTTTGAAACCAAACCAGGGAACAGATGTCTTGACTACTGTT  840
             |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    781   ATATTCATCCTCGCATACAGTTTGGAACCAAACCAGGGAACAGATGTCTTGACTACTGTT  840
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YFL034WNucleotide change(s) in the coding region of YFL034W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 323 is now Lysine rather than Asparagine.
New    961   CACAAGAAACTAGCACATAGATTACAGTTTACCCAGAAGGATATGGCTGCTTGGAAAACT  1020
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Old    961   CACAAGAACCTAGCACATAGATTACAGTTTACCCAGAAGGATATGGCTGCTTGGAAAACT  1020
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
FAB1/YFR019WNucleotide change(s) in the coding region of FAB1/YFR019W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 2275 is now Arginine rather than Tryptophan.
New    6781  GCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATAGGGAAGGAAATTAA  6837
             |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    6781  GCAATGGAGAGGTATATTTTGATGGTTCCTGATCCGTGGTATTGGGAAGGAAATTAA  6837
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SAP155/YFR040WNucleotide change(s) in the coding region of SAP155/YFR040W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 663 is now Asparagine rather than Threonine.
New    1981  AAGCAAAACATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAACTA  2040
             ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1981  AAGCAAACCATAAAACTTAGGACCGACCCCACGGTCGGGGACCTATTCAAAATCAAACTA  2040
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YGL041CA single nucleotide was deleted near the middle of ORF YGL041C, shifting its reading frame and altering its coding sequence. The start remains the same, but the C-terminus has changed and the annotated protein is truncated by one-third of its length (from 104 amino acids down to 67 amino acids).

New: 121 TCTAGATTAACCAATTTTTTTTCGATCATGATATTGCTAACCTTTTCTAACTTTTCC-AGAACATTAGGCCTCGAATTTATTTGA 204
         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| 
Old: 121 TCTAGATTAACCAATTTTTTTTCGATCATGATATTGCTAACCTTTTCTAACTTTTCCCAGAACATTAGGCCTCGAATTTATTTGA 205
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YGL041W-AA single G nucleotide was deleted within ORF YGL041W-A, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 72 amino acids longer.
New: 31  TTGCTAACCTTTTCTAACTTTTCC-AGAACAT 1
         |||||||||||||||||||||||| ||||||| 
Old: 154 TTGCTAACCTTTTCTAACTTTTCCCAGAACAT 185
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SDS23/YGL056CNucleotide change(s) in the coding region of SDS23/YGL056C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 180 is now Glycine rather than Alanine.
New    481   AAGGTGAGCAACGACAAGATAACCTCAGACTGCCAGAATGGTAAGTCCGTGCCCGTGGGC  540
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  
Old    481   AAGGTGAGCAACGACAAGATAACCTCAGACTGCCAGAATGGTAAGTCCGTGCCCGTGGCG  540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PKP2/YGL059WNucleotide change(s) in the coding region of PKP2/YGL059W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 224-225 are now SI rather than VY.

New    661   GAACACGTCAGTAT-CACAGCCAACTACACTAGTGGTAAGGAGGAAAATACCTTGGTATT  719
             ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||
Old    661   GAACACGTC-GTATACACAGCCAACTACACTAGTGGTAAGGAGGAAAATACCTTGGTATT  719
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PUS2/YGL063WNucleotide change(s) in the coding region of PUS2/YGL063W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 136 is now Cysteine rather than Serine.
New    361   ATTGGTCCACCCCGGAGTTCTCTTTTGCATCGAAACGTGGGGGGATGCTACCGCGAAGAC  420
             ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||
Old    361   ATTGGTCCACCCCGGAGTTCTCTTTTGCATCGAAACGTGGGGGGATCGTACCGCGAAGAC  420
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YGL109WNucleotide change(s) in the coding region of YGL109W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 26 is now Glutamine rather than Lysine.
New    61   AGAATGGAAGGCCAACaaaaaaaTTCTTGTACAATTGCATATATTGATTCATTACAATAT  120
            ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Old    61   AGAATGGAAGGCCAAAAAAAAAATTCTTGTACAATTGCATATATTGATTCATTACAATAT  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MON1/YGL124CNucleotide change(s) in the coding region of MON1/YGL124C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 113 is now Serine rather than Cysteine.

New    301   GCAAAGAGCAATGATGATACAACGAGAGCACTAAACAGTCCAAAAAAGGATTTCGGTCCT  360
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    301   GCAAAGAGCAATGATGATACAACGAGAGCACTAAACTGTCCAAAAAAGGATTTCGGTCCT  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RSM23/YGL129CA single T nucleotide was deleted within ORF RSM23/YGL129C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 38 amino acids shorter.
New: 1   ACAAGCCACGTGGT-ATACGTATCAGAATAATGCTA 35
         |||||||||||||| ||||||||||||||||||||| 
Old: 85  ACAAGCCACGTGGTTATACGTATCAGAATAATGCTA 120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MDS3/YGL197WNucleotide change(s) in the coding region of MDS3/YGL197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 262-264 are now QSE rather than HPK, and residue 403 is now Alanine rather than Arginine.
New    781   TGGCAATCCG-AAACCATACCCAAACAACCGATGGAAATCACTACAAATGTCAATGGCAT  839
             |||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    781   TGGC-ATCCGAAAACCATACCCAAACAACCGATGGAAATCACTACAAATGTCAATGGCAT  839
New    1200  ACGAGTCGCTACCGCCTGCCCTGACTGCGATATCAATAAACATCGATTCTGGAGGGTATT  1259
             |||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1200  ACGAGTCCGTACCGCCTGCCCTGACTGCGATATCAATAAACATCGATTCTGGAGGGTATT  1259
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YGL214WA single T nucleotide was inserted within ORF YGL214W very near its 5' end, altering its coding sequence. The reading frame and stop remain the same, but the start has been shifted downstream four nucleotides and the annotated protein is now one amino acid shorter.
New: 1   ATGATTGTAAGGTTACATGCAATATATCAAGATATTACTAGAGATTATTTACCGCCAGCT 60
         ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old: 5   ATGAT-GTAAGGTTACATGCAATATATCAAGATATTACTAGAGATTATTTACCGCCAGCT 63
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PEF1/YGR058WNucleotide change(s) in the coding region of PEF1/YGR058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 324 is now Aspartic Acid rather than Tyrosine.
New    961   GATTTTATCGATGCTACATTATATTTAGGTCGTTTCCTACCTCATTGA  1008
             ||||||||| ||||||||||||||||||||||||||||||||||||||
Old    961   GATTTTATCTATGCTACATTATATTTAGGTCGTTTCCTACCTCATTGA  1008
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YGR067CA single nucleotide substitution was made in the stop codon of ORF YGR067C, destroying it and increasing the length of the annotated protein by 10 amino acids.
New:   2415   TTATTTTATTTGGCTAAAAATTTCAATGTTTTTACTTTGTTTATTGTCAGTTGAAGAAGC 2356
              |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| 
Old:   622376 TTATTTTATTTGGCTAAAAATTTCAATGTTTTAACTTTGTTTATTGTCAGTTGAAGAAGC 622435
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ROM1/YGR070WNucleotide change(s) in the coding region of ROM1/YGR070W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 960 is now Valine rather than Alanine.
New    2821  GACGGTTTCTGTAATGGTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGTA  2880
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Old    2821  GACGGTTTCTGTAATGGTAAAAGAATCATTATGATTGCACATCATTTTTTGCACGCCGCA  2880
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ENP2/YGR145WNucleotide change(s) in the coding region of ENP2/YGR145W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 678 is now Aspartic Acid rather than Glutamic Acid.
New    1981  GGAAATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGACGAAAAT  2040
             ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Old    1981  GGAAATTATAAATCCAGGCGTCATGATAATTCATCGGATGAAGAAGGTATTGAAGAAAAT  2040
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YGR153WNucleotide change(s) in the coding region of YGR153W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 158 is now Alanine rather than Aspartic Acid.

New    421  GAACATGGAGAGGAGAGTGTAAAACCGTGTGGTTGTCATAAATCGAGAAAAGCAAAATGC  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||
Old    421  GAACATGGAGAGGAGAGTGTAAAACCGTGTGGTTGTCATAAATCGAGAAAAGACAAATGC  480
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
TOS2/YGR221CNucleotide change(s) in the coding region of TOS2/YGR221C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 69-91 are now EPSMQDFDPNFEGDLYYLPKMDS rather than NLLCRILTQILRAIYTIYRRWIT.
New    181   GTAGTATATAGGAGATGCAAAAAAGAACCTTCTATGCAGGATTTTGACCCAAATTTTGAG  240
             ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Old    181   GTAGTATATAGGAGATGCAAAAA-GAACCTTCTATGCAGGATTTTGACCCAAATTTTGAG  239
New    241   GGCGATTTATACTATTTACCGAAGATGGATT-CTTCTATGAATTCTGCAAACTCAGACAG  299
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    240   GGCGATTTATACTATTTACCGAAGATGGATTACTTCTATGAATTCTGCAAACTCAGACAG  299
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
DIE2/YGR227WNucleotide change(s) in the coding region of DIE2/YGR227W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 266 is now Isoleucine rather than Lysine.
New    781   GTTCTGCCCTATATGATAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC  840
             |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Old    781   GTTCTGCCCTATATGAAAAATTTTGTTTTGTTCTTCATTTATCTGATTTGGAACAGATCC  840
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SLH1/YGR271WNucleotide change(s) in the coding region of SLH1/YGR271W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 51 is now Glutamine rather than Proline, residue 193 is now Lysine rather than Glutamic Acid, and residue 438 is now Serine rather than Proline.

New    121   GACGAGCTaaaaaaaGTCCAAAAGGATGAACAAAATCAAAGAACTGAACTAACTGTTCTC  180
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    121   GACGAGCTAAAAAAAGTCCAAAAGGATGAACCAAATCAAAGAACTGAACTAACTGTTCTC  180
New    541   TTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGAAAAGTGCAGAGGATGCCAAGAAT  600
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Old    541   TTCCTGACACAGCAAGATATCAGGAATCAAGTTTTGGAAAGTGCAGAGGATGCCAAGAAT  600
New    1261  GTCAAATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTTCGGTTATT  1320
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    1261  GTCAAATTACTAATTATTGATGAAGTTCATTTACTGCACGAAGATAGAGGTCCGGTTATT  1320
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YHL037CA single nucleotide was deleted within the ORF YHL037C, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 26 amino acids shorter.
New: 361 CATGCC-ATAACCCTTGCATGGTTAGCACACGCCCTCACGTGA 402
         |||||| |||||||||||||||||||||||||||||||||||| 
Old: 361 CATGCCCATAACCCTTGCATGGTTAGCACACGCCCTCACGTGA 403
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ARN2/YHL047CA single nucleotide was inserted within the ORF ARN2/YHL047C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New: 1801 GAAGATGATCCTATCAATGACTGGATCGCGAAACGTTTTGCAAAGGCCTTAGGCAGGTCATAA 1863
          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||  
Old: 1801 GAAGATGATCCTATCAATGACTGGATCGCGAAACGTTTTGCAAAGGCCTTAGG-AGGTCATAA 1862
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YHR049C-AA single nucleotide was deleted near the middle of ORF YHR049C-A, altering its coding sequence. The start remains the same, but the C-terminal half of the protein sequence has changed and the annotated protein is now five amino acids shorter.
New: 121 TTCGTAAGCCACGCTAAAGCACCCCGGGTGGATTTTTCGCGCCGGGCGGGGTT-AGCAGC 179
         ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| 
Old: 121 TTCGTAAGCCACGCTAAAGCACCCCGGGTGGATTTTTCGCGCCGGGCGGGGTTTAGCAGC 180
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YHR056W-ANucleotide change(s) in the coding region of YHR056W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 116 is now Cysteine rather than Glycine.
New    301  ACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTTGCCCTGTCGCACCC  360
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    301  ACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTGGCCCTGTCGCACCC  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ERG7/YHR072WNucleotide change(s) in the coding region of ERG7/YHR072W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 530 is now Asparagine rather than Aspartic Acid.

New    1561  ACCTTGAATCCTGCTGAAGTTTTTGGTAACATAATGGTAGAATACCCATACGTGGAATGT  1620
             ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Old    1561  ACCTTGAATCCTGCTGAAGTTTTTGGTGACATAATGGTAGAATACCCATACGTGGAATGT  1620
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
HXT4/YHR092COne single nucleotide was inserted, and two single nucleotides deleted, within the ORF HXT4/YHR092C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 16 amino acids longer.
New:   1731   CTACTTTTTTCCGAACATCTTCTTGTAAAATGG-TTGATC-ATCATGCATTAGATCATCA 1674
              ||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| 
Old:   287083 CTACTTTTTTCCGAACATCTTCTTGTAAAATGGGTTGATCCATCATGCATTAGATCATCA 287142
New:   1673   GCGTTGTAGTCAGTACCTCTCTTGTTTGGTGGAACCCAAGAAGGTGATTTCCATGGCAAA 1614
              |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| 
Old:   287143 GCGTTGTAGTCAGTACCTCTCTTGTTTGGTGGAACC-AAGAAGGTGATTTCCATGGCAAA 287201
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YHR095WA single C nucleotide was inserted within ORF YHR095W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 20 amino acids longer.

New:  421  GCGCATGCGCAAGTAG  436
           ||||||||| ||||||
Old:  421  GCGCATGCG-AAGTAG  435
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MTG2/YHR168WA single G nucleotide was inserted very near the 3' end of ORF MTG2/YHR168W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 19 amino acids longer.
New: 1441   TTTTCCAAAAGTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAGGAAAACATA 1500
            ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Old: 441819 TTTTCCAAAAGTCAGGAATGGGACTGTGTTCCGATAAGCGCCCTCAGAGAG-AAAACATA 441877
New: 1501   GATGTGTTAAAGAAAAAGATGTTTAAGTGTGCTCGTCAGTCTGAATTTGACAAGTAG 1557
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old: 441878 GATGTGTTAAAGAAAAAGATGTTTAAGTGTGCTCGTCAGTCTGAATTTGACAAGTAG 441934
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RIX1/YHR197WNucleotide change(s) in the coding region of RIX1/YHR197W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 762 is now Glutamic Acid rather than Glycine.
New    2281  GAAGAAGAATAA  2292
             |||| |||||||
Old    2281  GAAGGAGAATAA  2292
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YIL012WA single G nucleotide was inserted within the ORF YIL012W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids shorter.
New: 301 GAGGCGTACTTCGCCTTGCGGGAAAAAAAATTTCTTTTGTAA 342
         |||||||||||||| ||||||||||||||||||||||||||| 
Old: 301 GAGGCGTACTTCGC-TTGCGGGAAAAAAAATTTCTTTTGTAA 341
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CAB2/YIL083CNucleotide change(s) in the coding region of CAB2/YIL083C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 338 is now Serine rather than Isoleucine.
New    961   TCCCCTGAAAACAGAAAGGGAGATTGGGTACGTTTGGATGAAAAACACCATAGCATTGAA  1020
             |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Old    961   TCCCCTGAAAACAGAAAGGGAGATTGGGTACGTTTGGATGAAAAACACCATATCATTGAA  1020
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SIM1/YIL123WThree nucleotides were inserted near the 5' end of ORF SIM1/YIL123W, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New: 241  TCCGCAGCCGCTGCGGATAGCTCCGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAG 300
          ||||||||||||| |||||||  ||||||||||||||||||||||||||||||||||||| 
Old: 241  TCCGCAGCCGCTG-GGATAGC--CGCTTCCATTGCTGTTTCATCTGCTGCCTTAGCCAAG 297
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RPC17/YJL011CNucleotide change(s) in the coding region of RPC17/YJL011C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 159 is now Glycine rather than Alanine.
New    421  TGTGATGCAAGATTTGACGAAAAAACAATTGAGGAAATGCTAGAGATCATCTCTGGCTAC  480
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||
Old    421  TGTGATGCAAGATTTGACGAAAAAACAATTGAGGAAATGCTAGAGATCATCTCTGCGTAC  480
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YJL015CA single nucleotide was inserted within the ORF YJL015C very near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 30 amino acids shorter.
New:  407390  ATCCTAATACTAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAAATAGCA  407449
              |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old:  407384  ATCCTAATACTAAACTTTTTCGTTTAACGTGACGCATGGTGCGAAGAAAAAAAA-TAGCA  407442
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PBS2/YJL128CNucleotide change(s) in the coding region of PBS2/YJL128C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 222-223 are now GL rather than AV.

New    661   CGAGGGCTCAAATTACCACCAGGAGGAATGTCATTAAAAATGCCCACTAAAACAGCTCAA  720
             |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    661   CGAGCGGTCAAATTACCACCAGGAGGAATGTCATTAAAAATGCCCACTAAAACAGCTCAA  720
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
URA2/YJL130CNucleotide change(s) in the coding region of URA2/YJL130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 123 is now Alanine rather than Arginine.
New    361   TATCTTGCTAAATCTTCCTTAGGTAAATGGTTACAAAATGAAGGGATCCCAGCTGTTTAT  420
             ||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    361   TATCTTCGTAAATCTTCCTTAGGTAAATGGTTACAAAATGAAGGGATCCCAGCTGTTTAT  420
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
TPK1/YJL164CNucleotide change(s) in the coding region of TPK1/YJL164C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 79-86 are now SGKYSLQD rather than VGSIVYKN.
New    181   ACTTATTACAATGAGGAGCAGTATAAACAGTTTATTGCCCAAGCGAGAGTTACAAGTGGG  240
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old    181   ACTTATTACAATGAGGAGCAGTATAAACAGTTTATTGCCCAAGCGAGAGTTACA-GTGGG  239
New    241   AAGTATAGTTTACAAGA-CTTTCAGATATTAAGGACACTGGGTACGGGTTCTTTTGGTAG  299
             ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Old    240   AAGTATAGTTTACAAGAACTTTCAGATATTAAGGACACTGGGTACGGGTTCTTTTGGTAG  299
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SET2/YJL168CNucleotide change(s) in the coding region of SET2/YJL168C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 594 is now Alanine rather than Phenylalanine, residue 605 is now Alanine rather than Serine, and residue 716 is now Alanine rather than Glycine.

New    1741  AATGAAAGAAAAAGCGTTTTGGAGGATATTATAGCGGAGGCCAACAAACAGAAGGAGTTA  1800
             |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||
Old    1741  AATGAAAGAAAAAGCGTTTTGGAGGATATTATAGCGGAGTTCAACAAACAGAAGGAGTTA  1800
New    1801  CAAAAGGAAGAGGCCAAAAAACTAGTGGAAGCAAAAGAGGCTAAGCGGTTGAAAAGAAAA  1860
             |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Old    1801  CAAAAGGAAGAGTCCAAAAAACTAGTGGAAGCAAAAGAGGCTAAGCGGTTGAAAAGAAAA  1860
New    2101  TACATGGATAAGATTATCCTCAAGAAGAAGCaaaaaaaGGCGTTGGCATTATCATCAGCA  2160
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    2101  TACATGGATAAGATTATCCTCAAGAAGAAGCAAAAAAAGGCGTTGGGATTATCATCAGCA  2160
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YJL169WNucleotide change(s) in the coding region of YJL169W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 62 is now Alanine rather than Proline.
New    181  AATGCCAACGCCtttttttGCTTCTTCTTGAGGATAATCTTATCCATGTATGAATTTATG  240
            ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    181  AATCCCAACGCCTTTTTTTGCTTCTTCTTGAGGATAATCTTATCCATGTATGAATTTATG  240
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YJL171CNucleotide change(s) in the coding region of YJL171C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 366 is now Lysine rather than Leucine, residue 371 is now Alanine rather than Arginine, and residue 374 is now Lysine rather than Asparagine.
New    1081  CCTTCGACCACCTCGAAGTCGAATGGTGTTGCTTTAACGAAGATGCAAAACGGTGTATGG  1140
             |||||||||||||||  |||||||||||||  ||||||||| ||||||||||||||||||
Old    1081  CCTTCGACCACCTCGTTGTCGAATGGTGTTCGTTTAACGAACATGCAAAACGGTGTATGG  1140
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PFD1/YJL179WNucleotide change(s) in the coding region of PFD1/YJL179W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 74 is now Aspartic Acid rather than Alanine.
New    181  TTACAGGATAAATCCAAATACGTTAATGATTTATCACATGACGAAACTGTTCTTCTGGAT  240
            |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Old    181  TTACAGGATAAATCCAAATACGTTAATGATTTATCACATGCCGAAACTGTTCTTCTGGAT  240
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MNN11/YJL183WNucleotide change(s) in the coding region of MNN11/YJL183W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 298 is now Aspartic Acid rather than Glycine.
New    841   TACAATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGATGGTAAT  900
             |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Old    841   TACAATCATTTTGAATATAGTTCGGCAAAGATTATCATTCCACATGATGCGGGTGGTAAT  900
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MNN5/YJL186WNucleotide change(s) in the coding region of MNN5/YJL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 395 is now Valine rather than Phenylalanine.

New    1141  ATTTCTCAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCGTCGCTGCTGCCCATGCC  1200
             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    1141  ATTTCTCAAGGCACTGCCGGTGAAGGTGACAAAGACACTTTCTTCGCTGCTGCCCATGCC  1200
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BUD19/YJL188CNucleotide change(s) in the coding region of BUD19/YJL188C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 90 is now Cysteine rather than Tyrosine.
New    241  GTTAGTAACAATGTTCAAACTCATCAATGTGATGCATTCACGGATCCAAGGCAATACCAC  300
            |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    241  GTTAGTAACAATGTTCAAACTCATCAATATGATGCATTCACGGATCCAAGGCAATACCAC  300
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YJR098CThree nucleotides were inserted near the middle of ORF YJR098C, altering its coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New: 1201 TTTGGAGATGATGTGATGTGGAATAAAACTATTTTCACTAAAGAAACCAACTTTTTTATG 1260
          ||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||| 
Old: 1201 TTTGGAGATGATGTGATGTGGAATAAA-CTATTTTCACTAA-GAA-CCAACTTTTTTATG 1257
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
URA8/YJR103WA single C nucleotide was inserted very near the 3' end of ORF URA8/YJR103W, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 14 amino acids longer.
New: 1621   ACATCGAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGCCTCCGGC 1680
            ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| 
Old: 622363 ACATCGAAGGTGCTGGAACCATCAAGACCGTTTTGGGGGCTTGTGGCCGCAGC-TCCGGC 622421
New: 1681   ACACTTGGTGAAGTGATCAAGGACATAAATCTAAGCGAGGGAAATGAAAATGAATGA 1737
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old: 622422 ACACTTGGTGAAGTGATCAAGGACATAAATCTAAGCGAGGGAAATGAAAATGAATGA 622478
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ECM27/YJR106WNucleotide change(s) in the coding region of ECM27/YJR106W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 219 is now Asparagine rather than Aspartic Acid.
New    601   AATCATTCTGCAGAAACCCCAGATGAAACTGCTGCGGATACGAGCCTCAGAGAAAACTCC  660
             |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Old    601   AATCATTCTGCAGAAACCCCAGATGAAACTGCTGCGGATACGAGCCTCAGAGAAGACTCC  660
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YJR107WNucleotide change(s) in the coding region of YJR107W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 14 is now Proline rather than Leucine, and residue 66 is now Glycine rather than Proline.
New    1    ATGCCTGTTGTTCATTGTTCGTCCAACCTGCCCATCACTCCATATATCTATGAGCGTCTA  60
            |||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||
Old    1    ATGCCTGTTGTTCATTGTTCGTCCAACCTGCCCATCACCCTATATATCTATGAGCGTCTA  60
New    181  ATTAACCCAACAGCGGGTCAAACAGTGGTTGAATTAGTTCTTAATGCaaaaaaaGGTGAA  240
            |||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||
Old    181  ATTAACCCAACAGCGCCTCAAACAGTGGTTGAATTAGTTCTTAATGCAAAAAAAGGTGAA  240
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YJR129CNucleotide change(s) in the coding region of YJR129C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 118 is now Lysine rather than Threonine.
New    301   CCGATGATGAAAGACGTCGTGAGGTACAGGTTTGACGAGGACGTAAAGATCAAAATTGAG  360
             |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Old    301   CCGATGATGAAAGACGTCGTGAGGTACAGGTTTGACGAGGACGTAAAGATCACAATTGAG  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
NMD5/YJR132WNucleotide change(s) in the coding region of NMD5/YJR132W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 258 is now Alanine rather than Serine.
New    721   GCATGtttttttGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGGCTATATCA  780
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    721   GCATGTTTTTTTGTCAGCATCATTCAGCAGCCATTGCCTCAGGAAGTTTTGTCTATATCA  780
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YJR149WNucleotide change(s) in the coding region of YJR149W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 402 is now Aspartic Acid rather than Valine.

New    1201  ATTGACGGAAAATAA  1215
             |||| ||||||||||
Old    1201  ATTGTCGGAAAATAA  1215
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
DAN1/YJR150CNucleotide change(s) in the coding region of DAN1/YJR150C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 115 is now Glutamic Acid rather than Glycine.
New    301  TCTACTAGATTGATGGGTGCTATTTCCGAAGCACTTGCGAATGAAGGTATTGCTACTGCA  360
            ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    301  TCTACTAGATTGATGGGTGCTATTTCCGAAGCACTTGCGAATGGAGGTATTGCTACTGCA  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YKL023WNucleotide change(s) in the coding region of YKL023W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 25-26 are now QQ rather than HE.
New    61   TGCGTCACGGATCAGCAGGCCTACTCTAATTGGTTAAAGAATGATAATGATGAACGTACG  120
            ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||
Old    61   TGCGTCACGGATCACGAGGCCTACTCTAATTGGTTAAAGAATGATAATGATGAACGTACG  120
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YET1/YKL065CNucleotide change(s) in the coding region of YET1/YKL065C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 16 is now Methionine rather than Valine.

New    1    ATGAGTTTATACTTTACGACATTATTTTTATTGCTCACTGTTGAGATGGTAATGCTCTTC  60
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Old    1    ATGAGTTTATACTTTACGACATTATTTTTATTGCTCACTGTTGAGGTGGTAATGCTCTTC  60
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
HSL1/YKL101WNucleotide change(s) in the coding region of HSL1/YKL101W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1482 is now Threonine rather than Serine.
New    4441  TCTACGGTAATTACTGTaaaaaaaaGAAGCAAACATTCAAACACAAGTTCCAATAAAGCC  4500
             ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    4441  TCATCGGTAATTACTGTAAAAAAAAGAAGCAAACATTCAAACACAAGTTCCAATAAAGCC  4500
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MYO3/YKL129CThree nucleotides were inserted within the ORF MYO3/YKL129C, and two nucleotides were substituted in the same region, altering the MYO3 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein sequence is now one amino acid longer and a small section of the sequence has changed.
New: 781  TGTACTACTGCAGATACAATTGATGACGTAAAAGATTACGAAGGCACGTTAGAGGCTATG 840
          |||||  |||||||| ||||||||| |||||| ||||||||||||||||||||||||||| 
Old: 781  TGTACATCTGCAGAT-CAATTGATG-CGTAAA-GATTACGAAGGCACGTTAGAGGCTATG 837
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YKL133CNucleotide change(s) in the coding region of YKL133C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 252 is now Tyrosine rather than Isoleucine.

New    721   GGTCTACCATTTATTGGTAAATCCAAACCTGACTACCAAATGCATTTAAACTCTAAAAGA  780
             |||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||
Old    721   GGTCTACCATTTATTGGTAAATCCAAACCTGACATCCAAATGCATTTAAACTCTAAAAGA  780
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
OCT1/YKL134CSix single nucleotides were inserted near the middle of ORF OCT1/YKL134C, and one nucleotide was inserted and another deleted near its 3' end, altering the OCT1 coding sequence. The start, stop, and majority of the reading frame remain the same, but the annotated protein is now one amino acid longer and two separate small sections of the protein sequence are now different.
New: 1021 GGTAAAATGGCAAAGAATCCGAAAGATGTTCAAGATTTTATTTTGACGTTAATGAACAAT 1080
          |||||| |||||| || || ||| ||||| |||||||||||||||||||||||||||||| 
Old: 1021 GGTAAA-TGGCAA-GA-TC-GAA-GATGT-CAAGATTTTATTTTGACGTTAATGAACAAT 1074
New: 2041 CAGAGTAATTGGTGTGGAAGATTCGGCCATTTATTTGGATACGGGGCAACTTATTACAGC 2100
          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| 
Old: 2035 CAGAGTAATTGGTGTGGAAGATTCGGCCATTTATTTGGAT-CGGGGCAACTTATTACAGC 2093
New: 2101 TACTTATTT-GATAGGACGATAGCTTCTAAAATCTGGTACGCCCTTTTCGAGGATGATCC 2159
          ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| 
Old: 2094 TACTTATTTTGATAGGACGATAGCTTCTAAAATCTGGTACGCCCTTTTCGAGGATGATCC 2153
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
APE2/YKL157WA single G nucleotide was deleted within ORF APE2/YKL157W, near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 17 amino acids longer.
New:   3181   AGTGGG-TTAACAGAGACCGTGATGTCGTCAACAAGTATTTGAAGGAAAATGGTTACTAT 3239
              |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old:   158176 AGTGGGGTTAACAGAGACCGTGATGTCGTCAACAAGTATTTGAAGGAAAATGGTTACTAT 158235
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PTK1/YKL198CFive nucleotide changes were made within the ORF PTK1/YKL198C, altering its coding sequence: one single insertion, two single deletions, and two substitutions. The start and majority of the reading frame remain the same, but a small section of the annotated protein sequence is now different, the C-terminus has changed, and the annotated protein is now 13 amino acids longer.
New: 721  AAGCGCTGCTC-AAAGGAGTTTATCATCGCAAAGCAGCTAAGTCATCATGTTCACATCAC 779
          || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| 
Old: 721  AA-CGCTGCTCCAAAGGAGTTTATCATCGCAAAGCAGCTAAGTCATCATGTTCACATCAC 779
New: 840  CGTCATGGAGCTAGGTCTACGAGATTTGTTCGCGATGATACAAAAATCGGGCTGGCGCAG 899
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
Old: 840  CGTCATGGAGCTAGGTCTACGAGATTTGTTCGCGATGATACAAAAATCGGGCTGGCGCCA 899
New: 1860 ACCTTCCGCACCTTCCGCTCGCGTCCGTGGCCACTCCCCGCACAGGGTAG-TGCATCACC 1918
          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| 
Old: 1860 ACCTTCCGCACCTTCCGCTCGCGTCCGTGGCCACTCCCCGCACAGGGTAGGTGCATCACC 1919
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MCH2/YKL221WNucleotide change(s) in the coding region of MCH2/YKL221W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 342 is now Alanine rather than Arginine.

New    1021  ATAGCTTTTGGATTATTGGTTGGTTCTATTATGGGAACAATTTGGCCAACAATTGCTTCA  1080
             |||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1021  ATACGTTTTGGATTATTGGTTGGTTCTATTATGGGAACAATTTGGCCAACAATTGCTTCA  1080
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RSC4/YKR008WNucleotide change(s) in the coding region of RSC4/YKR008W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 390 is now Lysine rather than Isoleucine.
New    1141  CCAAACAACTTCAAAAAGTTAATAGCCAAACCGGAAACAGTGCAATCCGAAGTCAAAAAT  1200
             |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Old    1141  CCAAACAACTTCAAAAAGTTAATAGCCATACCGGAAACAGTGCAATCCGAAGTCAAAAAT  1200
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YKR012CNucleotide change(s) in the coding region of YKR012C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 98 is now Lysine rather than Glutamine, and residue 109 is now Lysine rather than Glutamine.
New    241  ATCACAGCAATATGTAACACTCTGCGACAAGCATATATATATACAAAGATCAAAAGCATT  300
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    241  ATCACAGCAATATGTAACACTCTGCGACAAGCATATATATATACAAAGATCCAAAGCATT  300
New    301  GCCTTTGAACGACGTCTATGTTTCAAAAACATTACATATAGAGAAGTGCGTGAGATACAC  360
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Old    301  GCCTTTGAACGACGTCTATGTTTCCAAAACATTACATATAGAGAAGTGCGTGAGATACAC  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SAP190/YKR028WA single G nucleotide was inserted within the ORF SAP190/YKR028W near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 65 amino acids shorter.
New: 3001 TCAAGCGATGAAGAAGACTCCGAAGATGAAGATGAAGAGAATGATATGGGCAATGAGGAG 3060
          |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| 
Old: 3001 TCAAGCGATGAAGAAGACTCCGAA-ATGAAGATGAAGAGAATGATATGGGCAATGAGGAG 3059
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CAF4/YKR036CNucleotide change(s) in the coding region of CAF4/YKR036C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 94-95 are now QR rather than HG.
New    241   TCTGCAACAACTTTCAGAATACTTGCTCATTTAGATGAGCAGCGATACCCGCTACCCAAC  300
             |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||
Old    241   TCTGCAACAACTTTCAGAATACTTGCTCATTTAGATGAGCACGGATACCCGCTACCCAAC  300
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PXL1/YKR090WNucleotide change(s) in the coding region of PXL1/YKR090W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 688 is now Serine rather than Threonine.
New    2041  GGTATCGACAATGCTACATCAAGCAATGATAAGAACAATACTCTCTCTAAAAGGAGAACG  2100
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    2041  GGTATCGACAATGCTACATCAACCAATGATAAGAACAATACTCTCTCTAAAAGGAGAACG  2100
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YLL054CA single nucleotide was inserted very near the 3' end of ORF YLL054C, altering its coding sequence. The start and most of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 74 amino acids longer.
New: 2281 GATAAGTCCTTTTCGTTCACATCAAAATTAA 2311
          ||||||||||||||||||||| ||||||||| 
Old: 2281 GATAAGTCCTTTTCGTTCACA-CAAAATTAA 2310
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SPH1/YLR313CA GG dinucleotide was inserted within the ORF SPH1/YLR313C near its 3' end, altering its coding sequence. The start and majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now 131 amino acids shorter.
New: 1561 GTTGTTCTTCCTATGGCAGGCAGGGCATTTTGA 1593
          ||||||||||||||||||  ||||||||||||| 
Old: 1561 GTTGTTCTTCCTATGGCA--CAGGGCATTTTGA 1591
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CDC3/YLR314CNucleotide change(s) in the coding region of CDC3/YLR314C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 431 is now Glutamine rather than Leucine.
New    1261  TTCAAAGAGTTCGATCCAATATCTAAACAACAAGAAGAAAAAACTTTACATGAGGCAAAA  1320
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    1261  TTCAAAGAGTTCGATCCAATATCTAAACAACTAGAAGAAAAAACTTTACATGAGGCAAAA  1320
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
EST2/YLR318WNucleotide change(s) in the coding region of EST2/YLR318W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 162 is now Alanine rather than Valine.

New    481   TGGGCTCAACGATCATCCTCATCATCCGCAACTGCTGCGCAAATCAAACAACTTACAGAA  540
             ||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    481   TGGGTCCAACGATCATCCTCATCATCCGCAACTGCTGCGCAAATCAAACAACTTACAGAA  540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YLR402WA single G nucleotide was inserted within the ORF YLR402W near its 5' end, necessitating a change in annotation to a downstream start codon. The sequence change makes the longer version of the protein no longer possible in the reference sequence. The stop and reading frame remain the same, but the annotated protein is now 108 amino acids shorter, less than half its original size.
New:  924657   TTAAGTCTCTTCATCCCGTGTACTATTACCCGACAGGTTTCTGCGGCATGTTCTGTGGAA  924716
               ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Old:  924657   TTAAGTCTCTTCATCCCGTGTACTATTACCCGACA-GTTTCTGCGGCATGTTCTGTGGAA  924715
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YLR407WA single G nucleotide was inserted within the ORF YLR407W near its 3' end, altering its coding sequence. The start and vast majority of the reading frame remain the same, but the C-terminus has changed and the annotated protein is now one amino acid shorter.
New: 661 GCTAATGCTGCCAAGGGCATGCCATGA 687
         |||||||||||||||| |||||||||| 
Old: 661 GCTAATGCTGCCAAGG-CATGCCATGA 686
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YMR262WNucleotide change(s) in the coding region of YMR262W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 167 is now Cysteine rather than Tryptophan.

New    481  ACAGTATTCAGGCGATTTTGCCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACAC  540
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    481  ACAGTATTCAGGCGATTTTGGCGACTGGCAAGGCACACAAGCAAGCCCATCTCTATACAC  540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YMR290W-ANucleotide change(s) in the coding region of YMR290W-A resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 105-107 are now KKK rather than RKR.
New    301  aaaaaaaaaaaaaagaaaaagcaaataaaaaaTTTTCAATTCGGGTAA  348
            ||||||||||||| ||||| ||||||||||||||||||||||||||||
Old    301  AAAAAAAAAAAAAGGAAAAGGCAAATAAAAAATTTTCAATTCGGGTAA  348
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
DYN3/YMR299CNucleotide change(s) in the coding region of DYN3/YMR299C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 223 is now Lysine rather than Threonine.
New    661  ATGGTCAAACGCAGTGAGATATTAATACCGAAGGGGTGCGATTCTATTGGATTGATAAAA  720
            ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    661  ATGGTCACACGCAGTGAGATATTAATACCGAAGGGGTGCGATTCTATTGGATTGATAAAA  720
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YMR317WNucleotide change(s) in the coding region of YMR317W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 271-279 are now VISSEASWA rather than SVSSEASSS.

New    781   AGTTCAGAAGCTCCATCGGCAACGTCTAGCGTAATTAGTTCAGAAGCTTCATGGGCAACG  840
             ||||||||||||||||||||||||||||||  | | ||||| |||||||||| | |||| 
Old    781   AGTTCAGAAGCTCCATCGGCAACGTCTAGCTCAGTGAGTTCGGAAGCTTCATCGTCAACA  840
New    841   TCTAGCTCAGTGAGCTCGGAAGCTCCATTGGCAACGTCTAGCGTAGTGAGTTCAGAAGCT  900
             |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Old    841   TCTAGCTCAGTGAGTTCGGAAGCTCCATTGGCAACGTCTAGCGTAGTGAGTTCAGAAGCT  900
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YNL008CA single C nucleotide was deleted within ORF YNL008C, altering its coding sequence. The C-terminus and majority of the reading frame remain the same, but the N-terminus has changed and the annotated protein is now 7 amino acids longer.
 
New: 1  TGCTCCATAACA-GAGATGTATTTAGCTTTTT 31
        |||||||||||| ||||||||||||||||||| 
Old: 13 TGCTCCATAACACGAGATGTATTTAGCTTTTT 44
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
APC1/YNL172WNucleotide change(s) in the coding region of APC1/YNL172W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1547 is now Methionine rather than Isoleucine.
New    4621  TTGAAGCATTTCTGGAGCATGGCTGTAGAGCCTCGTTGCCTTGTTATAAAGGACATTTCC  4680
             |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Old    4621  TTGAAGCATTTCTGGAGCATTGCTGTAGAGCCTCGTTGCCTTGTTATAAAGGACATTTCC  4680
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
NOP13/YNL175CNucleotide change(s) in the coding region of NOP13/YNL175C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 296 is now Alanine rather than Glutamic Acid.

New    841   GGATTCGCATTTATCGACTTCAAGAATGAAGAAGGATCTACTAATGCATTAAAGGATAAA  900
             |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
Old    841   GGATTCGCATTTATCGACTTCAAGAATGAAGAAGGATCTACTAATGAATTAAAGGATAAA  900
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YNL176CNucleotide change(s) in the coding region of YNL176C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Phenylalanine rather than Cysteine.
New    721   CCTTCTACGATATCAAATAAAGATACCACATTCCCAAGTTCCAGTCGGAATACTTCCACA  780
             ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Old    721   CCTTCTACGATATCAAATAAAGATACCACATGCCCAAGTTCCAGTCGGAATACTTCCACA  780
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MRPL22/YNL177CNucleotide change(s) in the coding region of MRPL22/YNL177C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 151 is now Leucine rather than Phenylalanine.
New    421  CCAAATTCTAGCGAACGTTACAAGCTAAAGTTAACAAAAAGAGAAATTGAAGTACTAGAA  480
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Old    421  CCAAATTCTAGCGAACGTTACAAGCTAAAGTTCACAAAAAGAGAAATTGAAGTACTAGAA  480
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YNL181WNucleotide change(s) in the coding region of YNL181W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 262 is now Alanine rather than Proline.

New    781   GGCGCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTCAACCTGGAACTATGAGA  840
             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    781   GGCCCTGAAAGAACAGGAAAAAATGTTACCATTACTATGGTTCAACCTGGAACTATGAGA  840
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
UBP10/YNL186WNucleotide change(s) in the coding region of UBP10/YNL186W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 310 is now Glutamic Acid rather than Aspartic Acid.
New    901   ggagaggaggaggaagaagaggaagaagagCTGAAACATAAATCTAGGTCAATCACCCCT  960
             ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Old    901   GGAGAGGAGGAGGAAGAAGAGGAAGAAGATCTGAAACATAAATCTAGGTCAATCACCCCT  960
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CHS1/YNL192WNucleotide change(s) in the coding region of CHS1/YNL192W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 815 is now Valine rather than Phenylalanine.
New    2401  AATACATTGATTTCATGGTTTTCATTGAGTTCATTTTTCCTAGTCTTTAGAATTCTCACT  2460
             |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Old    2401  AATACATTGATTTCATGGTTTTCATTGAGTTCATTTTTCCTATTCTTTAGAATTCTCACT  2460
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YNL193WNucleotide change(s) in the coding region of YNL193W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 122 is now Leucine rather than Valine.

New    361   TCTCTGCCACAGATTATCCAACGGTTTGAAATTGTTTATGAGACTTTCCCAGAACAGAGA  420
             ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    361   TCTGTGCCACAGATTATCCAACGGTTTGAAATTGTTTATGAGACTTTCCCAGAACAGAGA  420
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SLA2/YNL243WNucleotide change(s) in the coding region of SLA2/YNL243W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 344 is now Alanine rather than Arginine.
New    1021  ACTGGTGCAGCTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAGCCGGACTTCTGG  1080
             |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||
Old    1021  ACTGGTGCACGTAACGCCATTTTTCCACAGGCGACGGCACAAATGCAGCCGGACTTCTGG  1080
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BNI1/YNL271CNucleotide change(s) in the coding region of BNI1/YNL271C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 938 is now Alanine rather than Threonine.
New    2761  AAGCCTCAAGAGGCGGACGTAAATAAACTAAATGACCTAAGGCGGGCTTTGGCTGAAATC  2820
             ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Old    2761  AAGCCTCAAGAGGCGGACGTAAATAAACTAAATGACCTAAGGCGGGCTTTGACTGAAATC  2820
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
EGT2/YNL327WNucleotide change(s) in the coding region of EGT2/YNL327W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 577 is now Threonine rather than Alanine.

New    1681  AGTTCTACTACGTCCAGTTTATCATCCGGCCCATTTGTTTCAAACACAACGGTTGCCTCT  1740
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    1681  AGTTCTACTACGTCCAGTTTATCATCCGGCCCATTTGTTTCAAACACAGCGGTTGCCTCT  1740
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ARG1/YOL058WNucleotide change(s) in the coding region of ARG1/YOL058W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 329-332 are now SYFT rather than FLLH.
New    961   TACTCCAGATTGATATATAACGG-TTCCTACTTCACCCCAGAGTGTGAGTACATCAGATC  1019
             ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||
Old    961   TACTCCAGATTGATATATAACGGTTTCCTACTTCA-CCCAGAGTGTGAGTACATCAGATC  1019
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YOL075CNucleotide change(s) in the coding region of YOL075C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 1164 is now Alanine rather than Arginine.
New    3481  TGTGGCGAAGCTCTTGGTATAATGACAAATACATTTTTCGAAAGGCCAGGCTTCGTCGTT  3540
             |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||
Old    3481  TGTGGCGAACGTCTTGGTATAATGACAAATACATTTTTCGAAAGGCCAGGCTTCGTCGTT  3540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
BRX1/YOL077CNucleotide change(s) in the coding region of BRX1/YOL077C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 161 is now Glycine rather than Cysteine.

New    481  GGTGTACCACCAAATGCTAGAAAATCTAAGCCATTTATTGATCACGTCATGTCCTTCAGT  540
             |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    481  TGTGTACCACCAAATGCTAGAAAATCTAAGCCATTTATTGATCACGTCATGTCCTTCAGT  540
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RTC1/YOL138CNucleotide change(s) in the coding region of RTC1/YOL138C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 393 is now Cysteine rather than Serine, and residue 548 is now Aspartic Acid rather than Glycine.
New    1141  CAAGAATACATTGCTACAGGTGGTAGAGACGGTAAATGCTGCCTCTGGTTTGTTGGCGAC  1200
             ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Old    1141  CAAGAATACATTGCTACAGGTGGTAGAGACGGTAAATCCTGCCTCTGGTTTGTTGGCGAC  1200
New    1621  GGTAACGGTTTACTTTCAGTTGACCAAGAGATAGGCTCATATGAGGTGGTAGAACCGGAG  1680
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Old    1621  GGTAACGGTTTACTTTCAGTTGGCCAAGAGATAGGCTCATATGAGGTGGTAGAACCGGAG  1680
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
PPM2/YOL141WNucleotide change(s) in the coding region of PPM2/YOL141W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 417 is now Leucine rather than Methionine.
New    1201  TTTTACATGGGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGTTGAGTATACAC  1260
             |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Old    1201  TTTTACATGGGAGGTAGTAACCCATACAGAGTAAACGAAATATTACAGATGAGTATACAC  1260
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
RRP40/YOL142WNucleotide change(s) in the coding region of RRP40/YOL142W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 160 is now Leucine rather than Phenylalanine.
New    421  ACAGGACGCGATGCTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTG  480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Old    421  ACAGGACGCGATGCTGGTTTCGGGATATTGGAAGATGGTATGATCATTGACGTGAATTTC  480
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
CTR9/YOL145CNucleotide change(s) in the coding region of CTR9/YOL145C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 197 is now Lysine rather than Glutamic Acid, residue 674 is now Glutamic Acid rather than Glycine, residue 786 is now Arginine rather than Threonine, residue 903 is now Glutamic Acid rather than Lysine, residue 907 is now Serine rather than Arginine, residues 956-959 are now LIQE rather than IFQV, and residue 987 is now Lysine rather than Glutamine.
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
ORT1/YOR130CNucleotide change(s) in the coding region of ORT1/YOR130C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 105 is now Serine rather than Phenylalanine.
New    301  CATACAAACGTTTCCCCGTTGGGGCAAATCCTGATCTCTGGTGGAGTAGCGGGTTCATGT  360
            ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Old    301  CATACAAACGTTTTCCCGTTGGGGCAAATCCTGATCTCTGGTGGAGTAGCGGGTTCATGT  360
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SFL1/YOR140WNucleotide change(s) in the coding region of SFL1/YOR140W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 446-462 are now FVQYQPQSQQHVTYAKQ rather than LYNTNRSRNQHVTYASE.

New    1321  CCGCCCTCGCAACTTTTTGTACAATACCAACCGCAGTCGCAA-CAACATGTGACTTATGC  1379
             ||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||
Old    1321  CCGCCCTCGCAAC-TTTTGTACAATACCAACCGCAGTCGCAACCAACATGTGACTTATGC  1379
New    1380  GAAGCAACCGGCACATGTACCAAACTTTATCAATCAGCCGATACCCATCCAACAACTACC  1439
             ||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    1380  GAGCGAACCGGCACATGTACCAAACTTTATCAATCAGCCGATACCCATCCAACAACTACC  1439
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
SMP3/YOR149CNucleotide change(s) in the coding region of SMP3/YOR149C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residues 122-123 are now IK rather than MQ.
New    361   TTCATCaaaaaaaGTCTACTTTTAACTTCTTACGTAACCTGGACGTACCAAACACACACG  420
             |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
Old    361   TTCATGCAAAAAAGTCTACTTTTAACTTCTTACGTAACCTGGACGTACCAAACACACACG  420
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
TIM18/YOR297CNucleotide change(s) in the coding region of TIM18/YOR297C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 137 is now Glutamic Acid rather than Glycine.
New    361  TATTTACAGTATGGCTTCACAAGTTGTATTATTGACTATATACCGAAGGAAAAGTATCCA  420
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Old    361  TATTTACAGTATGGCTTCACAAGTTGTATTATTGACTATATACCGAAGGGAAAGTATCCA  420
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MCH5/YOR306CNucleotide change(s) in the coding region of MCH5/YOR306C resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 495 is now Cysteine rather than Serine.

New    1441  TCTATCAAGACAACGGCCGATTACCAACACTATATTATTTTTTGCGGTTTGGCAACTTTT  1500
             ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Old    1441  TCTATCAAGACAACGGCCGATTACCAACACTATATTATTTTTTCCGGTTTGGCAACTTTT  1500
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
MMT2/YPL224CTwo nucleotide changes were made within the ORF MMT2/YPL224C, altering its coding sequence: one single nucleotide substitution near the 5' end, and one single nucleotide insertion near the 3' end. The start and majority of the reading frame remain the same, but the C-terminus has changed, and the annotated protein is now 35 amino acids longer.
New: 1    ATGCTACGGATAAGTATTGACTCTATCAAGCAATTCGGTTCCTTTGTGCCAGGTTATAAC 60
          |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Old: 1    ATGCTACGGATAAGTATTGACTCTATCAAGCAATTCGGTTCCTTTGTGACAGGTTATAAC 60
New: 1321 GGGAAGGTGGACGTCGAGTTTGTTGATGTAA 1351
          || |||||||||||||||||||||||||||| 
Old: 1321 GG-AAGGTGGACGTCGAGTTTGTTGATGTAA 1350
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
GLN1/YPR035WNucleotide change(s) in the coding region of GLN1/YPR035W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 251 is now Threonine rather than Alanine, and residue 264 is now Methionine rather than Threonine.
New    721   AAGGGTGACTGGAACGGTGCCGGTTGTCACACTAACGTTTCCACCAAGGAAATGAGACAA  780
             |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Old    721   AAGGGTGACTGGAACGGTGCCGGTTGTCACGCTAACGTTTCCACCAAGGAAATGAGACAA  780
New    781   CCAGGTGGTATGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAA  840
             |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Old    781   CCAGGTGGTACGAAATACATCGAACAAGCCATCGAGAAGTTATCCAAGAGACACGCTGAA  840
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
YPR097WNucleotide change(s) in the coding region of YPR097W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 848 is now Serine rather than Glycine.
New    2521  AAAAATTTTGAGAAGTTCATGAGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGT  2580
             ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Old    2521  AAAAATTTTGAGAAGTTCATGGGTGATTTGATCAGGCTTGTTGATGATGTTATCAATGGT  2580
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry
THI22/YPR121WNucleotide change(s) in the coding region of THI22/YPR121W resulted in an altered protein sequence. The start, stop, and reading frame remain the same, but protein residue 95 is now Glutamine rather than Histidine.
New    241   ACTACTTTGACTGCTCAAACTCCAGTGAAGGTGTACGGCGCTCAAAATATACCAAAGAAA  300
             |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Old    241   ACTACTTTGACTGCTCAAACTCCAGTGAAGGTGTACGGCGCTCATAATATACCAAAGAAA  300
Dietrich F (2011) Personal Communication, An updated S. cerevisiae reference genome: Resequencing of S288C using NextGen sequencing technology.
SGD Papers Entry